ID: 925387443

View in Genome Browser
Species Human (GRCh38)
Location 2:3472040-3472062
Sequence CTGCAGGAGTGGTGGGAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 557
Summary {0: 1, 1: 0, 2: 4, 3: 36, 4: 516}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925387432_925387443 24 Left 925387432 2:3471993-3472015 CCAAAGGTCAGAGCCCAAGGTGA 0: 1
1: 0
2: 2
3: 30
4: 165
Right 925387443 2:3472040-3472062 CTGCAGGAGTGGTGGGAAGTTGG 0: 1
1: 0
2: 4
3: 36
4: 516
925387435_925387443 11 Left 925387435 2:3472006-3472028 CCCAAGGTGATCAGGCAGGAGAA 0: 1
1: 0
2: 2
3: 44
4: 413
Right 925387443 2:3472040-3472062 CTGCAGGAGTGGTGGGAAGTTGG 0: 1
1: 0
2: 4
3: 36
4: 516
925387430_925387443 30 Left 925387430 2:3471987-3472009 CCTGGACCAAAGGTCAGAGCCCA 0: 1
1: 0
2: 0
3: 21
4: 205
Right 925387443 2:3472040-3472062 CTGCAGGAGTGGTGGGAAGTTGG 0: 1
1: 0
2: 4
3: 36
4: 516
925387436_925387443 10 Left 925387436 2:3472007-3472029 CCAAGGTGATCAGGCAGGAGAAA 0: 1
1: 5
2: 92
3: 1929
4: 7738
Right 925387443 2:3472040-3472062 CTGCAGGAGTGGTGGGAAGTTGG 0: 1
1: 0
2: 4
3: 36
4: 516

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925387443 Original CRISPR CTGCAGGAGTGGTGGGAAGT TGG Intronic
900484159 1:2913640-2913662 CTCCAGGGGTGGTGGGAGGAAGG - Intergenic
900671613 1:3857936-3857958 CTGCCCGAGAGGTGGGAAGAGGG - Intronic
900707103 1:4087680-4087702 ATGCAGCAGTGCTGGGAGGTGGG - Intergenic
900795609 1:4706487-4706509 CTGGAGGAGTCACGGGAAGTGGG + Intronic
900799042 1:4726439-4726461 TTCCAGGAGTTGTGGGGAGTGGG + Intronic
901691498 1:10976257-10976279 CTGCGGGAGAGGAGGGAAGGGGG + Intronic
901801145 1:11708696-11708718 CTGCAAGAGCTCTGGGAAGTGGG - Intronic
901849588 1:12007047-12007069 CTGCAGGTGTGGAAGGCAGTGGG + Exonic
902396083 1:16133066-16133088 GTGCAGGTGTGGGGGGAAGGTGG + Intronic
902645686 1:17796375-17796397 CTGCTGGAGTGATGGGCAGCTGG + Intronic
902703624 1:18189958-18189980 CTGCTGCAGGGGTGAGAAGTGGG + Intronic
902737245 1:18409237-18409259 CTGCAGGTGGGAGGGGAAGTAGG - Intergenic
903320362 1:22539314-22539336 TTGCAGGACTGGGGGGAAGCTGG - Intergenic
903332280 1:22602305-22602327 CTCCAGGTGTGGGGGGACGTAGG - Exonic
903892298 1:26577801-26577823 ATGCAGAAGTGGGGGGAAGGAGG - Intergenic
904975556 1:34453475-34453497 ATGCAACAGTGTTGGGAAGTAGG - Intergenic
904983066 1:34522967-34522989 TTGCAGGACTGCAGGGAAGTTGG + Intergenic
904991819 1:34599168-34599190 AGGCAGGAGTGGTGGGAGGCAGG - Intergenic
905827315 1:41035639-41035661 CTTCAGGAGTGGTGGGATCAAGG - Intronic
906528230 1:46508819-46508841 CTGCAGGGGTGGTGGGGGGTGGG - Intronic
906841819 1:49147382-49147404 ATGCAGCAGTGGTGTGAAATTGG - Intronic
907083333 1:51644965-51644987 CTGCAACAGTGTTGGGAAGTGGG + Intronic
907538206 1:55185067-55185089 CTGCTGGGGAGCTGGGAAGTGGG - Intronic
908717587 1:67086974-67086996 TTGCAGGAGTGATGGGGATTGGG + Intergenic
908804107 1:67912315-67912337 GTGCAACAGTGCTGGGAAGTAGG + Intergenic
909488000 1:76195756-76195778 CTGGAGGAATGTTGGGGAGTAGG - Intronic
913965990 1:143377937-143377959 CTGGGGGAGAGGTCGGAAGTGGG - Intergenic
914060364 1:144203545-144203567 CTGGGGGAGAGGTCGGAAGTGGG - Intergenic
914118786 1:144762824-144762846 CTGGGGGAGAGGTCGGAAGTGGG + Intergenic
914973097 1:152329296-152329318 CTGTAGGAGTGAAGGGGAGTTGG + Intergenic
915562037 1:156693129-156693151 CTTCAAGTGTGGTGGGAGGTGGG - Intergenic
916328010 1:163585015-163585037 GTGCAACAGTGTTGGGAAGTGGG - Intergenic
916898835 1:169198701-169198723 CTGAGGGTGAGGTGGGAAGTAGG + Intronic
918975582 1:191480997-191481019 ATGCAGGAGTGGTGAGGAGGTGG - Intergenic
919611922 1:199756215-199756237 TTGCAGGAGTTAGGGGAAGTTGG + Intergenic
920234523 1:204494121-204494143 CTGCTGGAGTGGAGTGGAGTGGG + Intronic
920575878 1:207059944-207059966 GGGAAGCAGTGGTGGGAAGTGGG + Intronic
920756582 1:208739407-208739429 CTGCAGGATAGGGGTGAAGTAGG - Intergenic
921295263 1:213695392-213695414 CTGGAGGAGTGGTGGAGAGGTGG + Intergenic
921456436 1:215377586-215377608 CTGCAGAATTGGAGGGAACTTGG + Intergenic
922663698 1:227451455-227451477 CTGCAGAGGTGGTGGGTACTTGG + Intergenic
922818961 1:228470994-228471016 GTGCAGGAGTGTTGGGATGCTGG - Intergenic
923109024 1:230876327-230876349 CGGAATGAGGGGTGGGAAGTAGG + Intergenic
923291271 1:232548656-232548678 CTGCAGGAGTAGTGAAAAGAGGG + Intronic
923523308 1:234752803-234752825 ATGGAGGGGAGGTGGGAAGTAGG + Intergenic
923678457 1:236100182-236100204 ATGCAGAGGTGGTGGGAAGAAGG - Intergenic
924826030 1:247539941-247539963 TGGGAGAAGTGGTGGGAAGTGGG - Intronic
1063135871 10:3215630-3215652 CTTCAGGAGTCTTGGCAAGTTGG - Intergenic
1064016070 10:11773272-11773294 ATGGAGGACTGGTGGGAAGGTGG - Intergenic
1064359968 10:14655691-14655713 CAGGAGGAGAGGTGGGAAGCCGG + Intronic
1066048959 10:31618179-31618201 CTGCAGGAAGGGTGGGAGGTGGG - Intergenic
1066502524 10:36007928-36007950 CTGCAGGAGCAGTGGGCAGTGGG + Intergenic
1066538959 10:36423216-36423238 ATGCAGGAGTGGAAGGAGGTAGG - Intergenic
1067735757 10:48848925-48848947 GTGCAGGACAGGTGGCAAGTGGG + Intronic
1068927427 10:62554767-62554789 CTGCAAGAGTGTTGAGATGTTGG + Intronic
