ID: 925395470

View in Genome Browser
Species Human (GRCh38)
Location 2:3530227-3530249
Sequence TAGTAGTACTACGGGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 1, 2: 1, 3: 7, 4: 61}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925395470 Original CRISPR TAGTAGTACTACGGGGAAGA AGG Intergenic
905417977 1:37817838-37817860 TAGAAGTACTAGGGGGCAGCAGG - Intronic
906028678 1:42699019-42699041 TAATAGTAGTAAGGGGAAAATGG + Intronic
907857324 1:58316581-58316603 GAGTAGTGCTAGGGAGAAGAGGG + Intronic
908820799 1:68084480-68084502 TAATAGAACTATGGGGTAGAAGG + Intergenic
911142231 1:94517037-94517059 AGGTAGTACTATGGGAAAGAAGG - Exonic
912775703 1:112505132-112505154 TAGTGCCACTATGGGGAAGAGGG + Intronic
918829696 1:189378551-189378573 TAGGACTACTAGGGGGGAGAAGG - Intergenic
919149949 1:193683365-193683387 AAGAAATACTATGGGGAAGAGGG - Intergenic
921612975 1:217233951-217233973 TGGTAGTCCTAGGGGGAAAATGG + Intergenic
1074336744 10:112584173-112584195 TAATAATACTACGGAGAGGAGGG - Intronic
1079794625 11:24785066-24785088 TAGTGTAACTACAGGGAAGAAGG - Intronic
1080179436 11:29406282-29406304 CAGCAGTCCTATGGGGAAGAGGG + Intergenic
1089713610 11:120336113-120336135 AAGTAGTCCTACGGGGCAGAGGG - Intergenic
1092976509 12:13750196-13750218 TAGCAGTCCTACAGGGAATAAGG - Intronic
1104797247 12:131528297-131528319 GAGTAGAACTTCAGGGAAGAGGG + Intergenic
1110982783 13:81922511-81922533 TTATAGTACTGAGGGGAAGATGG + Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1114852901 14:26401840-26401862 TAGAAGTGCTAAGGGGCAGATGG - Intergenic
1121136493 14:91503561-91503583 AAGTAGTACAAAGGGGCAGAGGG + Intronic
1126498620 15:49320200-49320222 TAGTAGTTCTACTCAGAAGAAGG + Intronic
1136049569 16:27640810-27640832 CAGTAGTGCTAAAGGGAAGACGG + Intronic
1138671696 16:58620736-58620758 CAGTAGTACCACAGGGAAGGAGG + Intronic
1146936729 17:36816714-36816736 TGGTAGAGCTACGGGGAGGAGGG - Intergenic
1153267507 18:3285610-3285632 TAGCAGTGCTACGGCAAAGATGG + Intergenic
1153284770 18:3448018-3448040 AAGGAGAACCACGGGGAAGAGGG + Intronic
1155831087 18:30515545-30515567 TAGAAGTAGTAAGGAGAAGAGGG + Intergenic
1157268617 18:46251042-46251064 TAGAAATACTATGGGGAACAAGG - Intronic
1159681755 18:71362427-71362449 TAGTAGTGCTCCAAGGAAGATGG - Intergenic
925395470 2:3530227-3530249 TAGTAGTACTACGGGGAAGAAGG + Intergenic
925395478 2:3530301-3530323 TATTAGTAGGATGGGGAAGAAGG + Intergenic
925395489 2:3530369-3530391 TAGTAGTAGTATGGGGAAGAAGG + Intergenic
925395494 2:3530406-3530428 TATTAGTAGGATGGGGAAGAAGG + Intergenic
925395500 2:3530443-3530465 TATTAGTAGGAGGGGGAAGAAGG + Intergenic
