ID: 925389325

View in Genome Browser
Species Human (GRCh38)
Location 2:3484702-3484724
Sequence ATCTGCTGCTAGGAGTTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 173}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925389325_925389328 6 Left 925389325 2:3484702-3484724 CCTCACAACTCCTAGCAGCAGAT 0: 1
1: 0
2: 0
3: 17
4: 173
Right 925389328 2:3484731-3484753 AGCCTCGCATCCTACAGGAAAGG 0: 1
1: 0
2: 0
3: 3
4: 81
925389325_925389327 1 Left 925389325 2:3484702-3484724 CCTCACAACTCCTAGCAGCAGAT 0: 1
1: 0
2: 0
3: 17
4: 173
Right 925389327 2:3484726-3484748 CTGTCAGCCTCGCATCCTACAGG 0: 1
1: 0
2: 1
3: 19
4: 119
925389325_925389331 30 Left 925389325 2:3484702-3484724 CCTCACAACTCCTAGCAGCAGAT 0: 1
1: 0
2: 0
3: 17
4: 173
Right 925389331 2:3484755-3484777 ACCATCGCCAAAAGACGCTGAGG 0: 1
1: 0
2: 1
3: 0
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925389325 Original CRISPR ATCTGCTGCTAGGAGTTGTG AGG (reversed) Intronic
900799040 1:4726433-4726455 GTCTGCTTCCAGGAGTTGTGGGG + Intronic
905514921 1:38555639-38555661 ATCTGCTTCTCAGAGTTGTTGGG - Intergenic
905623465 1:39469328-39469350 ATCTGCAGCTAGGGGGTGTGTGG + Intronic
907062169 1:51439456-51439478 ATCTGCTTCAAAGTGTTGTGAGG + Intronic
907425687 1:54378087-54378109 ATCTGCTTTTTGGGGTTGTGTGG - Intronic
908007846 1:59745090-59745112 ATCTGAAGCCAGGAGTTGAGAGG - Intronic
912242526 1:107926584-107926606 ATCTCCTGGTAGTAGCTGTGTGG + Intronic
913155383 1:116092172-116092194 ATCTGCTGCTGGGAGACTTGAGG - Intergenic
915377332 1:155408571-155408593 TTCTGCTGTTCGGAGTAGTGAGG - Intronic
919060174 1:192622131-192622153 ATCAGATGGTAGGAGATGTGTGG + Intergenic
922075456 1:222239138-222239160 ACCTGCTCCTGGGACTTGTGTGG - Intergenic
924416472 1:243861307-243861329 ATCTCCTGGTAGGGGCTGTGGGG - Intergenic
924908422 1:248482048-248482070 GTCTGTTGCTGGGAGTTGTATGG + Intergenic
924915688 1:248566037-248566059 GTCTGTTGCTGGGAGTTGTATGG - Intergenic
1062846023 10:706241-706263 ATCTTCTGCTATCAGTTTTGTGG - Intergenic
1064693755 10:17944774-17944796 ATCTGATGCTTGTAGATGTGTGG + Intergenic
1065355301 10:24834801-24834823 ACCTGCTGCTAGGAGATTTGAGG + Intergenic
1067515547 10:46938465-46938487 AACTGTTCCTAGGAATTGTGTGG + Intronic
1067646704 10:48113350-48113372 AACTGTTCCTAGGAATTGTGTGG - Intergenic
1068148825 10:53106392-53106414 TTCTTCTCCTAGGATTTGTGAGG - Intergenic
1070989405 10:80718347-80718369 ATCTGCTGAGAGGAGGTGGGCGG + Intergenic
1071017395 10:81013975-81013997 ATCTGCTTTTGGGAGTTGTCAGG - Intergenic
1072432818 10:95388622-95388644 GTCTGCTGCTTGGAGCTCTGAGG - Intronic
1073631987 10:105158501-105158523 TTCTGCTTCTTGGAGTTGTAAGG - Intronic
1075447417 10:122523273-122523295 AGCAGTTGCTAGGAGTTGTGTGG + Intergenic
1075880118 10:125843823-125843845 ATCTGCTACTAGGAGTGAGGGGG + Intronic
1078795677 11:14590167-14590189 GTTGGTTGCTAGGAGTTGTGGGG + Intronic
