ID: 925389614

View in Genome Browser
Species Human (GRCh38)
Location 2:3486363-3486385
Sequence CAGGGTGACCAGAAGGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 425
Summary {0: 1, 1: 0, 2: 0, 3: 39, 4: 385}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925389614_925389623 13 Left 925389614 2:3486363-3486385 CCTGGCTCCTTCTGGTCACCCTG 0: 1
1: 0
2: 0
3: 39
4: 385
Right 925389623 2:3486399-3486421 AAATGCCCACAGTGAGCCTGGGG 0: 1
1: 0
2: 5
3: 25
4: 256
925389614_925389621 11 Left 925389614 2:3486363-3486385 CCTGGCTCCTTCTGGTCACCCTG 0: 1
1: 0
2: 0
3: 39
4: 385
Right 925389621 2:3486397-3486419 TCAAATGCCCACAGTGAGCCTGG 0: 1
1: 0
2: 2
3: 28
4: 301
925389614_925389626 28 Left 925389614 2:3486363-3486385 CCTGGCTCCTTCTGGTCACCCTG 0: 1
1: 0
2: 0
3: 39
4: 385
Right 925389626 2:3486414-3486436 GCCTGGGGTCCTGCTGCCTGTGG 0: 1
1: 1
2: 6
3: 53
4: 505
925389614_925389622 12 Left 925389614 2:3486363-3486385 CCTGGCTCCTTCTGGTCACCCTG 0: 1
1: 0
2: 0
3: 39
4: 385
Right 925389622 2:3486398-3486420 CAAATGCCCACAGTGAGCCTGGG 0: 1
1: 0
2: 2
3: 27
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925389614 Original CRISPR CAGGGTGACCAGAAGGAGCC AGG (reversed) Intergenic
900087662 1:906093-906115 CAGGAGGCCCAGAAGGAGCGGGG - Intergenic
900489096 1:2937452-2937474 GGGTGTGACCTGAAGGAGCCAGG - Intergenic
901186357 1:7375869-7375891 CAGGGTGGACAGAAGGGGGCAGG + Intronic
901511661 1:9720860-9720882 CTTGGTGACCAGCAGCAGCCGGG - Exonic
902205497 1:14865441-14865463 GAGGGAGACCAGGAGAAGCCAGG - Intronic
902456422 1:16536681-16536703 CAGTGGGACCAGCAGGAGCCTGG - Intergenic
902495741 1:16871230-16871252 CAGTGGGACCAGCAGGAGCCTGG + Intronic
902681619 1:18047762-18047784 CAGGGTGCCCACATGGAGGCAGG - Intergenic
903184503 1:21621791-21621813 CAGGGTGACCAAACGTAGCCAGG + Intronic
903506962 1:23843272-23843294 AAGGGTGACAAGATGGTGCCAGG - Intergenic
903537117 1:24074347-24074369 CAGGCTCACCAGAAGCAACCTGG - Intronic
903772510 1:25772777-25772799 CAGGGTGATCAGCAGGGCCCAGG - Intronic
904948233 1:34214819-34214841 GAGGGTGAGGAGAAGGAGCAGGG + Intronic
905236692 1:36554893-36554915 CTGAGTGACATGAAGGAGCCAGG - Intergenic
905302920 1:36997809-36997831 AAGGGTGACCAGATACAGCCTGG + Intronic
907279755 1:53339850-53339872 CAGAGTGGCCAGAAGGATCTGGG - Intergenic
907309098 1:53529240-53529262 CTGGGTCACCTGCAGGAGCCTGG + Intronic
908167606 1:61473888-61473910 GAGGGGAACCAGAGGGAGCCAGG - Intergenic
911002409 1:93180192-93180214 CAGAGCGGCCAGAAGGAGCACGG + Exonic
913661754 1:121010930-121010952 AAGTGGGACCAGCAGGAGCCTGG - Intergenic
913996444 1:143654664-143654686 GAGTGGGACCAGCAGGAGCCTGG - Intergenic
914013127 1:143794110-143794132 AAGTGGGACCAGCAGGAGCCTGG - Intergenic
914164699 1:145167075-145167097 AAGTGGGACCAGCAGGAGCCTGG + Intergenic
914255611 1:145959753-145959775 CAGGGTGTGAATAAGGAGCCAGG + Exonic
914376372 1:147077253-147077275 GAGTGGGACCAGCAGGAGCCGGG + Intergenic
914505818 1:148288147-148288169 GAGTGAGACCAGCAGGAGCCTGG + Intergenic
914651751 1:149702719-149702741 AAGTGGGACCAGCAGGAGCCTGG - Exonic
915270378 1:154749587-154749609 CAGGGTGCCAAGGAGGAGCCTGG + Intronic
915313519 1:155016150-155016172 TGGGATGACCAGGAGGAGCCAGG + Intronic
915355967 1:155255332-155255354 CAGGGCGTCCAGTAGGATCCGGG + Exonic
915727772 1:158030912-158030934 CAGGATGAGCAGATGGAGCTGGG - Intronic
916496988 1:165355678-165355700 CAGGGCGACCAGAATCAGCCAGG + Intronic
920398827 1:205664588-205664610 CAGGTTGACCAGCAAGAGCTGGG + Exonic
921430421 1:215058858-215058880 CAGGATGACAAGAAGGAGTCTGG - Intronic
922762959 1:228143734-228143756 CTGGGTGAGCAGCAGGAGCCAGG + Intronic
923341284 1:233009033-233009055 CAGTGTGGCCAGTAGGAGCAAGG + Intronic
924647762 1:245894928-245894950 CAGGGCCACGTGAAGGAGCCTGG + Intronic
1063277835 10:4590598-4590620 CAGGATGAACAGCAGGAGCCAGG + Intergenic
1063365049 10:5485632-5485654 CTCGGTGACAAGACGGAGCCAGG + Intergenic
