ID: 925387746

View in Genome Browser
Species Human (GRCh38)
Location 2:3474051-3474073
Sequence GGCACGGAAGCCATTACAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 83}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925387746_925387754 20 Left 925387746 2:3474051-3474073 CCATCTGTAATGGCTTCCGTGCC 0: 1
1: 0
2: 1
3: 5
4: 83
Right 925387754 2:3474094-3474116 CAAAACTGTGACAGAGAAGCAGG 0: 1
1: 0
2: 2
3: 35
4: 271
925387746_925387748 -8 Left 925387746 2:3474051-3474073 CCATCTGTAATGGCTTCCGTGCC 0: 1
1: 0
2: 1
3: 5
4: 83
Right 925387748 2:3474066-3474088 TCCGTGCCACCAAGGTGATGAGG 0: 1
1: 0
2: 0
3: 6
4: 90
925387746_925387755 26 Left 925387746 2:3474051-3474073 CCATCTGTAATGGCTTCCGTGCC 0: 1
1: 0
2: 1
3: 5
4: 83
Right 925387755 2:3474100-3474122 TGTGACAGAGAAGCAGGTGAAGG 0: 1
1: 0
2: 3
3: 40
4: 423

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925387746 Original CRISPR GGCACGGAAGCCATTACAGA TGG (reversed) Intronic
912130647 1:106595791-106595813 GGCAAGGACCCTATTACAGAAGG + Intergenic
921909239 1:220528828-220528850 GGCCCGGACGCCATTGCCGACGG + Exonic
922706783 1:227794483-227794505 GGCACCCCAGCCATTGCAGAGGG + Intergenic
1081550218 11:44104762-44104784 GGCAAGGAAGCCATACCATAGGG + Intronic
1081620852 11:44618533-44618555 AGCCCGGAAGCCCCTACAGAGGG - Intronic
1087426297 11:97991338-97991360 GGCAAGGAAACCATTGCAGAAGG - Intergenic
1097414487 12:59297366-59297388 GGGAAAGAAGCCATAACAGAAGG + Intergenic
1105990485 13:25615502-25615524 AGCACAGAAGCCATGGCAGATGG - Intronic
1110012418 13:70354121-70354143 CGCTTGGATGCCATTACAGATGG + Intergenic
1111000826 13:82178515-82178537 GGCAAGGAAGTGATTACTGAAGG + Intergenic
1111108393 13:83675134-83675156 AGCTCGGAAGCAATGACAGATGG + Intergenic
1114140033 14:19899268-19899290 GACAAGTAAGCCATGACAGAAGG + Intergenic
1116779188 14:49217270-49217292 GGAAAGGAAGCCATAAAAGAGGG + Intergenic
1121954470 14:98201309-98201331 GTCACGAAAGCCAAAACAGAGGG + Intergenic
1122713235 14:103676210-103676232 GGGACAGCAGCCATCACAGAGGG - Intronic
1128082454 15:64864753-64864775 GCCACAGAAGCCAGGACAGAGGG + Intronic
1129525996 15:76214871-76214893 GGCAGGGCAGCCATGACAGGAGG + Intronic
1133203507 16:4218974-4218996 GTCACCGAATCCATGACAGATGG + Intronic
1135016765 16:18930113-18930135 TGCAGGGAAGGCATTCCAGATGG - Intergenic
1135322400 16:21505966-21505988 TGCAGGGAAGGCATTCCAGATGG - Intergenic
1136333877 16:29599096-29599118 TGCAGGGAAGGCATTCCAGATGG - Intergenic
1137575113 16:49594267-49594289 GGCAGGGAAGAGATTCCAGAGGG - Intronic
1140642861 16:76997387-76997409 GGCATGGAAACCATGACAGGTGG - Intergenic
1140857208 16:78988669-78988691 GGCACGAAGACCAGTACAGAAGG + Intronic
1143767803 17:9149104-9149126 GTGACGGGAGCCATTACAGATGG + Intronic
1157777518 18:50407311-50407333 GGCACGGAGGGCATAACAGGTGG - Intergenic
1163950212 19:20576991-20577013 GGCACAGAAGCCATGGCAGGTGG - Intronic
925387746 2:3474051-3474073 GGCACGGAAGCCATTACAGATGG - Intronic
933776923 2:85776722-85776744 GGCCCAGGAGCCATTAAAGATGG + Intronic
935245481 2:101215584-101215606 TGCAGGGAAGCCATGGCAGAGGG + Intronic
936047762 2:109200411-109200433 GACACAGAAGCCATCAGAGATGG - Intronic
936715505 2:115182734-115182756 GGTAGGGAAGCTATTTCAGAAGG + Intronic
937689371 2:124737471-124737493 GGCAAGGAGGCCAGTACAGCTGG + Intronic
942551864 2:177128052-177128074 GGCACGGATGACATTTCAGATGG - Intergenic
944910282 2:204304369-204304391 GGCAGGGAAGGCATCAGAGATGG - Intergenic
946541507 2:220689293-220689315 GACACGGAAGCTATCACTGAAGG - Intergenic
947243247 2:228019001-228019023 GGCAAGGAAGCCATTGCCAAGGG - Exonic
1170143452 20:13148107-13148129 GGCCCAGAAGGAATTACAGATGG - Intronic
