ID: 925395517

View in Genome Browser
Species Human (GRCh38)
Location 2:3530585-3530607
Sequence TATTATTAGTAGGGGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 1, 2: 6, 3: 28, 4: 237}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925395517 Original CRISPR TATTATTAGTAGGGGGAAGA AGG Intergenic
902138481 1:14331755-14331777 TATTCCTGGTAGGGGGAAGCAGG - Intergenic
902764229 1:18604225-18604247 TACTATTAGCAAGGGGAAGTGGG - Intergenic
902973749 1:20073895-20073917 TATTATTAGCAGGTAGCAGAGGG - Intronic
906028678 1:42699019-42699041 TAATAGTAGTAAGGGGAAAATGG + Intronic
906652375 1:47521827-47521849 TATTATTTGCAGGGTGAGGAGGG + Intergenic
906872672 1:49501433-49501455 TGTTATTGGCAGGAGGAAGATGG - Intronic
908036115 1:60055654-60055676 GATTATGAGTATGAGGAAGAGGG - Intronic
909979324 1:82079789-82079811 TGTTAATATTAGGGGGAAGCTGG - Intergenic
910681621 1:89871446-89871468 TATTTTTAGGAGAGGGAAGGGGG - Intronic
910787419 1:91015474-91015496 GACTATTAGTAGAGAGAAGAAGG - Intronic
911425198 1:97700957-97700979 TATTATAAATAGGTGGTAGAGGG + Intronic
911923205 1:103793644-103793666 TATTACTTGGAGGGGGCAGAAGG - Intergenic
912007649 1:104923734-104923756 TTTTGTTTGTAGGGGGAACAGGG - Intergenic
913223531 1:116678745-116678767 TATTATAAGTGAGGGGAAAAGGG - Intergenic
914955935 1:152162494-152162516 GACTACTAGAAGGGGGAAGAAGG - Intergenic
915193847 1:154174426-154174448 TATTATTACTTTGGGGAAGCTGG - Intronic
915970593 1:160352433-160352455 TCTTATCAGTGGGGGAAAGAGGG - Intronic
916060612 1:161096130-161096152 TATTATTAGCAGGTGAAAGCAGG + Intergenic
920291834 1:204928985-204929007 TATTATTAAGCTGGGGAAGAGGG - Intronic
922026519 1:221754904-221754926 GAATTTTAGTAGGTGGAAGATGG + Intergenic
923521224 1:234736345-234736367 TACTATTTGTCGGGTGAAGATGG - Intergenic
924259576 1:242215580-242215602 AATTATTAACATGGGGAAGAAGG + Intronic
1065536558 10:26720865-26720887 TATTATTAGCATTGGGAATATGG + Intronic
1066633846 10:37481831-37481853 TATTATTAGTGGGGGGGGGGGGG - Intergenic
1067493129 10:46733309-46733331 TAATATTTTGAGGGGGAAGAAGG - Intergenic
1067601532 10:47607097-47607119 TAATATTTTGAGGGGGAAGAAGG + Intergenic
1067782030 10:49214776-49214798 TATTAATAAAAGGGGGAAGAGGG + Intergenic
1071397682 10:85239302-85239324 TGTCATTAATTGGGGGAAGAAGG - Intergenic
1071653059 10:87414675-87414697 TAATATTTTGAGGGGGAAGAAGG + Intergenic
1072007623 10:91268980-91269002 TCTTATTAGTGGGAGGAAAAAGG + Intronic
1072186630 10:93046225-93046247 CATTATTAGAAGGAGGAAAAAGG + Intronic
1072262681 10:93696077-93696099 TGTTATTAGTATGAGGAATAGGG - Intronic
1072500220 10:96007872-96007894 TATTCATAGTAGGGAGAAGCAGG - Intronic
1073248447 10:102107523-102107545 GACTTTTAATAGGGGGAAGAGGG + Intergenic
1073436150 10:103517347-103517369 TATTATTAGAAGTTTGAAGAAGG - Intronic