1063457232 10:6192535-6192557 CCGGGTGACCCGCAGGGGCCAGG - Intronic
1063883551 10:10554601-10554623 CAGGGTCACCACAGGGAGGCTGG - Intergenic
1065967672 10:30782573-30782595 CAGGGGGACCCAGAGGAGCCAGG + Intergenic
1066615468 10:37289057-37289079 CAGGGTGAGCAGAAGCAGGATGG - Intronic
1067250006 10:44578161-44578183 CAGGGTGATCAGATGTAACCTGG + Intergenic
1070160038 10:73860928-73860950 CAAGGTGACCACAAGGAGAATGG - Intronic
1070385163 10:75917630-75917652 CAGGGTGATAAGAAAGAGCAAGG + Intronic
1070710194 10:78675703-78675725 CAGGGAGGGCAGCAGGAGCCAGG - Intergenic
1072617513 10:97059535-97059557 CAAGGTGAGCAGAAGGAGAGGGG + Intronic
1073562972 10:104512587-104512609 CAAGGAGTCCAGAAGTAGCCTGG - Intergenic
1073803719 10:107072127-107072149 CAGGGTAACAGGAAGGAGACAGG + Intronic
1074467045 10:113692511-113692533 CAGGCAGACCAGAAGGGGCGTGG - Intronic
1074493697 10:113960405-113960427 TAGGGTGGCGAGAAGGACCCAGG - Intergenic
1074530876 10:114297837-114297859 CAGGGTTAACAGGAGGAGCCAGG - Intronic
1075383155 10:122035099-122035121 CAGGGACACCCGTAGGAGCCTGG - Intronic
1075747236 10:124736435-124736457 CTGGGTGAGGAGAAGGAGCCTGG - Intronic
1076268395 10:129129287-129129309 GAGGGACTCCAGAAGGAGCCAGG - Intergenic
1076288193 10:129321990-129322012 GAGGGAGACAAGAAGGAGGCCGG - Intergenic
1076881225 10:133240124-133240146 CAGAGACCCCAGAAGGAGCCAGG - Exonic
1076930819 10:133530558-133530580 CAGGGTGCTCAGAAAGTGCCTGG - Intronic
1077228798 11:1449629-1449651 CAGGGTGTGCAGCAGGACCCAGG + Intronic
1077362741 11:2147907-2147929 CAAGGTGACCTGAAGGAACCCGG - Intronic
1077902749 11:6502941-6502963 CAGGGGGAGGAGAAGGGGCCTGG - Intronic
1078062884 11:8059862-8059884 CAAGGAGACCAGAAGGAGGCTGG + Intronic
1079124362 11:17708314-17708336 CAGGGTGCACAGTAGGAGCTTGG - Intergenic
1079336831 11:19577478-19577500 TAGGGGGCCCAGGAGGAGCCGGG - Intronic
1080222737 11:29924861-29924883 GAGTGGGACAAGAAGGAGCCTGG - Intergenic
1080688780 11:34538138-34538160 CAGGGTGACAGGAAAGAGCCTGG - Intergenic
1084359557 11:68660683-68660705 CAGGGTGAGCAGAGGAAGGCAGG + Intergenic
1084529164 11:69717023-69717045 GAGGGTGGCCAGAGGGAGCCAGG + Intergenic
1084604851 11:70166471-70166493 CAGGGTTTCCAGATGGAGGCTGG + Intronic
1084630616 11:70346185-70346207 CAGTGTGACCAGGGGGTGCCTGG + Intronic
1084900130 11:72303428-72303450 CAGGGTGGCAAGAAGAACCCTGG + Intronic
1085021572 11:73213441-73213463 CAGGCTGCCCAGGAGGAGCTAGG + Intergenic
1086837826 11:91647680-91647702 TTGAGTGATCAGAAGGAGCCAGG - Intergenic
1088625552 11:111727764-111727786 CAAGGTGACAAGCAGCAGCCTGG + Exonic
1088740792 11:112765340-112765362 GATGGTGACCAGCAGGTGCCTGG + Intergenic
1088993091 11:114971485-114971507 CAGACTGAACAAAAGGAGCCAGG - Intergenic
1089129083 11:116198476-116198498 CAAGGTGACCAGCAGGATTCAGG + Intergenic
1089325851 11:117656300-117656322 CAGGGTTACCTGGTGGAGCCAGG - Intronic
1089789047 11:120929371-120929393 CAATGGGATCAGAAGGAGCCAGG - Intronic
1090071322 11:123546934-123546956 CAGAATGACCAGTAGGAGCAGGG + Intronic
1090265687 11:125351528-125351550 CAGGCTGACGGGAAAGAGCCCGG - Intronic
1091156966 11:133383075-133383097 CAGGGTGACCAGGAGGATGTTGG - Intronic
1091172374 11:133530282-133530304 CAGCGCGCCCTGAAGGAGCCAGG - Intronic
1092054812 12:5500039-5500061 CAGCCTAAACAGAAGGAGCCGGG + Intronic
1092140396 12:6179622-6179644 CACAGTGCTCAGAAGGAGCCTGG - Intergenic
1095547449 12:43388326-43388348 GAGGGTGAACAGAAGCAGGCAGG - Intronic
1095580011 12:43786985-43787007 CAGGGTTAGCAAAAAGAGCCTGG + Exonic
1095985289 12:47995272-47995294 CAGGGGGACCAGGAGGACCACGG + Exonic
1096815934 12:54201726-54201748 CAGGGTCACCAGATGGAGAGCGG - Intergenic
1098140350 12:67444479-67444501 CAGGTTGAACAAAAGGAGCTAGG + Intergenic
1098722172 12:73914031-73914053 CAGGGTGACTAGATGGAAGCAGG + Intergenic
1098750970 12:74292913-74292935 CAGAGACCCCAGAAGGAGCCGGG - Intergenic