1079073567 11:17368782-17368804 AACTGCTGCTGGGAACTGTGTGG - Intronic
1079974625 11:27076222-27076244 ATCTGCTGCTAGGAGACTAGAGG - Intronic
1083484630 11:62975580-62975602 CTCTGCTGCCAGGAGCTGTGAGG - Intronic
1087520736 11:99231946-99231968 ATCAGCTGGTTGTAGTTGTGTGG + Intronic
1088774064 11:113065003-113065025 TTCTGATGCTAGGACTGGTGGGG + Intronic
1089402748 11:118173850-118173872 ATCTGCTGCTTGTGGTGGTGGGG - Intronic
1091289549 11:134430123-134430145 TTCTGCTGCTAGGATTTGTCAGG + Intergenic
1091669947 12:2445792-2445814 AGCTGCTTATAGGAGTTGTCTGG + Intronic
1093184317 12:16002612-16002634 ATTTGCTGAGAGGATTTGTGTGG - Intronic
1096309707 12:50509873-50509895 ATCTGATGCTAGGAGTATTAAGG + Intronic
1097165711 12:57085408-57085430 CTGTTCTGCTTGGAGTTGTGAGG - Intronic
1099100848 12:78439042-78439064 CTGAGCTGCTTGGAGTTGTGGGG + Intergenic
1101118535 12:101555266-101555288 CTATGCTGCTAGGAGATCTGTGG - Intergenic
1101837945 12:108308211-108308233 ATCTGTCTCAAGGAGTTGTGAGG + Intronic
1103099737 12:118163174-118163196 ATCTGCTGCTATGAGGGCTGAGG + Intronic
1108361050 13:49668237-49668259 ATCTCCAGCTAGGATCTGTGTGG - Intronic
1109009567 13:56923093-56923115 ATCTGCTTCTAGGAGGTCTCGGG + Intergenic
1109484143 13:62996719-62996741 ACCTGCTGCTGGGAGTCTTGAGG - Intergenic
1111996500 13:95170790-95170812 ATTTGCTGCTAGTGGTTTTGAGG - Intronic
1114684473 14:24515038-24515060 ATTTGTTGCCAGGGGTTGTGGGG - Intergenic
1115083172 14:29481857-29481879 ATATGATGCTAGCAGTTGTAAGG + Intergenic
1117673518 14:58132463-58132485 CTCTGCTGCTAGGAGCCGGGGGG - Intronic
1117943809 14:60997095-60997117 ATCTACAGATTGGAGTTGTGAGG + Intronic
1118621127 14:67615029-67615051 ATAGGTTGCTGGGAGTTGTGGGG - Intergenic
1120518094 14:85493761-85493783 ATCTGATGTTATCAGTTGTGAGG + Intergenic
1121498583 14:94415370-94415392 ATTTGCTGCTACAATTTGTGGGG + Intergenic
1121784786 14:96649318-96649340 ACCTGCTGTTAGGGGGTGTGGGG + Intergenic
1123036518 14:105474102-105474124 AGCTGCTGGTAGGGGGTGTGGGG - Intronic
1124555164 15:30718827-30718849 ATCTGCTTTTAAGAGTTGTGGGG - Intronic
1124676087 15:31686854-31686876 ATCTGCTTTTAAGAGTTGTGGGG + Intronic
1128921232 15:71612028-71612050 AGCTGCAGCTAAGACTTGTGGGG + Intronic
1129805098 15:78449442-78449464 ATGTTCTGCTGGGAATTGTGTGG + Intronic
1130379850 15:83362174-83362196 AGCTGCTGCCAGGAGTCATGAGG + Intergenic
1134665437 16:16015100-16015122 TGCTGCTGCTAGGAATTTTGAGG + Intronic
1134807379 16:17137504-17137526 CTCTGCTGCTAGGTGTGGGGAGG + Intronic
1137766701 16:50982979-50983001 ATCAGCTGCTAAGATTTGTGGGG + Intergenic
1137938526 16:52658422-52658444 CTCTGCTGTTTGCAGTTGTGGGG - Intergenic
1142120780 16:88385749-88385771 AACAGCTGCTAGGGGCTGTGTGG + Intergenic
1143111259 17:4554274-4554296 AACAGCTGCCAGGAGTTGTGTGG + Exonic
1146511986 17:33457859-33457881 CTCTGCTGCCAGGAATTATGTGG - Intronic
1148644529 17:49211632-49211654 CTCTGCTGTTTGGAGCTGTGTGG - Intronic