1074026360 10:109640082-109640104 TATTTTTATTAAGGGGAAGGAGG + Intergenic
1074641478 10:115388056-115388078 TTTTATGTGTAGTGGGAAGAAGG + Intronic
1074951871 10:118344591-118344613 TATTTTTAGTAGGGGGGAGCGGG - Intergenic
1076481393 10:130787255-130787277 TGTTATTATTAGGGGGCTGAAGG + Intergenic
1077832070 11:5884327-5884349 TATTCCTAGCAGGAGGAAGAAGG - Exonic
1078124225 11:8543605-8543627 TGTTGGTGGTAGGGGGAAGATGG + Intronic
1078403408 11:11047173-11047195 TATTATGAGAATGGAGAAGAGGG + Intergenic
1078682384 11:13489036-13489058 TTTTAAAAGTGGGGGGAAGAGGG - Intergenic
1080339541 11:31245061-31245083 TATTAATAGGTGGGGAAAGAGGG - Intronic
1081699379 11:45143323-45143345 TATTACTAGTAGGGGGTGGAGGG + Intronic
1085431543 11:76454918-76454940 CAGTATTAGGAGGGGGAGGAGGG - Intronic
1086239256 11:84669630-84669652 TGTGTTTAGTAGGGGGAAAAAGG - Intronic
1086801815 11:91184934-91184956 TATTATTGGAATGGGGAGGAGGG + Intergenic
1087787072 11:102367036-102367058 TATTAATACTGGGGGGAAAAAGG - Intronic
1087823181 11:102734173-102734195 TATTATTAGAAGGGGAAATCTGG - Intergenic
1088157998 11:106832448-106832470 TAGTATTAGGAGGTGTAAGATGG + Intronic
1088385901 11:109255412-109255434 TATTTTTAGTAGGGGAGAGATGG - Intergenic
1089044512 11:115488372-115488394 CATTATTGGGAGGGGGAGGAGGG - Intronic
1090855130 11:130604316-130604338 TTTTATTATAAGGGGGAAAAAGG - Intergenic
1094282792 12:28758705-28758727 TATTATTTTTGGGTGGAAGATGG - Intergenic
1096204506 12:49709456-49709478 TATTATGAGGGAGGGGAAGAAGG - Intronic
1097420820 12:59376991-59377013 TATTATTAGTATTGTCAAGATGG + Intergenic
1098216369 12:68224569-68224591 TATTATTGTTATGGGAAAGAAGG + Intronic
1099884078 12:88505374-88505396 TCTTATTACTATAGGGAAGAGGG + Intronic
1104579566 12:130000785-130000807 TATTATTAACAGGGTGAGGATGG - Intergenic
1106346287 13:28882232-28882254 TATTTTTAGTAGGGGCAGGTTGG + Intronic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1108409998 13:50135840-50135862 CATTATTGGTAGGGGCAGGAGGG + Intronic
1108518065 13:51221579-51221601 TCCTATTAGGAGGGTGAAGAGGG - Intergenic
1109198712 13:59407979-59408001 TATTATTAGTTGGTAGCAGAGGG - Intergenic
1110738733 13:78969243-78969265 TATTATTTGTAGAGGCAGGATGG - Intergenic
1111124710 13:83899067-83899089 TATTATTAACTGGGGGAAGGAGG + Intergenic
1111578202 13:90186898-90186920 TATGTTTAATAGGTGGAAGACGG - Intergenic
1114902122 14:27075282-27075304 TATTATTTGGAGGAGGAATAAGG - Intergenic
1115383093 14:32762124-32762146 TTTTAGTAGTAGGGGGAAAAAGG - Intronic
1115505315 14:34088166-34088188 CATAATTAGTAAGGAGAAGATGG + Intronic
1117607446 14:57444265-57444287 TATTATTATTAGGGGTTAAATGG - Intergenic
1118331948 14:64822048-64822070 TCTTCTTAGGAGGTGGAAGACGG + Intronic
1118628768 14:67683803-67683825 AAATATTAGTAGGGAGAGGAGGG - Intronic