1099862142 12:88234127-88234149 CAAGGTTACCCCAAGGAGCCTGG + Intergenic
1100345626 12:93727287-93727309 CAGAGTGACCACAGGAAGCCAGG - Intronic
1101498823 12:105281844-105281866 AAGGGAAAACAGAAGGAGCCTGG + Intronic
1102455025 12:113065771-113065793 GAGGGTGACGAGGAGGGGCCAGG + Intronic
1103091705 12:118102781-118102803 CAGGGAGAGGAGATGGAGCCAGG - Intronic
1103535791 12:121633096-121633118 CATGGAGCCCAGCAGGAGCCAGG + Intronic
1104593563 12:130104082-130104104 CAGGAGGACCCGAAGGAGCCAGG - Intergenic
1105623701 13:22093043-22093065 GAGGCTGACCAGATGGAGTCAGG - Intergenic
1105794624 13:23838700-23838722 CAGGCTGACTATTAGGAGCCAGG + Intronic
1105854399 13:24361766-24361788 CAGGGTGCCCAGAGGAAGGCGGG + Intergenic
1105898483 13:24738375-24738397 CAGGGAGAACAGAAGGGGCCTGG - Intergenic
1106305026 13:28501757-28501779 AAGTGTGTCCAGGAGGAGCCTGG - Intergenic
1106378893 13:29216655-29216677 CAGGGTGAGCAGAAGCAGGGTGG - Intronic
1110440489 13:75520725-75520747 CATAGGTACCAGAAGGAGCCAGG - Intergenic
1112569827 13:100583951-100583973 CAGGGTGACCAGAAAGTCCATGG + Exonic
1113381226 13:109808032-109808054 CACGGTGCACAGAAGCAGCCTGG + Intergenic
1113424707 13:110198494-110198516 CAGGGGAACCAGGAGGACCCGGG + Exonic
1113481438 13:110624927-110624949 GAGGGTGACCAGACCGAGCTGGG + Intronic
1113693615 13:112329179-112329201 CAGGGTGGACAGAAGGACCCAGG - Intergenic
1113732024 13:112648379-112648401 GAGGGTTACCACATGGAGCCTGG + Intronic
1113762532 13:112859574-112859596 CAGGGTGCCCAGCAGCAGGCGGG + Intronic
1114055509 14:18964631-18964653 CACTGGGACCAGATGGAGCCAGG + Intergenic
1114107036 14:19437132-19437154 CACTGGGACCAGATGGAGCCAGG - Intergenic
1114811573 14:25906532-25906554 CTGACTGACCAGAAGGAACCAGG + Intergenic
1116002030 14:39254113-39254135 GAGGGTGGGGAGAAGGAGCCTGG + Intronic
1116695047 14:48164289-48164311 AAGGGTAATCAGAAGAAGCCTGG - Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1118475193 14:66109832-66109854 CCTGATGACCACAAGGAGCCAGG + Intergenic
1118704544 14:68468706-68468728 CAAGATAACCAGAAGGAGTCAGG - Intronic
1119021992 14:71124015-71124037 CAGGATCACCAGGAGGAGGCGGG - Intergenic
1120209272 14:81618903-81618925 GAAGGTGACCAGAAGGTGTCAGG - Intergenic
1122266325 14:100548598-100548620 CAGGGTGCCCAGAAGGGGCAGGG - Intronic
1122286579 14:100655922-100655944 CAGGACCACCAGCAGGAGCCAGG - Intergenic
1122897672 14:104768578-104768600 TTGGGTGACCAGCACGAGCCAGG - Intergenic
1123449343 15:20350281-20350303 CAGGGTGACCAGATGCTGGCCGG - Intergenic
1124226806 15:27901958-27901980 CACTGTGACCAGAAGGGTCCTGG + Intronic
1124377058 15:29135041-29135063 CAGCATGACCAGAAGCATCCAGG - Intronic
1124549025 15:30660648-30660670 CAGGGTGACCAGCAGGTCCTAGG - Intronic
1125077693 15:35638731-35638753 GTGGGTGACCAAAAGGAGCTTGG + Intergenic
1125104800 15:35957921-35957943 CAGGATGCCCAGTAGCAGCCAGG - Intergenic
1125145115 15:36458058-36458080 AAGTTTGACTAGAAGGAGCCTGG + Intergenic
1125748763 15:42014703-42014725 TAGAGTGACCAGAAGGACCTGGG - Intronic
1127017631 15:54707023-54707045 TAAGGGGACCAGAAGGATCCTGG + Intergenic
1128303610 15:66583097-66583119 AAGGGTGACCAGAAGCAAACTGG - Intronic
1128311100 15:66632175-66632197 CAGGGAGACCAGACTGCGCCTGG + Intronic
1128735454 15:70051287-70051309 CAGGAAGAACAGGAGGAGCCTGG - Intronic
1129323306 15:74786743-74786765 CAGGGTTGCCAGGAGGAGACTGG - Intronic
1129324926 15:74794816-74794838 CATGGAGAGCAGAAGGAGCTGGG - Intronic
1129890446 15:79068233-79068255 CAGCGTGAACAGAAGGACCCTGG - Intronic
1130542233 15:84828492-84828514 CAGGCTCTCCAGAGGGAGCCTGG - Intronic
1132176658 15:99721339-99721361 CAAAGTGCCCATAAGGAGCCAGG + Intronic
1132646645 16:1002292-1002314 CAGGGAGCCCAGAAGGGGGCTGG - Intergenic
1132726635 16:1341739-1341761 CAGGGAGTCCAGAAGCAGCAGGG - Intronic
1133617457 16:7491411-7491433 CATTGTGAGCAGAAGCAGCCTGG + Intronic
1134682023 16:16132942-16132964 CAGGTTGACTAGAAAGAGCCAGG - Intronic