1148939625 17:51196988-51197010 ATCAACTGCAAGGAGTTGCGTGG - Intronic
1149131929 17:53313177-53313199 TTCTGCTGCTAATTGTTGTGTGG - Intergenic
1149806327 17:59620604-59620626 GTCTGCACCCAGGAGTTGTGGGG + Intronic
1151371825 17:73652046-73652068 ATCTTCTGCTAGTACCTGTGAGG - Intergenic
1153316590 18:3728827-3728849 ATCGGCTCCTAGGACCTGTGTGG + Intronic
1156583923 18:38410547-38410569 ACCTTCTGCTATGATTTGTGAGG + Intergenic
1161313837 19:3608815-3608837 CTCTGGTGGGAGGAGTTGTGAGG + Intergenic
1162355568 19:10181865-10181887 ATTTGCTGCTAATAGTTGGGTGG - Intronic
1162558047 19:11399911-11399933 CTCTGCTTCTAGGACTTGAGGGG + Exonic
1163488113 19:17601578-17601600 ATCACATGCTAAGAGTTGTGTGG + Exonic
1165092887 19:33395947-33395969 ATCTGCTGCCAGAAATTCTGGGG + Intronic
1165228214 19:34368906-34368928 ATCTGCTGCTGGCAGAAGTGGGG + Intronic
1168429386 19:56265865-56265887 ATCTGGTGCAAGGAGCTTTGAGG + Intronic
925389325 2:3484702-3484724 ATCTGCTGCTAGGAGTTGTGAGG - Intronic
925900917 2:8508902-8508924 ATCTGGTGGTGGGGGTTGTGGGG - Intergenic
926316044 2:11710728-11710750 TTCTTCTACTAGGAGCTGTGTGG - Intronic
927319819 2:21730087-21730109 ATCAGTTGTTAGGAGGTGTGTGG + Intergenic
929128617 2:38543841-38543863 TTCTGCTGCTGGGACTGGTGAGG - Intergenic
929714861 2:44299468-44299490 ATCTCCTGCTAGGAGTAATATGG - Intronic
931879217 2:66549371-66549393 ATGTGTTACTACGAGTTGTGTGG + Intronic
932173998 2:69582981-69583003 AATTGCTGCCAGGAGTTCTGTGG - Intronic
935750826 2:106232503-106232525 AGCTGCTGCTAGGGGTGGGGTGG - Intergenic
936136061 2:109895056-109895078 ATATCCTGCTGGGAGTTGGGAGG - Intergenic
936208636 2:110476429-110476451 ATATCCTGCTGGGAGTTGGGAGG + Intergenic
937000584 2:118463269-118463291 ATCTGGTGCTGGCAATTGTGTGG + Intergenic
937144939 2:119636726-119636748 CTCGGCTGCAAGGATTTGTGAGG - Intronic
937893915 2:126963195-126963217 CTCTCCTGCTGGTAGTTGTGAGG - Intergenic
940131441 2:150387451-150387473 ACCTGCTGCTGGGAGACGTGAGG - Intergenic
943731155 2:191305217-191305239 ATCTGTTGCTGGGACTGGTGTGG + Intronic
944208183 2:197179330-197179352 ATTTGGTGGTAGGAGTTGAGTGG - Intronic
944666466 2:201963230-201963252 CTCTGCTGCTAGCAGCTTTGTGG - Intergenic
947710430 2:232310743-232310765 ATCTGATGCAAGCAGGTGTGGGG + Intronic
948046121 2:234946732-234946754 ATCTGCTGAAAAGAGTTCTGTGG - Intergenic
1170621005 20:17995927-17995949 ATCTGCTTCTTGAAATTGTGAGG + Intronic
1170677135 20:18492905-18492927 ATATGCTGCCAGGGGTTGTCTGG - Intronic
1173350393 20:42239843-42239865 ATCTGCTCCTCAGGGTTGTGGGG - Intronic
1173747665 20:45450134-45450156 AGCTGCTGCGAGGAATTGTCTGG - Intergenic
1175397673 20:58678114-58678136 ATCTGCTGCTCTTAGGTGTGGGG + Exonic
1175614828 20:60389035-60389057 ATTTGTTGCCAGGGGTTGTGGGG + Intergenic
1176167135 20:63680255-63680277 TTCTGCTTCTCAGAGTTGTGGGG + Intronic
1177355266 21:19998783-19998805 ATCTCCTGCCAGGAGTCATGGGG + Intergenic