1118645938 14:67840282-67840304 GATTATTAGAAGGAGGAAGAAGG - Intronic
1120432653 14:84438860-84438882 TATTTTTAGTAGGGACGAGATGG - Intergenic
1123204628 14:106700603-106700625 AATTATTAATGTGGGGAAGAGGG + Intergenic
1123209631 14:106747043-106747065 AATTATTAATGTGGGGAAGAGGG + Intergenic
1123697042 15:22885930-22885952 TATTTTTAGCAGGGTGAAAATGG - Intronic
1124180807 15:27471746-27471768 TTAAATTAGTAGGAGGAAGAAGG - Intronic
1124549872 15:30670049-30670071 TATTATTATTATTGGCAAGAGGG - Intronic
1125176999 15:36834949-36834971 CATTATTATTACGTGGAAGAAGG + Intergenic
1126685778 15:51247645-51247667 TATTTTTAGTAGGGAGGATAGGG + Intronic
1127347003 15:58111071-58111093 TATTATCAGATGGTGGAAGAAGG + Intronic
1128502711 15:68238950-68238972 TATTTATAGATGGGGGAAGAAGG + Intronic
1129615056 15:77092083-77092105 TATCATTAGTAAAGGCAAGAGGG - Intergenic
1130160337 15:81392552-81392574 TATTAATAATAGGGGAAAGTGGG + Intergenic
1130756098 15:86765233-86765255 TATTTTTTGCAAGGGGAAGAAGG - Intronic
1131134866 15:89926691-89926713 TACTTTTAGTTGGGGGAGGATGG - Intergenic
1131764861 15:95664634-95664656 TGTTATTAGCAAGGGGCAGAAGG - Intergenic
1132012656 15:98289622-98289644 TATTATTAGTGGTGGGATTAGGG + Intergenic
1132149302 15:99448030-99448052 TATTATTCGGTGGGGGGAGAGGG + Intergenic
1133488652 16:6245580-6245602 TATTATTATTAGTGTGTAGAGGG - Intronic
1139168644 16:64602909-64602931 TATAATTAGTGGGAGGAATAGGG - Intergenic
1140451718 16:75076133-75076155 TACTTTTAGTATGGAGAAGATGG - Intronic
1140542221 16:75767204-75767226 AATTATTATTAGGGCAAAGAAGG - Intergenic
1141769551 16:86081245-86081267 TATTATTATTAGGCAGAAGGTGG - Intergenic
1143153569 17:4822001-4822023 CATTATTGGAAGGGGGATGAGGG + Intronic
1145393769 17:22477811-22477833 TATTTTTAGTAGGGGGGGGGGGG + Intergenic
1147639619 17:41987787-41987809 TCTGATGGGTAGGGGGAAGAGGG - Intronic
1149858008 17:60101747-60101769 TATTCTGAGTTGGGGGAAAAGGG - Intergenic
1150197308 17:63313717-63313739 TATTATTATTAGGGGAAGCAAGG - Intronic
1151857675 17:76734292-76734314 TACCATTTTTAGGGGGAAGAGGG + Exonic
1153916265 18:9748333-9748355 TATTATTATTTGGGGGTAGGGGG - Intronic
1158733408 18:60052106-60052128 TGTTATGAATAGGCGGAAGAAGG + Intergenic
1159662872 18:71120805-71120827 GACTACTAGTAGGGGAAAGAAGG - Intergenic
1164466898 19:28494792-28494814 TGTAATTTGTAGGGGGAAAATGG - Intergenic
1166792996 19:45408934-45408956 TCTTCTTCGTAGGGGGCAGAGGG - Exonic
925395470 2:3530227-3530249 TAGTAGTACTACGGGGAAGAAGG + Intergenic
925395478 2:3530301-3530323 TATTAGTAGGATGGGGAAGAAGG + Intergenic
925395485 2:3530335-3530357 TATTATTAGTGGGGGGGAGAAGG + Intergenic
925395489 2:3530369-3530391 TAGTAGTAGTATGGGGAAGAAGG + Intergenic
925395494 2:3530406-3530428 TATTAGTAGGATGGGGAAGAAGG + Intergenic
925395500 2:3530443-3530465 TATTAGTAGGAGGGGGAAGAAGG + Intergenic