1135116158 16:19725004-19725026 GAGGCAGAGCAGAAGGAGCCCGG - Intronic
1135432395 16:22396665-22396687 CAGTCTGCCCAGGAGGAGCCTGG + Intronic
1135683273 16:24477171-24477193 CAGGGAAACTAGAAGAAGCCTGG - Intergenic
1136097225 16:27965809-27965831 CACAGTGACCAGAAGTATCCTGG + Intronic
1136139590 16:28280072-28280094 CATGGTGGCCAGATTGAGCCAGG - Intergenic
1136477444 16:30522281-30522303 CAGGAAGACAGGAAGGAGCCTGG - Exonic
1137068895 16:35881228-35881250 CATGGTGGCCAGAAGGAGGTAGG - Intergenic
1137558462 16:49488319-49488341 CAGAGTGCCCAGAAGCAGGCAGG - Exonic
1137732603 16:50699668-50699690 GACGGTGTCCAGAAGGCGCCTGG - Exonic
1137948179 16:52755975-52755997 CAGAGTAACCAGGAGGAGCCAGG + Intergenic
1138652804 16:58471404-58471426 CAGAGTGATCAGAACGAGGCTGG - Intronic
1139923440 16:70473324-70473346 CAGCGTGGCCAGCAGGGGCCCGG - Exonic
1140515083 16:75535620-75535642 CAGGGTGGCCGGCGGGAGCCAGG + Intronic
1140681866 16:77393121-77393143 CATGGTGACCAGATGGTCCCTGG - Intronic
1141974694 16:87507772-87507794 AAGTGTGACCAGGAGGAGGCTGG + Intergenic
1142578813 17:927623-927645 CAGGAGGAGCAGAAGGAGGCGGG + Intronic
1142905787 17:3040958-3040980 CAGGGAAACCAGAGAGAGCCAGG - Intergenic
1143376868 17:6472172-6472194 CAGGGAGAACAGCAGGAGCGAGG - Intronic
1143405577 17:6675202-6675224 CTGGGTTACCAGCAGGAGTCAGG + Intergenic
1143561899 17:7701456-7701478 CAGCGTGGCCAGCAGCAGCCGGG + Exonic
1144206126 17:12980638-12980660 CAGGGTGACAGGAGGGAGTCAGG + Intronic
1144371699 17:14597627-14597649 GAGGGTGACCAGAAGTAGAGTGG + Intergenic
1145711592 17:26983344-26983366 GCGGCTGAGCAGAAGGAGCCAGG + Intergenic
1146017655 17:29246873-29246895 CAGGCTGAGCAGCAGGAGCTGGG + Exonic
1146634595 17:34494677-34494699 CCAGGTGACCAGAAGGAGCAGGG + Intergenic
1147555669 17:41477433-41477455 CATGGTGCCTAGAAAGAGCCTGG - Intronic
1147978389 17:44260604-44260626 CAGGGGGTCCAGAAGGGCCCAGG + Intronic
1148805365 17:50261176-50261198 AGGGGTGACCAGGAGGAGCCCGG + Intergenic
1149640023 17:58196789-58196811 CGGGGTGAGCAGCATGAGCCTGG + Intronic
1149661217 17:58334956-58334978 CAGGGTGACTGGAAGGAGCTGGG + Intergenic
1150215669 17:63467573-63467595 CAGAGTTAACAGAAGCAGCCGGG + Intergenic
1150292266 17:63988613-63988635 CTGGGGGACCAGAAGGGGTCTGG - Intergenic
1150441830 17:65197548-65197570 GAGGCTGACTAGAAGGAGCGGGG - Intronic
1150507542 17:65714990-65715012 CAGGTGGAGCAGAAGGAGCAAGG + Intronic
1151084905 17:71368984-71369006 CAGGATGACAAGAAGAAGACAGG + Intergenic
1151353782 17:73546554-73546576 CTGGCTGACCAGAGGGAGCAAGG + Intronic
1151817172 17:76477083-76477105 CAGGGTGCTCAGAAGGGGCTTGG + Intronic
1152157043 17:78641311-78641333 CTGGTTGACCAGAGGGAGCTTGG - Intergenic
1152341541 17:79728570-79728592 CGGGGTGCACAGAAGGGGCCTGG - Intergenic
1152696795 17:81801669-81801691 CAGGGTGAGCAGACGTCGCCTGG + Intergenic
1153491065 18:5648437-5648459 CAGTGAGAGCTGAAGGAGCCTGG + Intergenic
1153592310 18:6686579-6686601 CAGAGTGACAGGAAGGAGCCAGG + Intergenic
1153732223 18:8025934-8025956 CAGGGAGAGCAGAAGGAGAAAGG + Intronic
1154024569 18:10695440-10695462 CAGGGTGGCCAGAAGCTGTCAGG - Intronic
1155644464 18:28060802-28060824 GAGGTTCACCAGAAGGAGCCAGG - Intronic
1157181049 18:45498447-45498469 CAGGGTGACAGGAAGCAGCCTGG + Intronic
1157280763 18:46345044-46345066 CAGCTTGGCCAGAAGGAGCGAGG - Intronic
1157576376 18:48746549-48746571 CAGGCTGGCCAGGAGGAGTCAGG + Intronic
1158303848 18:56083145-56083167 CAGCGCCACCTGAAGGAGCCAGG + Intergenic
1159804706 18:72941904-72941926 CAGTGTGACGGGAAGGAGGCAGG + Intergenic
1159901685 18:74053098-74053120 GAGGGTGAGCAGAAGCAGCGTGG + Intergenic
1160187784 18:76688841-76688863 CAGGAGGAGCAGAAGCAGCCGGG + Intergenic
1160219235 18:76960503-76960525 TAGGGAGACCAGAGGGAGCCTGG - Intronic
1160230266 18:77043531-77043553 CAGGGTCACCAGCAGGTCCCCGG - Intronic
1160513077 18:79463358-79463380 CAGGGTGCTCAGAAGGGTCCTGG + Intronic