925395504 2:3530480-3530502 TAGTAGTAGTACGGGGAAGAAGG + Intergenic
925395512 2:3530554-3530576 TATTAGTAGGACGGGGAAGAAGG + Intergenic
925395517 2:3530585-3530607 TATTATTAGTAGGGGGAAGAAGG + Intergenic
925395525 2:3530651-3530673 TATTAGTAGTATGAGGAAGAAGG + Intergenic
925395530 2:3530688-3530710 TATTAGTAGGATGGGGAAGAAGG + Intergenic
925395536 2:3530757-3530779 TAGTAGTAGTATGAGGAAGAAGG + Intergenic
925395541 2:3530794-3530816 TATTAGTAGGATGGGGAAGAAGG + Intergenic
925395558 2:3530960-3530982 TATTAGTAGGATGGGGAAGAAGG + Intergenic
925395566 2:3531029-3531051 TAGTAGTAGTATGAGGAAGAAGG + Intergenic
925395571 2:3531066-3531088 TATTAGTAGGATGGGGAAGAAGG + Intergenic
925395577 2:3531103-3531125 TATTAGTAGGAGGGGGAAGAAGG + Intergenic
925395582 2:3531137-3531159 TAGTAGTAGGATGGGGAAGAAGG + Intergenic
942189706 2:173457596-173457618 CAGGAGTCCCACGGGGAAGACGG - Intergenic
944110124 2:196123303-196123325 TAGTAGTCCTATGTGCAAGAGGG + Intergenic
1179903065 21:44405127-44405149 TAGAAGAGCTACTGGGAAGAGGG - Exonic
1182654989 22:31883107-31883129 TGGTAGTGCTACTGGGTAGAGGG - Intronic
976794154 4:88913415-88913437 AAGTAGTAGTAGAGGGAAGAGGG + Intronic
989404509 5:41045039-41045061 TAGTAGTAATAAGGGGAAACTGG + Intronic
995245213 5:109927655-109927677 TAATAGTAATAGGGAGAAGAAGG - Intergenic
1004819993 6:19357206-19357228 TAGTAGTACTACTGGCAGGATGG - Intergenic
1005084080 6:21986068-21986090 TAGTAGTATCATGGGGAAGCTGG - Intergenic
1005275169 6:24209276-24209298 TAGTAGTAATAAAGGGAATATGG - Intronic
1007110632 6:39311678-39311700 TTGTAGGACTCTGGGGAAGAAGG + Intronic
1023247639 7:38222585-38222607 TAGTAGTGATACGAGGAACACGG + Intronic
1027588144 7:80083747-80083769 TAGTTGTACTGTGGGGAATAAGG + Intergenic
1027634799 7:80657933-80657955 TAGTAATGCTTTGGGGAAGAAGG - Intronic
1028267817 7:88749458-88749480 CAGTAGTACCCCGGGGAAGAGGG + Intergenic
1034857429 7:154565012-154565034 TAGTATCACTAAGGGCAAGAAGG + Intronic
1036205374 8:6801877-6801899 TAGAAGTTCTAGGGGTAAGAGGG + Intergenic
1046970286 8:120215586-120215608 TATTAATAGTAGGGGGAAGATGG + Intronic
1051044373 9:12855790-12855812 AAGTATTACTACAGGGAAGCAGG + Intergenic
1057400595 9:94719905-94719927 TTCTATTACTAGGGGGAAGAGGG + Intergenic
1057541029 9:95970284-95970306 TAAAAGTACTAGTGGGAAGAGGG - Intronic
1185510820 X:663960-663982 TGGGAGAACCACGGGGAAGATGG + Intergenic
1188705634 X:33326115-33326137 TAGTAATATTAGAGGGAAGAAGG + Intronic
1193819015 X:86139424-86139446 TAGTAGTAGAAAAGGGAAGAGGG - Intergenic
1194077264 X:89411730-89411752 TAGTATTACTAGGAGGAAAATGG - Intergenic
1200429909 Y:3067276-3067298 TAGTATTACTAGGAGGAAAATGG - Intergenic