1069619261 10:69826406-69826428 CTGCAGCAGTGGTGGCATGGGGG + Intronic
1069667642 10:70174163-70174185 CAGAAGGAGTGGTAGGAAATGGG + Intergenic
1070660948 10:78304835-78304857 CACCAGGACTGGTGGGCAGTGGG - Intergenic
1072917283 10:99545925-99545947 CCTCAGGAGTGCTGGAAAGTGGG - Intergenic
1073480110 10:103781037-103781059 CTGCAGGAGTGATGGGGAGGAGG - Intronic
1074221827 10:111445559-111445581 AAGCAGGAGTGTTGGGATGTAGG + Intergenic
1074291361 10:112140134-112140156 ATGCAGATGGGGTGGGAAGTGGG - Intergenic
1074412461 10:113240137-113240159 CTGCAGGAGGAGTGGGAGGGAGG - Intergenic
1076225503 10:128771635-128771657 CTGGAGGAGTGGTGGGAAGGGGG + Intergenic
1076257197 10:129037048-129037070 TGGCAGTAGTGGTGGGAAGTAGG + Intergenic
1076298701 10:129407274-129407296 CTGGAGGAGAGGTGGAAGGTTGG - Intergenic
1076483873 10:130803110-130803132 CTGCTGGTGGGGTGGGCAGTGGG + Intergenic
1076523012 10:131092858-131092880 CTGCAGGACTGTGGGGAAGCAGG - Exonic
1076723516 10:132403047-132403069 CTGCAGCAGCCGTGGGAAGCGGG - Intronic
1077325263 11:1961025-1961047 TTGCAGGAAAGGTGGGAGGTGGG - Intronic
1077985578 11:7347992-7348014 CTGGAGGAGTGAGGGGAAGGGGG + Intronic
1078187206 11:9062165-9062187 CTGAAGGAGTTGGGGGAAGAGGG - Intronic
1078997123 11:16713785-16713807 CTGCAGGAGTGGAAGGAGCTGGG - Intronic
1079248005 11:18767368-18767390 CTGCAGGAGTGCTGGGCTCTAGG - Intronic
1079945178 11:26732917-26732939 CAGCTGGAGTGGTGGGATGCAGG - Intergenic
1081907897 11:46680748-46680770 CTGTAGGAGTAGAGGGAGGTGGG + Intronic
1082766143 11:57169545-57169567 CTACTGGAGTTGTGGGAAGAGGG - Intergenic
1083312086 11:61789088-61789110 CTGCAGGGGTGGTGGGTGCTGGG - Exonic
1083637887 11:64130086-64130108 CTGCAGCAGTGGTGTGGGGTAGG - Intronic
1084129011 11:67119206-67119228 CTGGAGGAGGGGTGGGGAGGTGG + Intergenic
1084559816 11:69897442-69897464 GTGCAGCAGTATTGGGAAGTGGG - Intergenic
1084617032 11:70243289-70243311 CTGCAGCAGAGCAGGGAAGTGGG + Intergenic
1084798210 11:71523524-71523546 ATGCAAGAGTGTTGGGAGGTGGG - Intronic
1084906778 11:72354605-72354627 ATGCAGGTGTGGTGGGAGGGAGG - Intronic
1085503304 11:77041269-77041291 CTGGGGTAGTGGTGGGAAGAAGG - Exonic
1086211955 11:84331568-84331590 CGGCAGGGGAGGTGGGCAGTGGG + Intronic
1086254493 11:84859070-84859092 CTGCAGGAGTCCTATGAAGTAGG - Intronic
1087267488 11:96076698-96076720 CTGCATGAGTTGTGGGGTGTGGG - Intronic
1087271517 11:96116626-96116648 CTGCAGGATTGGGAGGAAGAAGG + Intronic
1088018107 11:105084627-105084649 CAGCAGGAGAGGTGGGGAGAAGG - Intronic
1088502545 11:110497166-110497188 CTTCAAGGGTGGTGGGAATTGGG + Intergenic
1088865138 11:113840178-113840200 CTACAGGATTGGTGGGCAGTTGG - Intronic
1088915621 11:114225660-114225682 ATGCAGCAGTGTTGGGAGGTGGG - Intronic
1090249322 11:125240397-125240419 CTGCAGGAGAGGTGGCTATTTGG + Intronic
1090385686 11:126356391-126356413 CTGCATGGGTGGTGAGCAGTGGG + Intronic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1091303531 11:134523141-134523163 CTGCTGGGGAGGTGGGAAGGGGG - Intergenic
1091360685 11:134976680-134976702 GTGCAGGAGTGGCCTGAAGTGGG + Intergenic
1202808244 11_KI270721v1_random:16204-16226 TTGCAGGAAAGGTGGGAGGTGGG - Intergenic
1091583123 12:1800601-1800623 CTGCAGGGCAGGTGGGAGGTGGG - Intronic
1091714923 12:2770231-2770253 CTGCAGGCATGGAGGGCAGTGGG - Intergenic
1091989901 12:4946869-4946891 CTGCACTAGTGATGGGAAGAAGG - Intergenic
1092155537 12:6279422-6279444 CTGCAGGCTGGGTGGGTAGTTGG - Intergenic
1092727517 12:11500005-11500027 CTGCAGGTCTGGTGGGATGTGGG - Intronic
1093494521 12:19740864-19740886 CTGGAGCAGTGGTGGTAGGTTGG - Intergenic
1093599391 12:21002948-21002970 CGGCAGGGGTGGGGGCAAGTTGG - Intergenic
1094524537 12:31222914-31222936 CTGCAGGTCTGGTGGGATGACGG + Intergenic
1095475729 12:42585661-42585683 CTTCAGGAGAGAGGGGAAGTGGG + Intronic
1095529836 12:43173968-43173990 GTGCAACAGTGTTGGGAAGTGGG + Intergenic
1095751274 12:45713880-45713902 GTTCATGAGTGGTGGGAAGGAGG - Intergenic
1095897942 12:47299661-47299683 CTGCAGCAGTGATGGGGAGAGGG - Intergenic
1095904789 12:47366734-47366756 GTGAAGAAGGGGTGGGAAGTGGG - Intergenic
1096240610 12:49958024-49958046 CTCCAGGGGTGGAGGGAAATTGG + Exonic
1096495562 12:52037452-52037474 CTGCCGGGGTGGCGGGAGGTGGG + Intronic
1096785709 12:54016170-54016192 CAGCAGGAGAGGTGAGAATTGGG - Intronic
1097012269 12:55961610-55961632 CTGCTGGAGAGGTAGGAACTTGG - Exonic
1097220679 12:57449096-57449118 ATGCAGTGGTGTTGGGAAGTGGG - Intronic
1097959229 12:65516180-65516202 CAGCAGAAGTGATGGGAAGGTGG - Intergenic
1098115460 12:67171761-67171783 ATGCAGCAGTGTTGGGAGGTGGG + Intergenic
1100269110 12:93006778-93006800 TTCCAGGATTGGTGCGAAGTAGG - Intergenic
1100849706 12:98696473-98696495 CTGTGGCAGTGTTGGGAAGTAGG - Intronic
1101044338 12:100789082-100789104 TTCCATGAGTGGTGGGAAGAAGG - Intronic
1101505461 12:105342175-105342197 ATGCAGTAGTGTTGGGAGGTGGG + Intronic
1102582321 12:113897725-113897747 CTGCAGGAGTGGTGGCCTCTAGG - Intronic
1102590253 12:113951215-113951237 CTGCAGGAGAGCTGGGGAGGAGG - Intronic
1102710639 12:114923327-114923349 CTGCAAGGGAGGTGGGAACTGGG + Intergenic