1160805264 19:989769-989791 CAGGATGACCAGAAGGTTCCCGG - Exonic
1161291140 19:3494001-3494023 CAGGGAGACAAGCAGGGGCCTGG + Intronic
1161552754 19:4923267-4923289 CAGGAGGAGCAGACGGAGCCAGG - Intronic
1161771864 19:6235308-6235330 GAGGGACACCAGCAGGAGCCTGG + Intronic
1163702130 19:18791231-18791253 CAGGGTGAGCAGAAGAACGCAGG + Exonic
1165895504 19:39138865-39138887 CAGCGTGGCAGGAAGGAGCCAGG + Intronic
1166338178 19:42121701-42121723 CAGGGAGGCCGGAAGCAGCCAGG - Intronic
1166755393 19:45187525-45187547 CAAGGAGACCAGATGGGGCCAGG - Intronic
1167360183 19:49025916-49025938 CAGGAAGACCAGAGGGGGCCCGG + Intronic
1167360902 19:49029865-49029887 CAGGAAGACCAGAGGGGGCCCGG - Intronic
1167362750 19:49038932-49038954 CAGGAAGACCAGAGGGGGCCCGG + Intergenic
1167363385 19:49042256-49042278 CAGGAAGACCAGAGGGGGCCCGG - Intergenic
1167365108 19:49050671-49050693 CAGGAAGACCAGAGGGGGCCCGG + Intergenic
1167472294 19:49682075-49682097 CAGGGTGGCCAGGCGGGGCCGGG + Intronic
1167705693 19:51079684-51079706 CAGGGCAACCTGAAGGATCCTGG + Exonic
1167734233 19:51282109-51282131 CAACGTGACCAGAAGTAGCTTGG + Intergenic
924989029 2:295429-295451 GAGGGTGGGCAGAAGGAGGCAGG - Intergenic
925302774 2:2828792-2828814 CAGGCAGACCAGAGGGAGACAGG + Intergenic
925389614 2:3486363-3486385 CAGGGTGACCAGAAGGAGCCAGG - Intergenic
925824282 2:7832303-7832325 CTGTGTTACCAGAAGGAGCATGG + Intergenic
926043118 2:9690586-9690608 CATGCTGGCCAGAAGGAGCTGGG + Intergenic
927481150 2:23455132-23455154 CAGCTCTACCAGAAGGAGCCAGG - Intronic
929136103 2:38625234-38625256 TAGGGTGGCCAGAAGCAGACAGG + Intergenic
930028987 2:47046993-47047015 CAGGGTCTCCAGCAGGAGACAGG - Intronic
930111524 2:47682849-47682871 CAGGGTGACCAGATGTCACCTGG + Intergenic
930723202 2:54657802-54657824 CACGTTGACCAGGAGGTGCCGGG - Intronic
930728933 2:54709359-54709381 CAGAGTGAGCAGCAGGAGCTGGG - Intergenic
931135566 2:59395731-59395753 CAGGCTTCACAGAAGGAGCCTGG - Intergenic
933488368 2:82950819-82950841 GAGGGTGAGCAGAAGGAGGGTGG - Intergenic
935217856 2:100988812-100988834 CAGGGGGACCTGGAGGAGCAGGG - Intronic
935361448 2:102250070-102250092 CATGGTAACCTGGAGGAGCCTGG - Intergenic
937997912 2:127708928-127708950 CAGTGTGACCAGAAGTAGATGGG + Intronic
938287609 2:130130328-130130350 GAGGGTGACGAGAGGGAGCAGGG + Intergenic
938427985 2:131208531-131208553 GAGGGTGACGAGAGGGAGCAGGG - Intronic
938473671 2:131589208-131589230 CACTGGGACCAGACGGAGCCAGG + Intergenic
939635171 2:144573342-144573364 CAGGGTCACCAATAGGAGCTAGG + Intergenic
940898025 2:159099710-159099732 CAGGGTGACCAGATGTCACCTGG - Intronic
942043946 2:172088267-172088289 CGGGGAGACAAGAAGGAGACGGG - Exonic
943789730 2:191918569-191918591 TTGGGAGCCCAGAAGGAGCCGGG + Intergenic
946033553 2:216724120-216724142 CAGGGTGCAGAGAAGTAGCCAGG + Intergenic
946131925 2:217613139-217613161 AAGAGTGCCCAGCAGGAGCCAGG - Intronic
947533010 2:230924676-230924698 ACTGGGGACCAGAAGGAGCCTGG - Intronic
948802804 2:240440565-240440587 CAGGGAGGCCAGGAGGAGCTGGG - Intronic
948802816 2:240440600-240440622 CAGGGAGGCCAGGAGGAGCTGGG - Intronic
948802828 2:240440635-240440657 CAGGGAGGCCAGGAGGAGCTGGG - Intronic
948802840 2:240440670-240440692 CAGGGAGGCCAGGAGGAGCTGGG - Intronic
948802852 2:240440705-240440727 CAGGGAGGCCAGGAGGAGCTGGG - Intronic
948802864 2:240440740-240440762 CAGGGAGGCCAGGAGGAGCTGGG - Intronic
948802876 2:240440775-240440797 CAGGGAGGCCAGGAGGAGCTGGG - Intronic
1170480517 20:16760715-16760737 CACGGTTACCTGAAGCAGCCAGG + Intronic
1172872593 20:38144940-38144962 CAGGGTGACCAGGATGACCAGGG + Intronic
1173841516 20:46160490-46160512 CAGGGTGACCAGATGGCAACAGG - Intergenic
1173940939 20:46910617-46910639 CAGGCTGACCATCAGGGGCCTGG - Intronic
1174187846 20:48719773-48719795 CAGGGAGACCAGAAAGTGCTTGG - Intronic
1174820633 20:53723908-53723930 CAGAGTGAGCAGAGGTAGCCTGG + Intergenic
1175647287 20:60685258-60685280 CAAGGAGACCTGAAGAAGCCAGG - Intergenic
