ID: 925394607

View in Genome Browser
Species Human (GRCh38)
Location 2:3524136-3524158
Sequence GTGAAAAACACAATGACTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925394606_925394607 -10 Left 925394606 2:3524123-3524145 CCAGTGCAGGTGTGTGAAAAACA No data
Right 925394607 2:3524136-3524158 GTGAAAAACACAATGACTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925394607 Original CRISPR GTGAAAAACACAATGACTGC TGG Intergenic
No off target data available for this crispr