1103729791 12:123019884-123019906 CTGCAGGGGAGCTGGGAGGTGGG + Intronic
1103963449 12:124623363-124623385 CTGGAGGAGAGGTGGGACGGGGG + Intergenic
1104908468 12:132228192-132228214 CTGCATGAGTGGAGGGCAGAGGG - Intronic
1105223876 13:18409174-18409196 GTGGAGGAGTGGTGGGCAGCGGG + Intergenic
1105354827 13:19650700-19650722 CTACAGTAGTGGTGGGGAGGAGG + Intronic
1105664844 13:22542440-22542462 CTGCAGGAGTGGTAGTGAATAGG + Intergenic
1106507402 13:30383109-30383131 CACCAGGTGTGGTGGGAAGCAGG + Intergenic
1108243997 13:48497006-48497028 CTGCAGTAGTGGTGGGGATGGGG - Intronic
1108697760 13:52917758-52917780 ATGCAGCAGTGTTGGGAGGTAGG - Intergenic
1109023372 13:57129032-57129054 ATGCAGCAGTGCTGGGAGGTGGG + Intergenic
1109835562 13:67852073-67852095 CTATAGTAGTAGTGGGAAGTGGG + Intergenic
1109907608 13:68865499-68865521 CTGCAGCAGTGGGTGGAGGTGGG - Intergenic
1110076828 13:71256405-71256427 ATGCAATAGTGTTGGGAAGTGGG - Intergenic
1110487285 13:76061370-76061392 ATGCAACAGTGTTGGGAAGTGGG + Intergenic
1110994164 13:82084298-82084320 ATGCAGCAGTGTTGGGAGGTGGG - Intergenic
1113314150 13:109160900-109160922 CTGCTGAAGTGCTGGGTAGTGGG + Intronic
1113553382 13:111211104-111211126 CTTCAGGCGTGGTGGGCGGTGGG + Intronic
1113559518 13:111266962-111266984 CTGCATGAGGGGTGACAAGTCGG - Intronic
1113646728 13:112002708-112002730 CTGCACCAGTGGTGCAAAGTCGG - Intergenic
1113730536 13:112638192-112638214 CTGCAGCAGAGGTGGCCAGTGGG - Intergenic
1113887644 13:113669359-113669381 CTGCAGGATTGCTGGGCAGGCGG + Intronic
1115118853 14:29915552-29915574 ATGCTGAAGGGGTGGGAAGTGGG + Intronic
1116416343 14:44682166-44682188 ATGCAGCAGTGTTGGGAGGTGGG - Intergenic
1117753057 14:58943668-58943690 CTCCAGGAGAGGTGAAAAGTGGG + Intergenic
1119128137 14:72147560-72147582 ATGCAACAGTGTTGGGAAGTGGG - Intronic
1119522484 14:75296162-75296184 CTGCAGGACGGGAGGGCAGTTGG - Intergenic
1119709258 14:76809505-76809527 CTGCAGCAGTGGCGAGAAGAAGG - Exonic
1120518706 14:85500970-85500992 ATGCAATAGTGTTGGGAAGTGGG + Intergenic
1121078766 14:91090704-91090726 CTCCAGGACTGATGGGAAGAAGG + Intronic
1121520117 14:94580553-94580575 CTGCAGGTGGGGTGTGGAGTTGG - Intronic
1121779149 14:96610727-96610749 CAGGAGGACTGGTGGAAAGTTGG - Intergenic
1121863001 14:97337083-97337105 CTGCAGCAGGGCTGGGAACTAGG + Intergenic
1121892279 14:97605366-97605388 GTGCAGGAGAGGTGGGAAAGTGG - Intergenic
1122160592 14:99781404-99781426 GGGCAGGAGTGGTGGGGTGTAGG - Intronic
1122245123 14:100397029-100397051 CTGCTGGAGGGGTGGCAAGGTGG + Intronic
1122774562 14:104111530-104111552 CTGCAGGTGTGGTGGCAGGCAGG + Exonic
1122804289 14:104248810-104248832 GCCCAGGAGAGGTGGGAAGTGGG + Intergenic
1123632051 15:22268301-22268323 GTGCAGCAGTGTTGGGATGTGGG + Intergenic
1123726905 15:23112277-23112299 CTGGAGCAGTGGTGGGAACGTGG + Intergenic
1123813910 15:23957067-23957089 CTGCAGTAGTTGAGGGAAGTAGG + Intergenic
1123997764 15:25730554-25730576 CTGCAGGAGTGGGTGGGTGTAGG - Intronic
1126216305 15:46158242-46158264 CTGCAGTAGTGGTGGCTACTGGG + Intergenic
1126765219 15:52004806-52004828 ATGCAGCAGTGTTGGGAGGTGGG - Intronic
1127221743 15:56887409-56887431 AGGCAGGGGTGGCGGGAAGTGGG + Intronic
1127261671 15:57331285-57331307 GTGCAGGATAGGTGGGAAGCAGG + Intergenic
1128511508 15:68316454-68316476 CTGCAGGAGTGGCTGGGCGTGGG + Intronic
1129331985 15:74832452-74832474 AGGCAGGGGTGGTGGGCAGTGGG + Intergenic
1129688627 15:77700609-77700631 CTGCAGGCGGGGTGGTAGGTGGG + Intronic
1129739254 15:77982039-77982061 CTGCGGCAGAGGTGAGAAGTGGG + Intergenic
1129785413 15:78306854-78306876 CCGCAGGAGGGGAGGGAAGAGGG - Intergenic
1129846700 15:78771150-78771172 CTGCGGCAGAGGTGAGAAGTGGG - Exonic
1130149545 15:81300707-81300729 CTTCAGGAGGGCTGGGAGGTAGG + Intronic
1130976925 15:88783519-88783541 CTTCAGGTGTGGTGTGAAATTGG + Intergenic
1131260366 15:90884564-90884586 CTGGAGGAGCGGTGGGAGCTGGG + Intronic
1131400779 15:92124042-92124064 CTGCAGGAGGGGCTGGCAGTGGG + Intronic
1131541297 15:93277530-93277552 CTGCAAGAGTGGAGGGACATTGG + Intergenic
1131578268 15:93614031-93614053 CTGGAGGAGAGGAGGGAGGTGGG + Intergenic
1131754849 15:95548703-95548725 CTGCAGGAGAGGTGGGCACTTGG - Intergenic
1132079235 15:98851038-98851060 CTGCAGGAGTGCTCCGAAATCGG - Intronic
1132538683 16:497006-497028 CTGAAGGAGTGTTGGGAAAGGGG + Intronic
1132804447 16:1769162-1769184 CTCCAGGGGTGCTGGGGAGTAGG - Exonic
1133507777 16:6429307-6429329 CAGCAGCAGTGGTGGGGAGCTGG - Intronic
1133789713 16:9000098-9000120 CTGGGGGGGTGGTGGGGAGTTGG + Intergenic
1133817766 16:9211273-9211295 CTGCAGGAGTGATGGGGTGAAGG - Intergenic
1135411254 16:22236296-22236318 CTGCAGGAGGGGAGAGTAGTTGG + Intronic
1135580057 16:23617897-23617919 CTTCTAGAGTGCTGGGAAGTTGG - Intronic
1135657354 16:24262510-24262532 GTGCAGTGGTGGTGGGGAGTTGG - Intronic
1135983117 16:27164018-27164040 CTGCAGCAGGGAAGGGAAGTAGG + Intergenic
1138588717 16:57987667-57987689 CTGGAGGACTGGTGGGGGGTTGG + Intronic
1139939730 16:70596562-70596584 CTGAGGCAGTGGTGGGAAATGGG - Intronic
1140264411 16:73408047-73408069 CTGCAGGAGTGGATGGGGGTGGG + Intergenic
1140731652 16:77862045-77862067 CTGCAAGAGCGCTGTGAAGTAGG + Intronic