1175675847 20:60945954-60945976 CAGGATGACCAGCAGCAGACAGG + Intergenic
1175922203 20:62455544-62455566 CAGGGTGCAGAGAAGGGGCCTGG - Intergenic
1175974216 20:62702285-62702307 CAGGGTGGGCAGAGGGAGCCTGG + Intergenic
1175974240 20:62702355-62702377 CAGGGTGGGCAGAGGGAGCCTGG + Intergenic
1176515711 21:7781846-7781868 ATGGGTGACCAGAGAGAGCCAGG - Intergenic
1178408821 21:32347449-32347471 CAGGGTGACCTCACGGAGCTGGG + Exonic
1178649739 21:34411858-34411880 ATGGGTGACCAGAGAGAGCCAGG - Intergenic
1178832969 21:36071623-36071645 CATGGTGACCTGCAGGATCCTGG - Intronic
1179804296 21:43827094-43827116 CAGGGCGAGCAGAAGCAGCTGGG + Intergenic
1179921618 21:44510555-44510577 CAGGGGGACCAGAAGATGCCTGG - Intronic
1179967264 21:44814717-44814739 CAGGGCAGCGAGAAGGAGCCTGG - Intronic
1180061670 21:45388495-45388517 CAGGGTGGCCAGAAGAGGACAGG + Intergenic
1180473987 22:15687183-15687205 CACTGGGACCAGATGGAGCCAGG + Intergenic
1181543623 22:23587967-23587989 CAGGGTGACCAGATGTCACCTGG - Intergenic
1181671418 22:24427250-24427272 CAGGGTGACCAAGCAGAGCCTGG - Intronic
1182361214 22:29747597-29747619 GAGGGTGACTGGCAGGAGCCAGG - Intronic
1182821711 22:33222309-33222331 GAGGGTTACCAGCATGAGCCTGG + Intronic
1183030733 22:35102626-35102648 CAGGGTCACATGAAGGAACCTGG + Intergenic
1183426808 22:37744405-37744427 CAGGATGACAGGCAGGAGCCAGG + Intronic
1184301748 22:43564970-43564992 CAGGGTGAACAGAAGCAGGGGGG - Intronic
1184406705 22:44304628-44304650 CAGGAGGGCCAGAAGGAGGCTGG - Intronic
1184891847 22:47384530-47384552 CATTGTGAAGAGAAGGAGCCAGG + Intergenic
1185088979 22:48755460-48755482 CAGGCTGATCAGGGGGAGCCAGG + Intronic
1185330593 22:50250552-50250574 CAGGGTCACCAGCAGGAGCAGGG + Intronic
949942011 3:9162535-9162557 CAAGTGGACCAGAAGGAGCAGGG - Intronic
950711418 3:14815677-14815699 CACGGTGACCAGAAACAGCTGGG - Intergenic
950991945 3:17449082-17449104 GAGGGTGAGCAGAAGCAGCATGG + Intronic
951747877 3:25999361-25999383 CAGGGTGAGCACAAGGGGTCAGG - Intergenic
952974034 3:38679047-38679069 CAGGATGCCCAGAAGGACCAAGG + Intergenic
953311266 3:41882038-41882060 CAGGGTGACCAACAGGTCCCAGG + Intronic
953695154 3:45152496-45152518 TAAGGTGACCAGAAGGAGCAAGG - Intergenic
954538114 3:51376317-51376339 CAGGGTGCCCCAAAGGAGTCCGG + Intronic
955888172 3:63622133-63622155 CAGGGTGATCGGAAAGAGCTAGG - Intergenic
956056058 3:65300351-65300373 CAGAGCCTCCAGAAGGAGCCAGG - Intergenic
956297503 3:67730152-67730174 CAGGGAGGCCAGTAAGAGCCTGG + Intergenic
956555778 3:70521050-70521072 CAGGGTGACCCAAAGCAGTCGGG + Intergenic
957153548 3:76518214-76518236 CAGTATGACCTGAAGGACCCAGG + Intronic
959117718 3:102197357-102197379 AAGGGAGACCAGAAGAAGTCTGG - Intronic
960602145 3:119469085-119469107 CAGGGCCGCCAGAAGGAGTCAGG + Exonic
963495385 3:146053102-146053124 CAGGGTGAGGAGACGTAGCCAGG + Intergenic
965820075 3:172676344-172676366 CATGGTGACAAGAAGAAGGCAGG - Intronic
966192716 3:177286004-177286026 AAGGGTTACATGAAGGAGCCAGG + Intergenic
968439111 4:612657-612679 CAGGAAGACCAGCAGGAGCCTGG + Intergenic
968519252 4:1028328-1028350 CAGGGGGACCCCAAGGAGTCAGG + Intergenic
968931465 4:3581706-3581728 CAGAGTGACCAGCAGGCTCCTGG - Intronic
970427986 4:15963094-15963116 CAAGGTCACCAGCAGGAGGCAGG + Exonic
972357073 4:38289785-38289807 CAGGGAGAAGAAAAGGAGCCTGG + Intergenic
977439048 4:97038387-97038409 GAGGGTGACCAGAAGCAGTGGGG - Intergenic
981229930 4:142340711-142340733 CAGGCTAACGAGAAGGACCCTGG - Intronic
982802458 4:159722132-159722154 CCGAGTGAGCAGAACGAGCCCGG - Intergenic
984889064 4:184474976-184474998 CAGGGTGGCCTGAAGGTTCCAGG + Intergenic
985542321 5:492691-492713 CCGGGGGACCAGAACCAGCCGGG - Intronic
985581473 5:697619-697641 CAAGCAGACCACAAGGAGCCTGG + Intergenic
985596100 5:788950-788972 CAAGCAGACCACAAGGAGCCTGG + Intergenic
986013963 5:3741082-3741104 CAGGGAGACCAGACAAAGCCGGG + Intergenic
986032443 5:3906749-3906771 CTGTGGGACCAGGAGGAGCCAGG + Intergenic