1178106666 21:29326970-29326992 ATCTAGTGATAGGAGTAGTGTGG + Exonic
1180692581 22:17729606-17729628 AGCTGCTGAAAGGAGGTGTGAGG + Intronic
1181482111 22:23206706-23206728 ATCTGCTGCTAGGAAATAAGAGG - Intronic
1182050579 22:27310035-27310057 ATCTTCTCCTGGGAGTTGTGAGG - Intergenic
950492944 3:13317177-13317199 GGCTGCTGCTAGGACTTCTGAGG - Exonic
951194748 3:19811863-19811885 ATCTGGTGCAAGCACTTGTGGGG - Intergenic
951804497 3:26629694-26629716 TCCTGCTGCTATGTGTTGTGTGG + Intronic
952282632 3:31938386-31938408 ATCTGCTGTTAATGGTTGTGTGG - Intronic
953386654 3:42510118-42510140 AGCTGCAGCAAGGAGTTCTGGGG - Intronic
954578058 3:51687660-51687682 CCCTGCTGCCAGGAGTTGCGGGG + Intronic
955865023 3:63372802-63372824 ATCTGCAGCTAGCACTTGAGTGG + Intronic
956436403 3:69238337-69238359 CTCTGTTCCTAGGAGTTTTGTGG + Intronic
961917869 3:130396169-130396191 ATTTGAGGCTAGGAGTTGAGAGG + Intronic
963328410 3:143887368-143887390 TTCTGCTGCTAAGAGTTTGGGGG + Intergenic
966732241 3:183161100-183161122 ATCCTCTGCTAGGAGTACTGGGG - Intronic
967635339 3:191795293-191795315 ATCTGCTGCCAGGTGTTTTGTGG + Intergenic
967870385 3:194224355-194224377 AGCTGCTGCTGGAAGTGGTGTGG - Intergenic
968538814 4:1151771-1151793 ATCTGCAGCTGGGACTTGGGTGG + Intergenic
972018717 4:34281061-34281083 ATCCACTGCTGGGAGATGTGAGG - Intergenic
975443318 4:74436850-74436872 AGCTGCTGCTTGGAGGTGGGGGG + Intergenic
978993425 4:115117752-115117774 ATCTTCTGCTAGCAATTGTTAGG + Intergenic
980523280 4:133958513-133958535 AACTGATGCCAGGAGTAGTGGGG - Intergenic
982226393 4:153171246-153171268 GTGTGCTGGTAGGATTTGTGAGG - Intronic
982298514 4:153855015-153855037 ATCTGATGCTTGTAGATGTGTGG + Intergenic
984604438 4:181768333-181768355 ATTTGCTGCGAGGAGCTGTCCGG - Intergenic
988614593 5:32763129-32763151 ATCAGCTGCTTGTAGATGTGTGG + Intronic
989552441 5:42751612-42751634 CTCTGCTCCTACTAGTTGTGTGG - Intergenic
991956677 5:72001566-72001588 ATCTGTTGATAGGAGTTGTCTGG + Intergenic
994320758 5:98392213-98392235 AGCTGCGGCTGGGAGTTGTGAGG + Intergenic
995115368 5:108472567-108472589 ACCTGCTGCTAGGAGACTTGAGG + Intergenic
995358708 5:111269202-111269224 ATCTTCTGCAATGAGTAGTGGGG + Intronic
995527096 5:113058880-113058902 GTCTGGTGTTAGGTGTTGTGGGG - Intronic
997145249 5:131426211-131426233 ACCTGGTGCTATGAGATGTGGGG + Exonic
999696432 5:154191445-154191467 ATCAGCAGGTAGGGGTTGTGGGG - Intronic
1001087615 5:168712462-168712484 AGCTACTGCTAGGAGCAGTGGGG - Intronic
1003468476 6:6405073-6405095 ATTTGCTTCTACTAGTTGTGTGG + Intergenic
1006251259 6:32787999-32788021 ATCAGATGCTAGTAGGTGTGTGG - Intergenic
1009273811 6:61649274-61649296 AGCTACTGCTAGCAGATGTGGGG + Intergenic
1010115562 6:72304227-72304249 ATGTAATGCTAGGATTTGTGGGG + Intronic
1012240628 6:96867689-96867711 CTCTGCTGAGAGGAATTGTGAGG + Intergenic
1016232731 6:141826474-141826496 ATTGGTTGCTAGGGGTTGTGGGG - Intergenic