1140747418 16:77993486-77993508 CTACAGGATTGGTGGGCAGATGG - Intergenic
1140782767 16:78311654-78311676 CTGTAGGAGAGATGGGGAGTAGG + Intronic
1141378824 16:83557002-83557024 CAGCAGGAGAGGTGAGCAGTGGG + Intronic
1141928453 16:87184568-87184590 GTGCAGGAAAGGTGGGGAGTGGG + Intronic
1142694031 17:1623594-1623616 CTGGAGGAGAGGAGAGAAGTGGG - Intronic
1143417223 17:6758856-6758878 CTGCAGGAGAGATGGGATCTGGG + Intronic
1144417028 17:15058216-15058238 TTGAATGAGAGGTGGGAAGTGGG + Intergenic
1144833991 17:18147446-18147468 CTGCAGGAGATGTAGGATGTGGG + Intronic
1144847555 17:18227823-18227845 GGGCAGCAGTGGTGGAAAGTGGG + Intronic
1146004957 17:29155330-29155352 CTGCATGTGTGGTGGGGAGGAGG - Intronic
1146470012 17:33116626-33116648 CTCCAGGAATGGTGGGGGGTGGG + Intronic
1147426845 17:40349889-40349911 CTGCAGAAGTGCTTTGAAGTGGG + Exonic
1147512412 17:41082224-41082246 ATGCAGCAGTGTTGGGAGGTGGG + Intergenic
1147861136 17:43524243-43524265 CTGGAGACGGGGTGGGAAGTGGG - Exonic
1148210642 17:45806539-45806561 CTGGAGGAAGGGAGGGAAGTGGG + Intronic
1148533109 17:48414308-48414330 CTGGGGGAAAGGTGGGAAGTTGG + Intronic
1148587376 17:48790669-48790691 TTGTAGGTGTGGTGGGAAGAGGG - Intronic
1149730819 17:58944483-58944505 CTGGAGGGGTGGTGGGAATGAGG - Intronic
1149734655 17:58981317-58981339 CTGAAGGGATGGTGGGAAGGGGG - Exonic
1150495363 17:65603941-65603963 ATGCAGCAGTGTTGGGAGGTGGG - Intronic
1151370048 17:73642145-73642167 CAGCAGGAGGGGTGGGATCTTGG + Intronic
1151500718 17:74486687-74486709 GTGCAGGAATGGTGGGAATGGGG - Intergenic
1151546533 17:74796733-74796755 TTGCAGGTCTGGTGGGAATTTGG + Intronic
1151563773 17:74885604-74885626 GTGCAGGAGTGGTGGGCAGCAGG - Intronic
1151991772 17:77579674-77579696 CTGCAGGGGAGGGGGTAAGTGGG - Intergenic
1152069826 17:78128902-78128924 CAGGAGGAGGGGTCGGAAGTTGG - Intronic
1152336945 17:79703951-79703973 CTGCAGGAGTGGGGGGTAGGAGG + Intergenic
1152871041 17:82752959-82752981 CTGCAGGCGGGGTGGGGTGTAGG + Intronic
1153181116 18:2434841-2434863 ATGGAGAAGTGTTGGGAAGTGGG + Intergenic
1153612689 18:6902697-6902719 GTGCACCACTGGTGGGAAGTGGG + Intronic
1153827909 18:8893670-8893692 CTGGAGGAGAGGAGGGAAGGGGG + Intergenic
1154064949 18:11098582-11098604 GTGCAGCAGTGTTGGGAGGTGGG + Intronic
1156371314 18:36473974-36473996 CTACAGGAAGGGTGGGATGTGGG - Intronic
1156415300 18:36881605-36881627 AGGAAGGATTGGTGGGAAGTGGG - Intronic
1156734275 18:40234328-40234350 CTGCAGGGGAGTTGGGAGGTGGG + Intergenic
1157275043 18:46304360-46304382 CTGGAGAAGCTGTGGGAAGTAGG + Intergenic
1157795909 18:50575048-50575070 ATGCAACAGTGTTGGGAAGTGGG + Intronic
1158871434 18:61692222-61692244 CAGCAGGTGGGGTGGGGAGTTGG + Intergenic
1158904743 18:62001150-62001172 CTAGTGGAGTGGTGGGAAGGAGG - Intergenic
1159454574 18:68644539-68644561 CTGCAACAGTGTTGGGAGGTGGG + Intergenic
1159609492 18:70510104-70510126 CTGCAGGATGGGTGGGTAGAAGG + Intergenic
1161431201 19:4233369-4233391 CTGGAGGACAGGTGGGAGGTGGG - Intronic
1161668470 19:5590895-5590917 CTGGTGGAGAGGTGGGAGGTGGG - Intronic
1162021201 19:7869395-7869417 CGGCACGAGCGGTGGGAAGGCGG - Exonic
1162147893 19:8624471-8624493 GTGCAACAGTGTTGGGAAGTGGG + Intergenic
1163546005 19:17941915-17941937 CTGCAGGAGTGCCAGGCAGTGGG + Intronic
1165840803 19:38788274-38788296 CTGCAAAATTGGTGGGAAGATGG + Intergenic
1166259298 19:41626863-41626885 CTCTGGGAGTGGTGGGAAGAGGG - Intronic
1166305138 19:41933043-41933065 CTGCAGAATTGGTGGGCAGATGG + Intergenic
1166553515 19:43683098-43683120 GTGCAGGAGAGGTGAGAAGATGG - Intergenic
1167281677 19:48572832-48572854 AGGCAGGAGGGCTGGGAAGTTGG + Intronic
1168431041 19:56280830-56280852 ATGCAGCAGTGTTGGGAGGTGGG - Intronic
1168547536 19:57266069-57266091 CTGGAGCAGTGGTGCGAACTCGG + Intergenic
1202699768 1_KI270712v1_random:155430-155452 CTGGGGGAGAGGTCGGAAGTGGG - Intergenic
925072178 2:978223-978245 ATGCGGGAGTGATGGGGAGTTGG + Intronic
925129796 2:1486786-1486808 CTCCAGGCGTAGTGGGGAGTGGG + Intronic
925287290 2:2724153-2724175 GTGCAGCGGTGCTGGGAAGTGGG - Intergenic
925372635 2:3358120-3358142 CTGCCGAGGAGGTGGGAAGTGGG - Intronic
925387443 2:3472040-3472062 CTGCAGGAGTGGTGGGAAGTTGG + Intronic
925407139 2:3613161-3613183 CTGCAGGCGGGGAGGGAGGTAGG + Intronic
925636170 2:5943004-5943026 CTGAAGGAGAGATGGGAGGTTGG - Intergenic
926283774 2:11471406-11471428 ATGCAACAGTGCTGGGAAGTGGG - Intergenic
926726699 2:16004290-16004312 CTGCATGAGATGTGGGGAGTGGG + Intergenic
926909668 2:17840351-17840373 CAGCAGAAGTGGGTGGAAGTGGG - Intergenic
927667116 2:25040689-25040711 CTGCAGGACTGTTGGGAAACTGG - Intergenic
927888004 2:26730360-26730382 TTGCAGGTGTGGTGGGCAGAGGG - Exonic
928294841 2:30073552-30073574 AGGCAGGGGAGGTGGGAAGTAGG + Intergenic
928581008 2:32707414-32707436 ATGCAACAGTGGTGGGAGGTGGG - Intronic
929217019 2:39425100-39425122 CTGGGGGGGTGGTGGGGAGTGGG - Intronic
929411811 2:41705162-41705184 AAGCAGGAGTGGTGGGCAGGAGG - Intergenic
930036898 2:47091608-47091630 ATGCAGGAGTTAGGGGAAGTGGG + Intronic
930122328 2:47770094-47770116 CTGCAATGGTGTTGGGAAGTGGG + Intronic