987198118 5:15547730-15547752 GAGGGAGACCAGAAAGAGTCCGG + Intronic
995263860 5:110136247-110136269 GAGGGTGAGCAGAAGCAGGCTGG - Intergenic
995464339 5:112435843-112435865 GAGGGTGAGCAGAAGCAGGCTGG + Intergenic
995671952 5:114615095-114615117 ATGGCTGACAAGAAGGAGCCAGG + Intergenic
998020871 5:138769185-138769207 CAGGAAAACAAGAAGGAGCCAGG - Intronic
998923822 5:147100682-147100704 CACGGTGCCCAGAAGATGCCAGG + Intergenic
999476024 5:151899598-151899620 GAGGGTGACCAGCAGGGCCCAGG - Intronic
1001536708 5:172503177-172503199 CAGTGTGAGCAGAGGGATCCAGG + Intergenic
1001758120 5:174186301-174186323 CAGAGGGAGCAGGAGGAGCCGGG - Intronic
1002313863 5:178330860-178330882 CTGAGTGACAAGAAGTAGCCAGG - Intronic
1002419310 5:179137478-179137500 CACGGTGAACTGCAGGAGCCCGG + Intronic
1002644344 5:180645830-180645852 CAGTGTGTCCAGCTGGAGCCAGG - Intronic
1002912965 6:1505295-1505317 CAGGGAGCCCAGAAGGTCCCAGG + Intergenic
1003422050 6:5967516-5967538 CAGGCTGACCAGGAGGCCCCAGG + Intergenic
1005681484 6:28212751-28212773 CAGGGCGGCCAGCTGGAGCCGGG + Intergenic
1005894073 6:30163366-30163388 CCTAGGGACCAGAAGGAGCCAGG + Exonic
1005917346 6:30364796-30364818 CAGGGAGACCAGGAGGTGGCAGG + Intergenic
1006515877 6:34545298-34545320 CAGGCTTTCCAGGAGGAGCCAGG + Intronic
1007070577 6:39035115-39035137 CATGGTAACCAGAAGGAGCATGG + Intergenic
1007170608 6:39860642-39860664 CAGGGTGACCTGAAGCAGGAGGG + Intronic
1007943714 6:45806218-45806240 CAGAGTGACAGGAAGGAACCAGG + Intergenic
1008407676 6:51136734-51136756 GAGGGTGAGCAGAAGGAGGGTGG - Intergenic
1008815494 6:55559558-55559580 CAGGGGCACAAGAAGGAGCGTGG + Intronic
1010732770 6:79408790-79408812 CAGGGCTATCACAAGGAGCCAGG - Intergenic
1012258912 6:97065000-97065022 CAGGGTTCCCTGCAGGAGCCGGG + Intronic
1013024956 6:106262703-106262725 GAGGGTGACCAGAAGCAGGGTGG + Intronic
1013480585 6:110549607-110549629 CGGGGTCACCACAGGGAGCCTGG + Intergenic
1013691865 6:112654515-112654537 CAGGAAGACGAGAAGGATCCAGG + Intergenic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1017987270 6:159455322-159455344 AAGGGGGCCGAGAAGGAGCCAGG + Intergenic
1019070600 6:169341833-169341855 GAGGGTGCACAGATGGAGCCGGG - Intergenic
1019088493 6:169503126-169503148 CAGAGTGACGAGAAAGAGGCAGG + Intronic
1019203753 6:170341775-170341797 GAGGGTGACCAGAAGCAGGGTGG - Intronic
1019299518 7:296266-296288 CAGGAGGACCAGGAGGTGCCAGG - Intergenic
1019299557 7:296377-296399 CTGGGGGTCCAGAAGGGGCCTGG - Intergenic
1019346845 7:535288-535310 CAGGGTGAAGAGGAGGAGCCGGG - Intergenic
1019475324 7:1241533-1241555 CACGGTGGCCACGAGGAGCCGGG + Intergenic
1020534464 7:9377858-9377880 CATGGTGAGCAAAAGGTGCCAGG + Intergenic
1021921769 7:25492453-25492475 GAGGGGGACCAGAAGGAGCTGGG + Intergenic
1023185271 7:37526571-37526593 CAGTGTGACCAAAAGGAATCTGG - Intergenic
1025029963 7:55548956-55548978 CAGGGTGACCACAGTGAGACTGG + Intronic
1025230676 7:57201620-57201642 CAGTGTGGCCAGGAGGAGGCAGG - Intergenic
1025230969 7:57203201-57203223 CAGGGAGACCAGGGGGAACCAGG - Intergenic
1026676607 7:72433684-72433706 CAGGGTAGCAAGAAGGACCCAGG + Intronic
1027476031 7:78632494-78632516 CAGGGGATCCAGAAAGAGCCTGG + Intronic
1029176045 7:98665147-98665169 CAGGGAGGCCAGAAGGTCCCAGG - Intergenic
1030482225 7:110119552-110119574 GAGGGTGAGCAGAAGCAGGCTGG + Intergenic
1031730917 7:125299543-125299565 CCCCGTGAGCAGAAGGAGCCAGG + Intergenic
1033251172 7:139761166-139761188 CAGGGTAACCAGACGGCCCCAGG + Intronic
1033890439 7:146006416-146006438 CAGGGGGAGGAGAAGGAGCAGGG - Intergenic
1033956389 7:146854054-146854076 CAGGGAGATGAGAAGGAGGCTGG + Intronic
1034274638 7:149818663-149818685 CAGGGGGACCAGGAGGACCATGG - Intergenic
1034978892 7:155463364-155463386 GAGGGTGAGGAGAGGGAGCCGGG - Exonic
1035072652 7:156156747-156156769 CAGGGTGGCCACAACCAGCCTGG - Intergenic
1035196008 7:157221044-157221066 CGTGCTGACCAAAAGGAGCCAGG - Intronic