1016612142 6:146002072-146002094 GTCTGCTGCCAGGTGTTTTGGGG - Intergenic
1017801646 6:157901444-157901466 GTTTCCTTCTAGGAGTTGTGTGG + Intronic
1018355512 6:163010952-163010974 ATCTGCTGCAGTGAGATGTGCGG + Intronic
1018499917 6:164396251-164396273 ATCTGCTAATAGGAGAGGTGTGG - Intergenic
1022071444 7:26919355-26919377 ATTTAGTGCTAGGAGATGTGTGG - Intronic
1023946360 7:44806056-44806078 CTCTGCTTCTCAGAGTTGTGGGG + Intronic
1024070133 7:45777723-45777745 GTCTGCTTCTAGGGGTTGGGTGG + Intergenic
1027838619 7:83278878-83278900 ATCTGCTGCTGGGAGAGTTGAGG - Intergenic
1029797973 7:102914960-102914982 ATCTGTAGAAAGGAGTTGTGAGG + Intronic
1030596314 7:111543877-111543899 CTCTCCTGCTAGGAGATGTGCGG - Intronic
1031389512 7:121196226-121196248 ATCTGCTGCTGGGAGCTGGGGGG + Intronic
1032621666 7:133540070-133540092 ATTTGCTGGTAGTAGTTTTGAGG + Intronic
1032802997 7:135331398-135331420 AACTGCAGCTGGGAGGTGTGGGG + Intergenic
1033580781 7:142733298-142733320 GTTTGCTTCTAGGACTTGTGGGG - Intergenic
1033589781 7:142799607-142799629 ATTAGCAGGTAGGAGTTGTGGGG + Intergenic
1033661913 7:143408469-143408491 ATCTGCTCCTGGGAGTGGGGAGG - Intronic
1037067110 8:14595561-14595583 AGCTGCTAGTAGGAGTTCTGAGG - Intronic
1039444746 8:37622035-37622057 TTCTGCTGCCAGAAGATGTGGGG + Intergenic
1040382797 8:46889028-46889050 ACCTGATGCCAGGACTTGTGCGG - Intergenic
1041950228 8:63492786-63492808 GCCTGCTGTTAGGAGTTGAGGGG + Intergenic
1043738227 8:83774679-83774701 TTCTGCTGCCAGGATTTGAGAGG - Intergenic
1045670134 8:104541670-104541692 ACCTGTTGCTAGGGGATGTGGGG - Intronic
1045991607 8:108314848-108314870 GTCTGCTGCTTGGTGTTGGGAGG + Intronic
1046513565 8:115229249-115229271 ATCAGTTGCTAGTAGATGTGTGG - Intergenic
1047251976 8:123187388-123187410 ATCTGCTGCGAAGGGTTGTCTGG - Intronic
1050262364 9:3854098-3854120 ATCTACTGCCTGGAGTGGTGAGG + Intronic
1052247514 9:26354345-26354367 GTCTTCTTCTAGGAGTTTTGTGG - Intergenic
1052899416 9:33778797-33778819 GTTTGCTCCTAGGACTTGTGGGG - Intronic
1060439296 9:123623957-123623979 ACATGCTGCTAGGAGTTTTCAGG - Intronic
1185658208 X:1702966-1702988 TTCTCCTGCTTGGAGTAGTGGGG + Intergenic
1188984699 X:36758750-36758772 GTGTGCTGCCAGGAGTTGTATGG - Intergenic
1189085710 X:38021425-38021447 CTATGGTGCCAGGAGTTGTGAGG + Intronic
1192883146 X:75309141-75309163 ATCTGATGGTTGTAGTTGTGTGG + Intergenic
1193433491 X:81441741-81441763 ATCTGATGGTAGTAGTTGTATGG + Intergenic
1194547613 X:95257269-95257291 ATATGCTCTTAGGAGTTCTGGGG - Intergenic
1194569671 X:95539300-95539322 ATCTGCTGCTAGCAAATGTTGGG + Intergenic
1196345124 X:114646481-114646503 ATATGTTGCTAACAGTTGTGAGG + Intronic
1198837269 X:140817879-140817901 AACTGCTGTTAGGAGGTGTTGGG + Intergenic
1199971269 X:152863667-152863689 ATCTGCAGCTAGCAGTTGTCAGG - Intronic
1200854344 Y:7921067-7921089 ACCTGAAGCTAGGATTTGTGTGG - Intergenic
1201158604 Y:11152944-11152966 ATTTGCTGCTAGGGGTTGCTGGG - Intergenic