ID: 925390088

View in Genome Browser
Species Human (GRCh38)
Location 2:3488609-3488631
Sequence AACTCAGATGAAATCCTATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925390085_925390088 2 Left 925390085 2:3488584-3488606 CCCTTTGCCAGGCTGTTGTATTT No data
Right 925390088 2:3488609-3488631 AACTCAGATGAAATCCTATTTGG No data
925390086_925390088 1 Left 925390086 2:3488585-3488607 CCTTTGCCAGGCTGTTGTATTTA No data
Right 925390088 2:3488609-3488631 AACTCAGATGAAATCCTATTTGG No data
925390087_925390088 -5 Left 925390087 2:3488591-3488613 CCAGGCTGTTGTATTTATAACTC No data
Right 925390088 2:3488609-3488631 AACTCAGATGAAATCCTATTTGG No data
925390083_925390088 13 Left 925390083 2:3488573-3488595 CCATTGACTTGCCCTTTGCCAGG No data
Right 925390088 2:3488609-3488631 AACTCAGATGAAATCCTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925390088 Original CRISPR AACTCAGATGAAATCCTATT TGG Intergenic
No off target data available for this crispr