930771455 2:55134320-55134342 CAGGAGGAGTGGGGGGAAGAGGG - Intergenic
931409942 2:62019552-62019574 GTGCAGCAGTGTTGGGAGGTAGG - Intronic
931464066 2:62471644-62471666 CTGAAGGAGTGCTGGGGAGGGGG + Intergenic
932340017 2:70957679-70957701 CTGCAGCAGCCGTGGGAAGTAGG + Intronic
932736910 2:74260662-74260684 TTGAAGTACTGGTGGGAAGTAGG - Intronic
934617730 2:95785292-95785314 AAGCAGGTATGGTGGGAAGTTGG + Intergenic
934643163 2:96039267-96039289 AAGCAGGTATGGTGGGAAGTTGG - Intronic
934853041 2:97713286-97713308 AGGCAGCAGTGGTGGGAAGGAGG - Intergenic
937649346 2:124302660-124302682 GTGCAAGAGTGTTGGGAGGTGGG - Intronic
937675904 2:124589924-124589946 ATGCAGCAGTGTTGGGAGGTGGG + Intronic
937901659 2:127024713-127024735 CTGCAAGACTCGTGGGAAGGAGG + Intergenic
938110345 2:128560074-128560096 CTGCAGGAGTGGTCACAGGTGGG + Intergenic
938645543 2:133326401-133326423 GTGCAGTAGTGGTGTGAACTCGG - Intronic
938779862 2:134575338-134575360 CAGCAGGAATGGTGGGCACTGGG - Intronic
939280275 2:140055139-140055161 CTGCAGGAGTGGGGGTAGGGTGG - Intergenic
939881921 2:147640844-147640866 CTGGAGGAAGGGTGGGATGTAGG + Intergenic
940123206 2:150291952-150291974 ATGCAACAGTGTTGGGAAGTGGG - Intergenic
940518570 2:154713475-154713497 CAGCAGGAGTGGTGGGGGGAGGG + Intronic
940782334 2:157945983-157946005 CTTTAGGAGTGATGGTAAGTGGG - Intronic
941703122 2:168626881-168626903 CTGCAGGAGGGGAGGAATGTTGG - Intronic
942259985 2:174150119-174150141 ATGCAGCAGTGTTGAGAAGTGGG + Intronic
942704068 2:178748176-178748198 CTGCAGATGAGGTTGGAAGTAGG + Intronic
944288782 2:197980206-197980228 GAGCAGGCGAGGTGGGAAGTGGG + Intronic
944303475 2:198152289-198152311 ATGCCAGAGTGTTGGGAAGTGGG - Intronic
944693281 2:202177763-202177785 ATGCAGCAGTGTTGGGAGGTGGG - Intronic
944763613 2:202841787-202841809 ATGCAGGAGTGGAGGCAGGTGGG + Intronic
945874880 2:215267774-215267796 GTGCTGGAGAGGTGGGAAGCGGG - Intergenic
945930523 2:215850433-215850455 AACCAGGAGTGGTCGGAAGTGGG - Intergenic
945998800 2:216463467-216463489 GTGCAGTGGTGGTGGGAAGTGGG - Intronic
946159355 2:217826673-217826695 CTCCAGGATTGGAGGGAAGGAGG - Intronic
946328812 2:218998598-218998620 CGCCAGGGGTGGTGGGAAGCAGG - Intergenic
946332833 2:219019793-219019815 GTGCAGGAGTCCTGGGCAGTTGG + Intronic
947016789 2:225629856-225629878 ATGCAGCAGTGTTGGGAGGTGGG - Intronic
947667879 2:231918609-231918631 CTGCAAGGGTGGTGGGAGATAGG - Intergenic
948249118 2:236511485-236511507 CTGCAGGAGTGGAGGAGAGGAGG + Intergenic
948505027 2:238422668-238422690 CTGGAGGAGGGGAGGGAGGTTGG + Intergenic
948571916 2:238923014-238923036 CTGCAGGTGGGGAGGGAAGCAGG - Intergenic
1169306436 20:4494957-4494979 CTGCAGGGGAGGTGGGGAGGTGG - Intergenic
1170461355 20:16579606-16579628 ATGGAGGAGAGGAGGGAAGTAGG - Intergenic
1171094882 20:22322636-22322658 CTGCTGGAATAGTGAGAAGTTGG + Intergenic
1171405237 20:24908336-24908358 CTGTTGGAGGGGTGGGAGGTGGG + Intergenic
1172428422 20:34871933-34871955 CTGCTGGAATTGTGAGAAGTGGG - Intronic
1172758849 20:37307965-37307987 CTCCGGAAGTGGTGGGAACTGGG + Intronic
1172860424 20:38045660-38045682 CTCCAGGAATGGTGGGTGGTGGG + Intronic
1172936252 20:38622680-38622702 CTGCAGGCATGGAGGGATGTGGG - Intronic
1172989982 20:39028205-39028227 CAGCAGCAGTTGTGGGGAGTGGG + Intronic
1173366393 20:42389470-42389492 TTGCAGCAGTGTTGGGAGGTGGG + Intronic
1173578969 20:44132835-44132857 CTGCAGGTGTGGGGGGCGGTGGG - Intronic
1174654149 20:52156218-52156240 CTAAAGGAGGGGTGGGAGGTGGG - Intronic
1174681600 20:52414123-52414145 ATGCAGCAGTGCTGGGAGGTGGG - Intergenic
1175062811 20:56259192-56259214 GTGGAGGGGTGGTGGGAAGATGG - Intergenic
1175226134 20:57444996-57445018 CAGCAGGAGGTGTGGGAAGCAGG + Intergenic
1175243607 20:57567837-57567859 GTGCAGGAGGGGAGGGAATTTGG - Exonic
1175423557 20:58850847-58850869 CTGCTGGGGTGGTTGGAAGCCGG - Intronic
1176767969 21:13038528-13038550 GTGGAGGAGTGGTGGGCAGCGGG + Intergenic
1178109747 21:29358052-29358074 CTGCTGGAGTGACTGGAAGTGGG + Intronic
1178352471 21:31882104-31882126 TTGAAGGAGTTGTGGGAATTTGG + Intronic
1178701034 21:34834370-34834392 GTGCAGGAGAGGCGGGCAGTGGG + Intronic
1178877319 21:36423037-36423059 CCGCAGGGGTGGTGGGCAGCCGG + Intergenic
1179504549 21:41831827-41831849 CTGCAGGTGGGGTGGGATGTGGG - Intronic
1180515101 22:16132790-16132812 GTGGAGGAGTGGTGGGCAGCGGG + Intergenic
1180764847 22:18340371-18340393 ATGCAGGAGGGGTGGGGCGTGGG - Intergenic
1180814183 22:18779313-18779335 ATGCAGGAGGGGTGGGGCGTGGG + Intergenic
1181029420 22:20142705-20142727 CTGCAGGCGGGGTGGCAGGTGGG + Intronic
1181165504 22:20980969-20980991 CTGCAGGAGTGAGGGGAGGAGGG - Intronic
1181171751 22:21014008-21014030 CCGCAGGGGTTGTGGGAGGTGGG - Intronic
1181200368 22:21213648-21213670 ATGCAGGAGGGGTGGGGCGTGGG + Intronic
1181701369 22:24623311-24623333 ATGCAGGAGGGGTGGGGCGTGGG - Intronic
1182654637 22:31880266-31880288 CTGCAGGAATGGTGGAAAGGAGG - Intronic
1182685834 22:32121276-32121298 CTGCAGCAGTGGTGGGGTGGGGG - Intergenic
1183343036 22:37292552-37292574 CTGCAGAAGTGAGGGCAAGTGGG + Intronic
1183418735 22:37697738-37697760 CTGCAGGTGTTTTGGGATGTTGG + Intronic
