ID: 925396367

View in Genome Browser
Species Human (GRCh38)
Location 2:3536416-3536438
Sequence TGGTCCACGAGGGGACTCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 61}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925396367_925396379 8 Left 925396367 2:3536416-3536438 CCTCCGAGTCCCCTCGTGGACCA 0: 1
1: 0
2: 0
3: 4
4: 61
Right 925396379 2:3536447-3536469 CCTTGGGCTCTGTCCTGGGCTGG 0: 1
1: 0
2: 6
3: 30
4: 407
925396367_925396376 3 Left 925396367 2:3536416-3536438 CCTCCGAGTCCCCTCGTGGACCA 0: 1
1: 0
2: 0
3: 4
4: 61
Right 925396376 2:3536442-3536464 TCTGACCTTGGGCTCTGTCCTGG 0: 1
1: 0
2: 0
3: 22
4: 234
925396367_925396377 4 Left 925396367 2:3536416-3536438 CCTCCGAGTCCCCTCGTGGACCA 0: 1
1: 0
2: 0
3: 4
4: 61
Right 925396377 2:3536443-3536465 CTGACCTTGGGCTCTGTCCTGGG 0: 2
1: 6
2: 16
3: 43
4: 385
925396367_925396374 -8 Left 925396367 2:3536416-3536438 CCTCCGAGTCCCCTCGTGGACCA 0: 1
1: 0
2: 0
3: 4
4: 61
Right 925396374 2:3536431-3536453 GTGGACCAGGCTCTGACCTTGGG 0: 1
1: 0
2: 1
3: 15
4: 186
925396367_925396373 -9 Left 925396367 2:3536416-3536438 CCTCCGAGTCCCCTCGTGGACCA 0: 1
1: 0
2: 0
3: 4
4: 61
Right 925396373 2:3536430-3536452 CGTGGACCAGGCTCTGACCTTGG 0: 1
1: 0
2: 0
3: 18
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925396367 Original CRISPR TGGTCCACGAGGGGACTCGG AGG (reversed) Intronic
902187095 1:14733656-14733678 TGTTCAGCGTGGGGACTCGGGGG + Intronic
922373018 1:224929976-224929998 GGTTCCGCGCGGGGACTCGGAGG - Intronic
1063375465 10:5551820-5551842 TGGTCAACGAGGGGAGGCTGTGG - Intergenic
1063375470 10:5551840-5551862 TGGTCAACGAGGGGAGGCTGTGG - Intergenic
1070325972 10:75389358-75389380 GGGTCCAAGAGGGCACTGGGAGG - Intergenic
1070351545 10:75597452-75597474 TGAGCCAGGAGGGGACTGGGAGG + Intronic
1074532431 10:114306311-114306333 AGATCCAGGAGGGGACGCGGGGG + Intronic
1075408468 10:122210428-122210450 TGGCCCACGGAGCGACTCGGTGG + Exonic
1076704737 10:132294938-132294960 TGGTCCACAAGGGAACACTGAGG + Intronic
1083227735 11:61295208-61295230 AGGGCCGCGAGGGGACGCGGCGG + Exonic
1086020586 11:82224664-82224686 TGGTCCACTTGGTGACTTGGTGG + Intergenic
1095329205 12:40937329-40937351 TGGTCCAAGAGGGGAAAAGGTGG + Intronic
1097745013 12:63291965-63291987 TGGTAAAGGAGGGGACTTGGGGG - Intergenic
1103320671 12:120091076-120091098 TGGGCCATGAGGGGAGGCGGCGG - Intronic
1120167783 14:81220035-81220057 TGGATCACGATGGGTCTCGGGGG + Intronic
1122294135 14:100695499-100695521 TGGTCCCCGAGGGGCCTCCGGGG + Intergenic
1123579609 15:21704243-21704265 GGGTCCACGTGGGGACAGGGGGG - Intergenic
1123616236 15:22146754-22146776 GGGTCCACGTGGGGACAGGGGGG - Intergenic
1123705646 15:22949214-22949236 TGGTCCCCGGGGGGAATCCGCGG - Intronic
1125485522 15:40108563-40108585 TGCTCCAAGAGGGAACTTGGGGG - Intronic
1129144162 15:73632832-73632854 GGGTCGGCGAGGGGACACGGAGG - Intronic
1130887224 15:88103786-88103808 TGGTTCAGGTGGGGACTCTGTGG - Intronic