925395504 2:3530480-3530502 TAGTAGTAGTACGGGGAAGAAGG + Intergenic
925395512 2:3530554-3530576 TATTAGTAGGACGGGGAAGAAGG + Intergenic
925395517 2:3530585-3530607 TATTATTAGTAGGGGGAAGAAGG + Intergenic
925395525 2:3530651-3530673 TATTAGTAGTATGAGGAAGAAGG + Intergenic
925395530 2:3530688-3530710 TATTAGTAGGATGGGGAAGAAGG + Intergenic
925395536 2:3530757-3530779 TAGTAGTAGTATGAGGAAGAAGG + Intergenic
925395541 2:3530794-3530816 TATTAGTAGGATGGGGAAGAAGG + Intergenic
925395547 2:3530860-3530882 TATTAGTAGTAGTAGGAAGAAGG + Intergenic
925395553 2:3530923-3530945 TATTAGTAGTAGTAGGAAGAAGG + Intergenic
925395558 2:3530960-3530982 TATTAGTAGGATGGGGAAGAAGG + Intergenic
925395566 2:3531029-3531051 TAGTAGTAGTATGAGGAAGAAGG + Intergenic
925395571 2:3531066-3531088 TATTAGTAGGATGGGGAAGAAGG + Intergenic
925395577 2:3531103-3531125 TATTAGTAGGAGGGGGAAGAAGG + Intergenic
925395582 2:3531137-3531159 TAGTAGTAGGATGGGGAAGAAGG + Intergenic
927831504 2:26354835-26354857 AATTATTAGTAGGGGCAAGCGGG + Intronic
929660553 2:43780081-43780103 GACTGTTAGTGGGGGGAAGAGGG + Intronic
930044199 2:47154891-47154913 TTTAATTAGTAGTGGGAAGAAGG + Intronic
930336703 2:50057952-50057974 TATTATTAGTAGGGAAAGGTTGG + Intronic
931471966 2:62547445-62547467 TAATATTAGTAGTGGGAAGAGGG - Intergenic
932629696 2:73329112-73329134 TAATATTAGGTGGGGGAAAAGGG - Intergenic
934537165 2:95144358-95144380 TAATATCAGTAGGGAGAGGAGGG + Intronic
934962318 2:98687543-98687565 GAATATTAGGAGGGGGAAGGTGG - Intronic
935513393 2:104003695-104003717 TATTTTTAGTATGTGAAAGAAGG + Intergenic
935747318 2:106199814-106199836 TATTAATAATAGGGGAAAAATGG - Intergenic
936724527 2:115296838-115296860 TATTACTAATGGAGGGAAGAAGG - Intronic
937734069 2:125268349-125268371 TATGATTTGTAGATGGAAGAAGG + Intergenic
939486185 2:142814077-142814099 TATCATTAGGAGAGGGAACACGG + Intergenic
941028508 2:160485117-160485139 TATTTTAATTAGGGGGAAAAGGG + Intronic
941616988 2:167731865-167731887 AATTAATAGTTGGGGAAAGAGGG - Intergenic
942093563 2:172517220-172517242 AATTATTAACATGGGGAAGAGGG + Intergenic
943267792 2:185757947-185757969 GATTATTAGTTGGAGGAAGGAGG - Intronic
945046817 2:205789140-205789162 TTTTATTAGAAGGGGGCAGTAGG + Intronic
945271300 2:207943028-207943050 TAAGAAAAGTAGGGGGAAGAGGG + Intronic
945996991 2:216446132-216446154 TATTATTAAGATGGGAAAGAGGG - Intronic
946058789 2:216923691-216923713 CATTGCCAGTAGGGGGAAGAAGG - Intergenic
948670548 2:239565952-239565974 TATTAATAGAAGGCGGAAGAAGG + Intergenic
1170034331 20:11973999-11974021 TACTATTAGTACAAGGAAGAAGG + Intergenic
1170085424 20:12526202-12526224 TAAAATTGGTAGGGGGATGAGGG + Intergenic
1173871423 20:46344420-46344442 TAGCATGAGGAGGGGGAAGAGGG - Intergenic
1174136021 20:48380404-48380426 TTTCATTTGTAGGGGGAAAAAGG + Intergenic