1184108175 22:42380666-42380688 ATGCAGGAGAGGTGGGCCGTTGG - Exonic
1184281186 22:43438388-43438410 CACTAGGAGTGTTGGGAAGTGGG + Intronic
1184537476 22:45097089-45097111 GTGCAGCAGTGTTGGGAGGTGGG + Intergenic
1184962280 22:47939924-47939946 CTGCACCAGTGCTGGGAATTCGG - Intergenic
1185097916 22:48821811-48821833 CTGCAGATATGGTGGGATGTGGG + Intronic
1203226468 22_KI270731v1_random:81276-81298 ATGCAGGAGGGGTGGGGCGTGGG - Intergenic
1203264281 22_KI270734v1_random:5000-5022 ATGCAGGAGGGGTGGGGCGTGGG + Intergenic
949851120 3:8421441-8421463 CTGCAGTAGGGGTAGGAGGTGGG + Intergenic
950903691 3:16518516-16518538 GTACAGGTGTGATGGGAAGTAGG - Intergenic
951180645 3:19654742-19654764 CTGGTGGAGTGGTGAGAAGAGGG - Intergenic
951310382 3:21117859-21117881 CTGCTGCAGGGGTGGGAAGATGG + Intergenic
951480295 3:23154184-23154206 ATGCAGCAGTTTTGGGAAGTGGG - Intergenic
952723075 3:36553823-36553845 ATGCAGTAGTGTTGGGAGGTGGG + Intergenic
953507247 3:43498344-43498366 TTGCAGGGGTGGAGGGCAGTTGG - Intronic
954149572 3:48650671-48650693 CAGCAGGAGTGGCGGGCAGTGGG - Intronic
954722193 3:52574359-52574381 GTGCAACAGTGTTGGGAAGTGGG - Intronic
955598695 3:60620885-60620907 CTGGGGGAGTGGTGGGGCGTAGG + Intronic
956746200 3:72312687-72312709 CTGGAGGATGGGAGGGAAGTAGG + Intergenic
957277193 3:78105835-78105857 CTGCATGAGTGGAAGAAAGTAGG + Intergenic
957314475 3:78559694-78559716 ATGCAGGAGTGTTGGGAGATGGG + Intergenic
958450966 3:94271734-94271756 GTGCAAGAGTGTTGGGAGGTGGG + Intergenic
958972657 3:100629635-100629657 CTGCAGGAATGGTGGAACCTGGG + Exonic
960231969 3:115238889-115238911 ATGCAACAGTGTTGGGAAGTTGG - Intergenic
960583938 3:119303571-119303593 CTCCAGTAGTGGTGGGAAGGGGG - Intronic
960970262 3:123134556-123134578 TGGCAGGAGTGCTGGGAAGAGGG - Intronic
961069781 3:123911944-123911966 CTCCAGGGGTGGTGGGAATAAGG + Intronic
961092491 3:124126428-124126450 ATGCAGGAGTGGTGGGGAGCAGG - Intronic
961582706 3:127895572-127895594 CTGCAGGAGGGGTGGGCGATGGG + Intergenic
962357982 3:134711239-134711261 TTCCAGGAGAGTTGGGAAGTGGG + Intronic
963845890 3:150157820-150157842 ATGCAACAGTGTTGGGAAGTGGG - Intergenic
964835135 3:160929863-160929885 CTGAAGGAGAGGTGGGAAGGTGG - Intronic
965551147 3:169966634-169966656 CAGCAGGAGCGGAGGGAAGAGGG + Intronic
966288531 3:178326686-178326708 CTGAAGGAAGGGTGGGAAATAGG - Intergenic
968645980 4:1740708-1740730 CAGGAGGAGAGGTGGGCAGTGGG - Intronic
968964991 4:3765367-3765389 CTCCAGCAGCGCTGGGAAGTGGG + Intergenic
969526974 4:7708813-7708835 CTGAGGGAGTGGTGGGAGGATGG + Intronic
970147389 4:13051215-13051237 CTGAAGGAGAGGTGGGAAGTGGG + Intergenic
971362469 4:25950707-25950729 CAGCAGCAGGGATGGGAAGTTGG - Intergenic
972529360 4:39947863-39947885 TTGCAGCAGTGTTGGGAATTGGG - Intronic
972925640 4:44003014-44003036 ATCCAGGAGAGGTGGGAAGGTGG - Intergenic
973573536 4:52263896-52263918 CCTCAGCAGTGGTGGGAATTTGG + Intergenic
973711555 4:53634645-53634667 CTGCATGAGAGGTAGTAAGTAGG - Intronic
973964416 4:56146990-56147012 ATGCGGGAGTGGTGGCAAGGTGG + Intergenic
975725652 4:77289287-77289309 ATTCAGGGGTGCTGGGAAGTAGG - Intronic
975800588 4:78056625-78056647 CAGCAGGAGTGGCGGGCTGTGGG + Intergenic
977686925 4:99857296-99857318 CTGCAGGAGGGGTGGGTTGAGGG + Intronic
978777682 4:112519349-112519371 CTGCGGGGGTGGGGGGAAGAGGG + Intergenic
978826873 4:113035188-113035210 CTGCAGGTGGGTTGGGAAGGGGG + Intronic
978957652 4:114634059-114634081 CTGCAGAGATGGTGAGAAGTGGG + Intronic
980242190 4:130191269-130191291 CTACTGGAGTGGTGAGAAGAGGG - Intergenic
981231079 4:142356509-142356531 CTGCAGGAGTGATGAGGAGCTGG + Intronic
981248698 4:142572421-142572443 CTGAAGAGTTGGTGGGAAGTTGG + Intronic
981940933 4:150280917-150280939 GTGCAGGAGTGCTGGGAAAAAGG + Intronic
983199595 4:164846584-164846606 CTGCAGCTGTGGTGTGAAGTGGG - Intergenic
983644532 4:169976562-169976584 GTGCAGGTGTGGTGGGAAGGGGG + Intergenic
983671239 4:170240278-170240300 GTGCAACAGTGTTGGGAAGTTGG - Intergenic
984833521 4:183998483-183998505 CTGCAGCAGAGGTGGGAGTTGGG - Intronic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
986270812 5:6229048-6229070 CTGTGGGACTGTTGGGAAGTTGG + Intergenic
991600077 5:68343359-68343381 ATGGAGAAGTGGTGGGCAGTGGG - Intergenic
991674307 5:69076083-69076105 CTGCAGGTGGGGTCCGAAGTCGG + Intergenic
992356107 5:75985329-75985351 ATGCAGCAGTGTTGGGAGGTGGG - Intergenic
992620921 5:78591977-78591999 GCGCAGGAGGGCTGGGAAGTGGG + Intronic
992636272 5:78728593-78728615 CTGGGGGTGAGGTGGGAAGTTGG - Intronic
993607186 5:90006208-90006230 AGGAAGGAGTGGTGGGAAGGTGG + Intergenic
993681479 5:90883846-90883868 CTGCAGGAGTTGATGGGAGTGGG + Intronic
994222443 5:97211482-97211504 CTGTAGGAGTGGGGGGAATGGGG - Intergenic
994738234 5:103584995-103585017 CTGCAGGATTGTTGTGAAATTGG - Intergenic
994953201 5:106492750-106492772 TTGCAGGAATGTGGGGAAGTAGG + Intergenic
997164617 5:131646597-131646619 CTGAAGGAGGAATGGGAAGTTGG - Intronic
997419500 5:133754967-133754989 TTGAAGGAAGGGTGGGAAGTGGG - Intergenic
997560547 5:134842779-134842801 CTCCAGGAAGGGTTGGAAGTGGG - Intronic
