ID: 925394564

View in Genome Browser
Species Human (GRCh38)
Location 2:3523718-3523740
Sequence CTGTTAACACCCATGAATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925394564_925394566 -5 Left 925394564 2:3523718-3523740 CCCAGATTCATGGGTGTTAACAG No data
Right 925394566 2:3523736-3523758 AACAGAAGTCAAGAGATTATCGG No data
925394564_925394567 26 Left 925394564 2:3523718-3523740 CCCAGATTCATGGGTGTTAACAG No data
Right 925394567 2:3523767-3523789 TAAAACACAGCCTATTACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925394564 Original CRISPR CTGTTAACACCCATGAATCT GGG (reversed) Intergenic
No off target data available for this crispr