1035212037 7:157336167-157336189 GATGGTGACCAGCAGGAGCAGGG - Intronic
1035324427 7:158055813-158055835 CACGGAGACCAGTAGTAGCCCGG - Intronic
1035563868 8:628523-628545 CAGGGTGACCCCAAGGGGCTGGG + Intronic
1035579761 8:732106-732128 CAGGGAGACAAGAAGGGGTCTGG - Intronic
1037688269 8:21162161-21162183 CAGGGAGACCAGGAGAGGCCTGG - Intergenic
1037809643 8:22080015-22080037 GAAGGTGACCAGTAGGAGCTGGG + Intronic
1038450860 8:27637907-27637929 CAGGGGCACGGGAAGGAGCCAGG + Intronic
1038567823 8:28634548-28634570 CAGGATGGGCAGAAAGAGCCAGG - Intronic
1038600979 8:28942123-28942145 CAGGGTGCCCCGGAGGTGCCAGG + Intronic
1040489766 8:47909086-47909108 CAGGGTGACCAGACACTGCCTGG - Intronic
1042894512 8:73651605-73651627 CAGAGACCCCAGAAGGAGCCAGG - Intronic
1045384846 8:101662334-101662356 CTGGGCGAGCAGAAGGAGACTGG - Intronic
1045554379 8:103201337-103201359 TAGGGTGACCAACAGGTGCCTGG - Intronic
1046541595 8:115590514-115590536 CAGGGTGACAAGAAGGAGAAGGG + Intronic
1046984198 8:120369421-120369443 CAGGCTGGCCAGAAGGACCTTGG - Exonic
1047646947 8:126879410-126879432 TAGAGTGACCAGAAGCAGTCTGG + Intergenic
1047719716 8:127628386-127628408 CACGGTGAGCAGAAGGATCTAGG - Intergenic
1048474054 8:134727259-134727281 CTGAGTGATAAGAAGGAGCCAGG + Intergenic
1048573348 8:135672539-135672561 GAGGGTGCTCAGAAGGAGCGGGG - Intergenic
1049061391 8:140278753-140278775 GCGGGTGCCCAGATGGAGCCTGG - Intronic
1049247777 8:141571889-141571911 CCCGGTGACCCAAAGGAGCCAGG + Intergenic
1049334607 8:142076533-142076555 GAGGGTCATGAGAAGGAGCCGGG - Intergenic
1049381498 8:142318635-142318657 CTGGGGGCCGAGAAGGAGCCAGG + Intronic
1049428928 8:142550304-142550326 CCGGGTGTCTAGAATGAGCCAGG - Intergenic
1050186538 9:2981080-2981102 CCTGGTGACAAGAAGGAGGCAGG - Intergenic
1051209628 9:14728046-14728068 CAGGGTGAAAAGAAGGACCGTGG - Intergenic
1051374113 9:16386883-16386905 CAGAGAGACCAGCAGGAGGCAGG + Intergenic
1052914691 9:33915912-33915934 CTGAGTGACAGGAAGGAGCCAGG + Intronic
1053262048 9:36675734-36675756 TTGGGTGACCAGAAGAGGCCTGG - Intronic
1053429428 9:38032408-38032430 CCTGTTGCCCAGAAGGAGCCTGG - Intronic
1054458665 9:65450223-65450245 CAGAGTGACCAGCAGGCTCCTGG + Intergenic
1056095385 9:83248104-83248126 CAGGCCCACCACAAGGAGCCTGG + Exonic
1056451805 9:86723642-86723664 CGAGGTGACCTGCAGGAGCCAGG + Intergenic
1056859325 9:90165133-90165155 GAGGCTGTCCAAAAGGAGCCTGG - Intergenic
1057311549 9:93946251-93946273 CAGGGTGTCCGGAACGAGCAAGG - Intergenic
1057500185 9:95590653-95590675 CAGGTTGTCCAGGAAGAGCCAGG - Intergenic
1058182436 9:101815365-101815387 GAGGGTGAGCAGAAGCAGCGTGG + Intergenic
1060216885 9:121743784-121743806 CAGGGAGACCTGAATGAGCTGGG + Intronic
1060311442 9:122466131-122466153 CAGGGTCACATCAAGGAGCCTGG - Intergenic
1061777423 9:132974772-132974794 CTGGATGACAAGAAGGAGACAGG + Intronic
1062050169 9:134443074-134443096 CTGGGTGACCAGAGGAGGCCAGG + Intergenic
1062261363 9:135664807-135664829 CTGTGAGACCAGGAGGAGCCTGG - Intronic
1062481465 9:136754431-136754453 CAGGGTGCCCAGGAGGGGCAGGG + Exonic
1203775215 EBV:69137-69159 CAGGTTGGCCAGAAAGAGACAGG - Intergenic
1186101663 X:6163925-6163947 CAAGGAAACCAGAAGGAACCAGG + Intronic
1186156645 X:6733043-6733065 CAGGGTGATGAGAAGGGGCATGG + Intergenic
1188072623 X:25735906-25735928 CTGAATGACAAGAAGGAGCCAGG + Intergenic
1188141611 X:26558134-26558156 CAGAGACCCCAGAAGGAGCCAGG - Intergenic
1191115291 X:56846236-56846258 CAGGGTATCCACAAGGAGGCTGG - Intergenic
1192980292 X:76332183-76332205 GAGGGTGAGCAGAAGCAGGCTGG + Intergenic
1194583351 X:95703716-95703738 AAGTTTGACCAGAAGTAGCCTGG + Intergenic
1194810246 X:98380257-98380279 CAGGGTGCCCAGCAGCAGGCTGG - Intergenic
1197991413 X:132322149-132322171 CACAGAGACCAGAAAGAGCCAGG - Intergenic
1199974220 X:152883119-152883141 CAGGGTCAACAGGAGCAGCCAGG + Intergenic
1200053591 X:153447075-153447097 CAAGGAGGCCAGGAGGAGCCAGG - Intronic