997599943 5:135132291-135132313 CTGCATGGGTGGTGGGAAGTGGG - Intronic
997641186 5:135449850-135449872 CTGCAGCCGTGGTGGGACATTGG + Exonic
997668703 5:135652906-135652928 ATGCAACAGTGTTGGGAAGTAGG + Intergenic
999453416 5:151695374-151695396 ATGCAGCAGTGTTGGGAGGTGGG - Intergenic
999984540 5:156990730-156990752 CTGTCAGAGTGTTGGGAAGTAGG + Intergenic
1001891712 5:175344780-175344802 AGGCAGGAGTGGGGGGAAGGAGG + Intergenic
1002097159 5:176838205-176838227 GAGCTGGAGAGGTGGGAAGTAGG + Intronic
1002202275 5:177536584-177536606 CTGCCGGGGTGGTGGGCAGCAGG + Exonic
1002456908 5:179350505-179350527 CTGGAGGAGAAGTGGGAAGTGGG - Intergenic
1002535261 5:179872391-179872413 CTGCAGGAGGGCTGGGAATGTGG + Intronic
1003034824 6:2633387-2633409 CTGCAGGAGCTGGGGGAGGTTGG - Intronic
1005105847 6:22223465-22223487 CAGGAGGAGAGGTGGGAAGAAGG - Intergenic
1005353545 6:24960469-24960491 GTGCAGCAGTGTTAGGAAGTGGG - Intronic
1005370280 6:25124891-25124913 TTGGAGGATTCGTGGGAAGTAGG - Intergenic
1006679703 6:35788098-35788120 CACCATGAGTGGAGGGAAGTGGG + Exonic
1007139086 6:39553893-39553915 CTACAGAAGTGGTGGGAGCTTGG - Intronic
1007358825 6:41341253-41341275 CAGCAGGAGTGGTGCGCAGCCGG + Intronic
1007577770 6:42937261-42937283 GTGCAGGGGTTGTGGGAAGCAGG + Intronic
1010845222 6:80699091-80699113 ATGCAGCAGTGGTAGGAATTAGG - Intergenic
1012079004 6:94731400-94731422 TTGCAGGGGTGGTTGGAGGTGGG + Intergenic
1012438754 6:99242288-99242310 ATCCAGGGGTGGTGGGAGGTAGG + Intergenic
1013671295 6:112406281-112406303 CTCCAGGAGTGGAGGGGTGTAGG + Intergenic
1013864960 6:114684773-114684795 GTGCAAGAGTGTTGGGAAGTAGG - Intergenic
1015886357 6:137922538-137922560 CTCGAAGGGTGGTGGGAAGTGGG + Intergenic
1016850225 6:148611644-148611666 TTGCAGGAGTGGTTGGGAGGTGG - Intergenic
1017953346 6:159157238-159157260 CTGCAGGATTGGTTGGCAGGAGG - Intergenic
1017989195 6:159471377-159471399 CTGCAGCAGTGCAGGGCAGTGGG + Intergenic
1018002003 6:159587658-159587680 CTGAAGGAGTCGTGGGGAGAAGG - Intergenic
1018171935 6:161150625-161150647 CTGCAGGAGAGCCTGGAAGTGGG + Intronic
1018187942 6:161283997-161284019 ATGCAGGTGGGGTGGGGAGTGGG + Intergenic
1019059185 6:169243100-169243122 AGGTAGGAGTGGTGGGAAGGTGG - Intronic
1019173758 6:170149381-170149403 CTGGAGGGGTGGTGGGCAGCTGG - Intergenic
1019173847 6:170149846-170149868 CTGGAGGGGTGGTGGGCAGCTGG - Intergenic
1019935038 7:4249308-4249330 GAGCAGGACTGGTGGGAAGGTGG - Intronic
1020023263 7:4881941-4881963 AAGCAGGGGTGGGGGGAAGTGGG - Intronic
1020035154 7:4959653-4959675 CTGGAGGGGTTGGGGGAAGTGGG + Intergenic
1020654984 7:10918238-10918260 CTGCATATGTTGTGGGAAGTGGG - Intergenic
1021948518 7:25752223-25752245 CTGCAGGGCTGGGGGGAAGTAGG + Intergenic
1022754667 7:33273912-33273934 CTACAGGAATGTGGGGAAGTTGG - Exonic
1022815855 7:33913515-33913537 CTGGAGTAGGGGTGGGCAGTAGG + Intronic
1023272573 7:38480530-38480552 CTTCAGGACTGGTGAGAGGTGGG + Intronic
1023478113 7:40602953-40602975 CTGCAGTAGTGATGGGATGTTGG + Intronic
1024660641 7:51489973-51489995 TGGCAGGAGTGGTGGGACTTGGG - Intergenic
1024848174 7:53675950-53675972 GGGCAGGAGTGGGGGGAATTTGG - Intergenic
1025783087 7:64619053-64619075 CTGGATGAGTGGTCAGAAGTTGG - Intergenic
1025807550 7:64849613-64849635 CTGCAGCTGCAGTGGGAAGTGGG + Intergenic
1026872785 7:73863305-73863327 CTGCAGGACTGGGGTGAGGTGGG - Intronic
1029454016 7:100658299-100658321 CAGCAGGAGTGGTGAGCTGTAGG + Intergenic
1031205550 7:118752519-118752541 CTTCAGGACTGGGGGGATGTAGG + Intergenic
1031409754 7:121427164-121427186 GTGCAGTAGTGGTGCGAACTTGG - Intergenic
1031891392 7:127297205-127297227 CTGCAGGATTTGGGGGCAGTGGG + Intergenic
1032508675 7:132454946-132454968 CTGAAGGAGCTGTGGGAAGGTGG - Intronic
1032882079 7:136100529-136100551 GTGCAGGAGAGATTGGAAGTTGG + Intergenic
1034200204 7:149279403-149279425 CTGCAGGAGTGTTGGGGACATGG + Intronic
1034299005 7:149998890-149998912 CTGAGGGAGTGGTGGGAGGGAGG - Intergenic
1034313817 7:150111873-150111895 CGCCGGGAGTGGTGGGAAGGGGG - Intergenic
1034459613 7:151191280-151191302 CTGCAGGTGTGGAGGGAAGAGGG - Intronic
1034564168 7:151900061-151900083 CTTCTGGAGTGGAGGGAAGGAGG - Intergenic
1034699865 7:153086520-153086542 CTGCAGGTGTGGAGGAAAGGAGG - Intergenic
1034793081 7:153988919-153988941 CGCCGGGAGTGGTGGGAAGGGGG + Intronic
1034807011 7:154097883-154097905 CTGAGGGAGTGGTGGGAGGGAGG + Intronic
1034997726 7:155589010-155589032 CTGCAGCACTGGTGGCCAGTTGG - Intergenic
1036579617 8:10061896-10061918 CTGCAGCAGTGGTGGGGAAGAGG + Intronic
1036751359 8:11445451-11445473 CTGCAGCTGTGGAGGGAAGAAGG + Intronic
1036793143 8:11736615-11736637 CTGGAGGAGTGGTGGGCAGAAGG + Intronic
1038764449 8:30414369-30414391 CCTCAGTAGTGGTGGGAAGTGGG + Intronic
1039475650 8:37838066-37838088 CCCCATGAGTGGTGGGATGTGGG + Intronic
1040435433 8:47386525-47386547 AGTCAGGAGTGGTAGGAAGTGGG + Intronic
1040499775 8:47996264-47996286 TTACAAGAGAGGTGGGAAGTGGG + Intergenic
1040937475 8:52796293-52796315 CAGCAGGAGAGGTGAGAAGAGGG - Intergenic
1042096365 8:65220205-65220227 ATACAGCAGTGCTGGGAAGTGGG + Intergenic
1043326605 8:79060114-79060136 CTCCAGGAGTGGTGTGTAGATGG + Intergenic