1174785830 20:53431506-53431528 TATTATTACTAGGTGGCAGGTGG - Intronic
1174811857 20:53652578-53652600 TATAATTACTCTGGGGAAGAGGG + Intergenic
1175061216 20:56245210-56245232 TATTATTAGTAGAGGAGACAGGG + Intergenic
1177066568 21:16444158-16444180 TAAAATTAGTAGGTGAAAGATGG - Intergenic
1177429334 21:20970401-20970423 TATTATAATTAGGAGGAAAAAGG + Intergenic
1179037666 21:37773441-37773463 TCTTATGAGTAGGGAGCAGAGGG + Intronic
1182176525 22:28295352-28295374 TATTATTAATAGGGAAGAGAAGG - Intronic
1182229404 22:28825812-28825834 TATTAGGAGAAGGGGGAAGGTGG + Intergenic
1182510059 22:30813122-30813144 TTTTAGTAGTAGGGGGAAAATGG + Intronic
1182655670 22:31887924-31887946 CATGATTTATAGGGGGAAGAAGG + Intronic
1182787754 22:32921825-32921847 TATTATTATTAGGAGGAGGAGGG + Intronic
949427143 3:3929732-3929754 TATCATTTGTAGGGGGATGGGGG + Intronic
952947845 3:38492219-38492241 CATTATTTGTAAGGGAAAGAAGG + Exonic
953310440 3:41872650-41872672 TATTATTATTATTGGCAAGAGGG + Intronic
955442686 3:58974258-58974280 GACTACTAGTAGGGGGAAGGTGG - Intronic
956220899 3:66902057-66902079 CTTTATTAGCAGGGGGAAAATGG + Intergenic
958967068 3:100570825-100570847 TATTATGTGTTGGGGGTAGAGGG - Intronic
960463093 3:117960742-117960764 TATTATTATTAGTGGGAGGTGGG - Intergenic
962555934 3:136551437-136551459 TTTTTTTGGCAGGGGGAAGAGGG + Intronic
965113801 3:164461164-164461186 TATTATTAGGTGAGGCAAGAAGG + Intergenic
965238651 3:166161883-166161905 TATTATTAGGAGGGCTGAGAGGG + Intergenic
966967706 3:185011766-185011788 TAGGATCAGTAGGAGGAAGAAGG + Intronic
968955758 4:3718234-3718256 TAGAATTAGTAAGGGGAACACGG - Intergenic
972258014 4:37379777-37379799 TGTTCTTAGTAGGGGACAGATGG + Intronic
973718661 4:53702042-53702064 TAATATAAGTAGGGGTAAGCAGG + Intronic
974846190 4:67353317-67353339 TCCTATGAGTAGGGAGAAGATGG + Intergenic
974911507 4:68127234-68127256 AATTAGTAGTAGGAGAAAGACGG - Intronic
975713169 4:77180506-77180528 TATTATTAAAAGGCAGAAGAGGG - Intronic
976582773 4:86758685-86758707 AATTATTGGTGGGGAGAAGATGG + Exonic
976794154 4:88913415-88913437 AAGTAGTAGTAGAGGGAAGAGGG + Intronic
977837062 4:101657420-101657442 TATTATTTGGAAGGGGAAGGGGG + Intronic
979000912 4:115217806-115217828 TAAAATGAGTAGGAGGAAGAAGG + Intergenic
979097953 4:116574502-116574524 TTTTATTAGTAGGGTGAAAATGG - Intergenic
980511587 4:133797367-133797389 TATGATTACAAGGGGGAAAAGGG - Intergenic
981599558 4:146470120-146470142 TATTATTTGGTGGGAGAAGAAGG + Intronic
981896218 4:149803454-149803476 GCTTATTAGTAGGCTGAAGATGG - Intergenic
984131424 4:175879729-175879751 AATAATTAGTGGAGGGAAGAAGG - Intronic
984727935 4:183039426-183039448 TATTATCAGAACTGGGAAGAGGG + Intergenic
987688339 5:21233712-21233734 TATTAATAGTAGAGGAGAGAGGG + Intergenic
990154390 5:52858225-52858247 TATTCTATGTAGGGGGAAGTTGG - Intronic