1170388587 20:15848281-15848303 GGCTGGGAATCCATTACAGGTGG - Intronic
1172079963 20:32332381-32332403 GGCAGGGAAGACATAACAGATGG + Exonic
1172480813 20:35270343-35270365 AGCAAGGAAGGCATTCCAGAGGG + Intronic
1174103588 20:48146290-48146312 GGCACGAATGACATTGCAGAAGG + Intergenic
1179942623 21:44649680-44649702 GGCATTGAAGCTATTGCAGAAGG - Intronic
1182481777 22:30613931-30613953 CGCAGGGAAGCCAGTCCAGATGG - Intronic
949748401 3:7322905-7322927 GACACTGATGCCATTACAAAAGG - Intronic
953213051 3:40893338-40893360 GGAAAGGAAGCCAGTGCAGAAGG + Intergenic
962599755 3:136982800-136982822 CCCACAGAAGTCATTACAGAAGG - Intronic
962697279 3:137962714-137962736 GGCACTGCAGCAATTAAAGAAGG - Intergenic
964140151 3:153388647-153388669 GGCACGGCAGCAATTCAAGAAGG + Intergenic
968176565 3:196555227-196555249 GGAAAGGAAGGCATTCCAGATGG - Intronic
970391460 4:15616503-15616525 AGCACAGAAGCCATGGCAGATGG - Intronic
982974422 4:162035749-162035771 GTCAGGGAGGCCATTAAAGAAGG + Intronic
984744951 4:183206010-183206032 TTCACGGAAGCCATGACAGGTGG - Intronic
991212394 5:64120795-64120817 GGCACACAACCCATTCCAGATGG + Intergenic
993194672 5:84725746-84725768 GGCACTGAAGACATTCCAGTGGG + Intergenic
993546588 5:89220126-89220148 CCCAGGGAAGCCATGACAGATGG + Intergenic
997226376 5:132212411-132212433 AGCACGGAAGACATGAGAGAAGG + Intronic
998909788 5:146946773-146946795 GAGGCCGAAGCCATTACAGAAGG + Intronic
1000497299 5:162000941-162000963 GTTACGGAGGCCACTACAGATGG + Intergenic
1001780525 5:174365058-174365080 AGCACAGAAGCCAACACAGAAGG + Intergenic
1006386171 6:33732248-33732270 GGCAGGGATGCCACTCCAGAGGG - Intronic
1017644662 6:156527746-156527768 GGCACAGGAGCCATTCCAGAAGG - Intergenic
1025716884 7:63965846-63965868 GGCATGGAAGTCACTAAAGAGGG + Intergenic
1026124341 7:67566333-67566355 GGAAGGGAAGACATCACAGATGG - Intergenic
1026598609 7:71754505-71754527 GGCAGGAAAGCAATTCCAGATGG - Intergenic
1026613349 7:71880450-71880472 GGGAAGGAAGCCAGTAGAGATGG - Intronic
1031425153 7:121596170-121596192 GGCTAGGAAGCACTTACAGATGG - Intergenic
1032988194 7:137361953-137361975 GCCATAGAAGCCATTACATAAGG + Intergenic
1036124023 8:6046734-6046756 GGCAAGGAGGCCTTTACTGAAGG + Intergenic
1036596255 8:10215082-10215104 GGCACAGAATCCATTGTAGAGGG + Intronic
1042375073 8:68040600-68040622 GTCAGGGAAGACACTACAGAGGG - Intronic
1048354520 8:133642259-133642281 GGCATAGAAGGCTTTACAGAGGG - Intergenic
1048627832 8:136205706-136205728 GGCATGGAGACCATCACAGAGGG - Intergenic
1049094531 8:140540602-140540624 GGCAGGGAAGCCATCACAGAGGG - Intronic
1050521170 9:6501889-6501911 GGGAGAGAAGCAATTACAGATGG + Intronic
1050653563 9:7799509-7799531 GGCACGGAAGCCCATGAAGATGG - Exonic
1057107753 9:92436646-92436668 GGCACCAAAGCAATTACTGAAGG - Intronic
1057219091 9:93246202-93246224 GGCACGGGAGCCAGTGCTGAGGG - Intronic
1058295339 9:103299572-103299594 GGCACTGAAGACACAACAGAGGG + Intergenic
1189375230 X:40461322-40461344 GGCACTGAAGCCATTCATGAGGG + Intergenic
1195770987 X:108351001-108351023 AGAACAGAAGCTATTACAGAGGG - Intronic
1196745314 X:119066524-119066546 GGCACGGAAGAGGTAACAGAAGG - Intergenic
1196804978 X:119575247-119575269 GGGTCGGAAGCCACTACAAATGG - Intronic
1200887325 Y:8282207-8282229 GGGAGGGAGGCCATTAGAGAGGG + Intergenic
1201060301 Y:10038373-10038395 GGGAGGGAGGCCATTAGAGAGGG + Intergenic
1202161762 Y:21941564-21941586 GGGAGGGAGGCCATTAGAGAGGG + Intergenic
1202196732 Y:22305674-22305696 GGGAGGGAGGCCATTAGAGAGGG - Intergenic
1202229594 Y:22644809-22644831 GGGAGGGAGGCCATTAGAGAGGG - Intergenic
1202313562 Y:23551356-23551378 GGGAGGGAGGCCATTAGAGAGGG + Intergenic
1202557241 Y:26119239-26119261 GGGAGGGAGGCCATTAGAGAGGG - Intergenic