1043550871 8:81371307-81371329 ATGCATGAGAGGTGGGAAGTTGG + Intergenic
1045137049 8:99232801-99232823 CTGCAGAAGTCCTGGGAGGTAGG + Intronic
1045347489 8:101306394-101306416 CTGCAGGAGTGGGGGGGTGTTGG - Intergenic
1046314368 8:112479899-112479921 CTTATGGAGTTGTGGGAAGTAGG + Intronic
1047559692 8:125973171-125973193 ATGCAACAGTGTTGGGAAGTGGG - Intergenic
1047906032 8:129474159-129474181 CTGCAGGTGTGGGGGGCAGCAGG + Intergenic
1048289562 8:133170174-133170196 CTGCCAAAGTGGTGGGAAGCTGG + Intergenic
1048567526 8:135618278-135618300 CTGGAGGAGTTCTGGGAAGGAGG + Intronic
1048845771 8:138602609-138602631 CTGCAGGCCAGGTGGGAAGTAGG - Intronic
1049082843 8:140456919-140456941 CTGCAGGGGTGGAGGGGATTGGG + Intronic
1049162510 8:141106265-141106287 CTGCAGGAGTGAGGGGATGTGGG + Intergenic
1051873543 9:21766995-21767017 GTGCAACAGTGCTGGGAAGTGGG - Intergenic
1052739778 9:32382333-32382355 TAGCAGGTGTGGTGGGAAGAGGG + Intergenic
1054823949 9:69552070-69552092 CTGCAGAAGTGTTGGGAATATGG + Intronic
1056268407 9:84922826-84922848 ATGAAGGAGTGGGGGAAAGTAGG + Intronic
1056803272 9:89708755-89708777 CTTCAGGAGTGATGGGAGGAGGG - Intergenic
1056808353 9:89745585-89745607 CTGCAGGAGTTGTGGGCATGAGG - Intergenic
1057054080 9:91948717-91948739 CTGCAGGAGTGCAGGGATGGGGG + Intronic
1057414244 9:94847213-94847235 CTGCAGGCATGGTGGGAGGGTGG - Intronic
1057804620 9:98211402-98211424 GTGCAGGAGGGCTGTGAAGTGGG - Intronic
1058139561 9:101342727-101342749 CTTCAGGAGTGGTTGGAACCAGG - Intergenic
1058381733 9:104384300-104384322 CTGCAGGTGTGGTTGGAGGGAGG - Intergenic
1058546116 9:106061750-106061772 ATGGAGCAGTGTTGGGAAGTGGG + Intergenic
1058866713 9:109167409-109167431 CTGCCTGCGTGGAGGGAAGTCGG - Intergenic
1060356327 9:122912484-122912506 CTGTTGTAGTGGTGGGGAGTAGG - Intronic
1060512500 9:124244066-124244088 CTGCAAGAGTGTAGTGAAGTGGG - Intergenic
1060601715 9:124882463-124882485 CAGGGGGAGTGCTGGGAAGTGGG + Intronic
1061872124 9:133526770-133526792 CTGCAGGGGAGGTGGGAGGCTGG - Intronic
1061874631 9:133537537-133537559 CTGCAGCAGAGGTGCGAGGTTGG + Exonic
1061876384 9:133546227-133546249 CTGCAGGGGTGGTGGGGAGTGGG + Intronic
1062054292 9:134462983-134463005 CTGCTGGTGTGGTGGGATGGGGG + Intergenic
1062366466 9:136211776-136211798 CTGGAAGACTGGTGGGAGGTGGG - Intronic
1062520114 9:136954270-136954292 CTGCAGGCATGCTGGGCAGTAGG + Intronic
1062624013 9:137434903-137434925 TTGCAGGACTAGTGGGAAGGCGG - Exonic
1187389402 X:18875909-18875931 CAGGAGGAGTGGTGGAAAGGAGG + Intergenic
1187428064 X:19196629-19196651 CTGCAGTAGTGGTGGAAGTTGGG - Intergenic
1188801830 X:34541720-34541742 CTGAGAGAGTGGAGGGAAGTTGG - Intergenic
1188803449 X:34559514-34559536 GTGGAGAAGTGGGGGGAAGTGGG - Intergenic
1189386552 X:40541507-40541529 ATGCAAGAGTGTTGGGAGGTGGG - Intergenic
1189408026 X:40743487-40743509 CTCCAGGAGGTGTGGGAAGGGGG - Intergenic
1189489419 X:41458171-41458193 CTGCAGTAGTGTTGAGAGGTGGG - Intronic
1190074390 X:47305536-47305558 ATGCAGCAGTGTTGGGAGGTGGG + Intergenic
1190188330 X:48255382-48255404 CGGCAGCAGTGGTGGCGAGTTGG - Exonic
1190269005 X:48847783-48847805 CTGCAGCAGTGCTGGGAGCTTGG + Intergenic
1190272663 X:48878478-48878500 ATGCAGCAGTGTTGGGAGGTGGG - Intergenic
1190325959 X:49206941-49206963 GTGGAGGAGGGGTGGGAACTGGG - Intronic
1190372410 X:49755301-49755323 ATGCAGGAGTGTTGGGAGTTGGG + Intergenic
1190657221 X:52623148-52623170 CGGCAGCAGTGGTGGCGAGTTGG - Intergenic
1190787828 X:53669798-53669820 CTGAAGTAATGGTGTGAAGTAGG - Intronic
1190823058 X:53992719-53992741 CGGCAGGTGAGGTGGGAAGGAGG - Exonic
1192549918 X:72045483-72045505 GTGGAGGGGTGGTGGGAGGTGGG + Intergenic
1192836849 X:74808936-74808958 ATGCAACAGTGTTGGGAAGTGGG + Intronic
1193046401 X:77059375-77059397 ATGCAAGAGTGGTGGGAGCTTGG + Intergenic
1193365398 X:80626022-80626044 TTGCAAGAGTAGTGGGAAGGTGG - Intergenic
1193667575 X:84341154-84341176 CTGAAGGAGAGTGGGGAAGTAGG - Intronic
1195067478 X:101250619-101250641 TTGCAGGAAGGGTGGGAAGAAGG + Intronic
1195298559 X:103504177-103504199 CTGGAGGAGTGGGGAGAGGTGGG + Intronic
1195840297 X:109168562-109168584 CTGGAGGAGAGGTGTGAATTAGG - Intergenic
1195898699 X:109774566-109774588 CTTCTAGAGTGGTGGGAAGAGGG + Intergenic
1195960065 X:110377017-110377039 CTGCAGTAGTGGTAGGCAGTGGG + Intronic
1195997863 X:110749373-110749395 CTGCAGGAGGGGGAGGAAGAGGG - Intronic
1196729943 X:118930621-118930643 TTGCAGCAGTGTTGGGAAGTGGG + Intergenic
1197344633 X:125318041-125318063 CTGGAGGAGTAGGGGGATGTAGG - Intergenic
1197400956 X:125990360-125990382 GTGCAACAGTGTTGGGAAGTGGG + Intergenic
1197434581 X:126410446-126410468 CTGCAGTTGTGGTGCAAAGTGGG + Intergenic
1197572157 X:128163152-128163174 CTGCAGCTGTTGTGGGAAATGGG + Intergenic
1198103556 X:133441727-133441749 CTTCAGGAGTGCTGAGCAGTGGG - Intergenic
1198302435 X:135344962-135344984 CGGAAGGAGTGGTGGGCGGTGGG + Intronic
1198463577 X:136885057-136885079 ATGCAGGAGAGGGGGGACGTGGG + Intergenic
1199779785 X:151047763-151047785 GTGCAGCAGTATTGGGAAGTGGG + Intergenic
1201458958 Y:14201452-14201474 CTGGAGGAGAGGAGGGAAATGGG + Intergenic