993079215 5:83274916-83274938 TATTATAAGTATGTGGAAAATGG + Intronic
993434663 5:87877288-87877310 TATCTTTAGTAGGGCAAAGAAGG + Intergenic
994459096 5:100051010-100051032 TATTAATAGTAGGGCTAGGAGGG + Intergenic
995046424 5:107653613-107653635 TATTTTAACTAGAGGGAAGAGGG + Intronic
995245213 5:109927655-109927677 TAATAGTAATAGGGAGAAGAAGG - Intergenic
996758345 5:126959630-126959652 CATTAATAATAGGGGAAAGAAGG + Intronic
999120057 5:149202274-149202296 GATGATTAGGAGGTGGAAGAAGG + Intronic
999887374 5:155937700-155937722 TATAATTAAGTGGGGGAAGATGG + Intronic
1003681795 6:8264244-8264266 TATAATGAGTGGGGGAAAGAAGG + Intergenic
1004336666 6:14770399-14770421 TATTTTTAGCAGCGGGAGGAAGG - Intergenic
1004356949 6:14938062-14938084 TGTTAATAGTAGGGGAAACAGGG - Intergenic
1006834292 6:36987352-36987374 CATTATCAGGAGTGGGAAGAGGG - Intergenic
1010845756 6:80704801-80704823 TATTGTTGCTAGGGGGAAAAAGG - Intergenic
1012334390 6:98036614-98036636 AATTATTAGTAAGAAGAAGAAGG - Intergenic
1014544184 6:122713892-122713914 TAATATTTATAGGGGGAAAAGGG - Intronic
1015753231 6:136582100-136582122 CATTCTTATTAGGTGGAAGAGGG + Intronic
1016178832 6:141118239-141118261 TATTATTATTATGAGGAAGGGGG + Intergenic
1016843923 6:148552504-148552526 CATTTTTAATAGGGAGAAGAGGG + Intergenic
1017201658 6:151761121-151761143 AATAATTAGTAGTGGGAAAATGG - Intronic
1018741328 6:166731429-166731451 TATGATTAAAAGGGGGAAGGAGG + Intronic
1021671993 7:23044153-23044175 ATTTAATAGTAGGGGAAAGAGGG + Intergenic
1023190072 7:37570757-37570779 TAGCATTAGTAGTTGGAAGAAGG + Intergenic
1027199622 7:76055243-76055265 TAGTATGAGGATGGGGAAGAGGG + Intronic
1028270512 7:88782701-88782723 TAATATTAGCAGGGAGAACAAGG + Intronic
1028909418 7:96191041-96191063 TATTATTATTAGGGTGAAGAAGG - Intronic
1029012304 7:97274493-97274515 TATTTTTAGTAGAGGGCAGTGGG + Intergenic
1031518340 7:122729742-122729764 TATCTGTAGAAGGGGGAAGATGG - Intronic
1031552475 7:123132224-123132246 TTTTATTAGTAGTGAGAAGATGG - Intronic
1031563910 7:123270874-123270896 TATGATTACTTGGGGGCAGATGG + Intergenic
1032903384 7:136336639-136336661 TATTAGTAGCTGTGGGAAGAAGG + Intergenic
1037325843 8:17689255-17689277 AATTATTTGTAGGGGGAGGGAGG + Intronic
1037785475 8:21900443-21900465 TCTTATTTGTAGGTGGAAGCAGG + Intergenic
1039341637 8:36657173-36657195 TATTAATAATAGGAAGAAGAAGG + Intergenic
1040577643 8:48667689-48667711 TGTGATTAGTAAGGGGAAGGGGG - Intergenic
1041070453 8:54123300-54123322 AATCATTAGTAGGGAGAAGGAGG + Intergenic
1043338534 8:79207805-79207827 TATTAATAGAAGGGGAAAGTAGG - Intergenic
1043353056 8:79384208-79384230 GCTTATTATTTGGGGGAAGATGG - Intergenic
1043718703 8:83516284-83516306 TATTTATAGTAGAGAGAAGAAGG - Intergenic
1044803572 8:95981681-95981703 AACTATAAGTAGGGGGAAAAAGG - Intergenic
1046921561 8:119734815-119734837 TTAAATTAGTTGGGGGAAGAGGG + Intronic
1046970286 8:120215586-120215608 TATTAATAGTAGGGGGAAGATGG + Intronic
1047505444 8:125475999-125476021 GATTACTAGTAGGGGGAGGATGG - Intergenic
1049131153 8:140843776-140843798 TATTAATAGTAGGGGGACCTGGG - Intronic
1049505766 8:142996651-142996673 TAGTACTGGGAGGGGGAAGAGGG - Intergenic
1052856492 9:33410140-33410162 TATTATTATTTGCTGGAAGAAGG - Intergenic
1052942924 9:34144706-34144728 TTTGATTAGAAGGGTGAAGAAGG + Intergenic
1053446488 9:38157148-38157170 TTTTATAAGAAGGGGGCAGAAGG - Intergenic
1056345510 9:85690488-85690510 TATTTTCAGTGGTGGGAAGAGGG + Intronic
1056345532 9:85690644-85690666 TATTTTCAGTGGTGGGAAGAGGG + Intronic
1056345546 9:85690748-85690770 TATTTTCAGTGGTGGGAAGAGGG + Intronic
1056345561 9:85690852-85690874 TATTTTCAGTGGTGGGAAGAGGG + Intronic
1056496241 9:87158083-87158105 TATTGTTAGTAGGAAGAATAGGG - Exonic
1056546798 9:87620344-87620366 TAGTCTGAGGAGGGGGAAGAAGG - Intronic
1057015446 9:91647093-91647115 TATAATTAGTAGGAGGGATAGGG - Intronic
1057357034 9:94340522-94340544 AATAATTACTAGGGAGAAGAGGG - Intergenic
1057400595 9:94719905-94719927 TTCTATTACTAGGGGGAAGAGGG + Intergenic
1057650718 9:96917105-96917127 AATAATTACTAGGGAGAAGAGGG + Intronic
1059952501 9:119481071-119481093 TGTTATTAGTAAGAAGAAGAAGG - Intergenic
1060015241 9:120081038-120081060 TGTTCTGTGTAGGGGGAAGAAGG + Intergenic
1185735645 X:2493632-2493654 TATTATTATTAGGCTGAAAAAGG + Intronic
1185927951 X:4168099-4168121 TATTATTAGATGGGGGCAGTGGG + Intergenic
1186362200 X:8853825-8853847 TATGATGAGTAGCTGGAAGAGGG - Intergenic
1186482980 X:9910325-9910347 TATTAATAATAGGGGGAAGTGGG + Intronic
1186923356 X:14305853-14305875 TGTTATTAGTAGGGGGAAAAGGG + Intergenic
1187065441 X:15832518-15832540 TATTCTGAGTTGGGGGAAAAGGG - Intronic
1188705634 X:33326115-33326137 TAGTAATATTAGAGGGAAGAAGG + Intronic
1192163210 X:68804106-68804128 AAGTATAAGAAGGGGGAAGATGG - Intergenic
1192431833 X:71118008-71118030 TATTATTATTTCTGGGAAGAAGG + Intergenic
1193666190 X:84320782-84320804 TATTATTAGTAGGTACCAGATGG - Exonic
1194077264 X:89411730-89411752 TAGTATTACTAGGAGGAAAATGG - Intergenic
1194630916 X:96282407-96282429 TAGTATTTGTAGGGAGAAAAAGG + Intergenic
1195684530 X:107573543-107573565 CATTATTAGGAAGGGGTAGAAGG - Intronic
1195894412 X:109731501-109731523 TATTTTTGGTAGGGGTGAGATGG - Intronic
1197291751 X:124666855-124666877 TCTTATTAGGAAGGGGTAGATGG - Intronic
1198574401 X:137994169-137994191 GGTTATAAGCAGGGGGAAGAGGG + Intergenic
1199645156 X:149902166-149902188 TTTTTTTTGTGGGGGGAAGAGGG - Intergenic
1200429909 Y:3067276-3067298 TAGTATTACTAGGAGGAAAATGG - Intergenic
1202348461 Y:23960353-23960375 TATCATTAGTGGGTGGGAGAAGG + Intergenic
1202522313 Y:25709751-25709773 TATCATTAGTGGGTGGGAGAAGG - Intergenic