1131276766 15:90988715-90988737 TGGTCTACTAGGGGGCTTGGGGG - Intronic
1132348471 15:101122499-101122521 TGGTCCACCAGGGTCCTTGGTGG - Intergenic
1202988479 15_KI270727v1_random:438488-438510 GGGTCCACGTGGGGACAGGGGGG - Intergenic
1141144035 16:81516346-81516368 GGGTGGACGAGGGGACCCGGGGG - Intronic
1151426036 17:74031758-74031780 TGGCCCAGGAGGGGACTCTGAGG - Intergenic
1152630696 17:81409544-81409566 TTGTCCACGCGGGGTCGCGGGGG + Intronic
1160208438 18:76857045-76857067 TGGTCCACGTGGGAACTAGGGGG - Intronic
1160774026 19:846594-846616 TGGTCCTAGAGGGGAGTGGGGGG - Intronic
925396367 2:3536416-3536438 TGGTCCACGAGGGGACTCGGAGG - Intronic
927192187 2:20524416-20524438 TGGTCCGCGAGGAGTCTCAGGGG + Intergenic
928266941 2:29820185-29820207 TGGTCCAAGAGAGGACAAGGAGG - Intronic
935045240 2:99476225-99476247 TGGTCCAAGATGAGACTGGGAGG + Intronic
937015862 2:118604826-118604848 TGCTCCCCGAGGGTACTCTGTGG - Intergenic
937926796 2:127174182-127174204 TGGAGCCCGAGGGGACTTGGAGG - Intergenic
944400547 2:199320733-199320755 TGGTCCAAGAGGGTCCTCGAGGG - Intronic
946775900 2:223140876-223140898 TGGTCCAAGTGGGGCTTCGGGGG - Intronic
949016976 2:241719073-241719095 AGGTCCTCAAGGGGCCTCGGTGG - Intronic
1175862940 20:62159815-62159837 GGATCCACGTGGGGACTCTGTGG + Intronic
1176212695 20:63932761-63932783 TGGTCCACGTGTGGATTCTGTGG - Exonic
1176212711 20:63932814-63932836 TGGTCCACGTGTGGATTCCGTGG - Exonic
1182332497 22:29561094-29561116 TGGCCCACCAGGGGCCTTGGTGG + Intronic
1183090656 22:35519706-35519728 GGGTCCACAAGGGGTCTGGGCGG + Intergenic
1184598360 22:45527772-45527794 GGGTCCACGAGAGGCCTCAGGGG - Intronic
1185086879 22:48745721-48745743 TGGTCCACGTGGGTACTTGGAGG + Intronic
1185149355 22:49155177-49155199 CTGTCCCCGAGGGGACTTGGGGG - Intergenic
950158598 3:10742457-10742479 TGGGCCACAGGGGGACTGGGGGG + Intergenic
954745267 3:52784224-52784246 TGGGGCACGAGGGGGCTCTGGGG - Intronic
960030716 3:113052015-113052037 TGTTCCACGAGAGGCCTTGGAGG - Intergenic
969711358 4:8846134-8846156 TGCTCCACGCGGTCACTCGGGGG + Intronic
978379950 4:108116545-108116567 TGGTTCAGAAGTGGACTCGGAGG - Intronic
989278238 5:39612770-39612792 TTGTCCACGTGGGGCCTGGGAGG - Intergenic
998403288 5:141859171-141859193 GGGTCCAGGAGGGGTCTGGGAGG + Intronic
1002355664 5:178627061-178627083 TGGTGCTAGAGGCGACTCGGGGG - Exonic
1005456192 6:26021827-26021849 TGATCTACGAGGAGACTCGCGGG + Exonic
1023842051 7:44103628-44103650 TTGTCCACGTTGGGACCCGGAGG + Intergenic
1025191436 7:56898675-56898697 TGTTCCTCCAGGGGCCTCGGTGG + Intergenic
1025680512 7:63678259-63678281 TGTTCCTCCAGGGGCCTCGGTGG - Intergenic
1032069319 7:128794127-128794149 TGGTCCAGGAAGGGCCTGGGAGG + Intronic
1036647766 8:10622854-10622876 TGGTCCACTGGGGGTCTTGGGGG + Exonic
1043372367 8:79610396-79610418 TGGTCCACCTGGGGACATGGGGG - Intergenic
1058820187 9:108722557-108722579 TGGTCCCCTAGAGGCCTCGGAGG + Intergenic
1060163414 9:121388022-121388044 TGGTCCAAAAGGGGACTGGCCGG - Intergenic
1061359854 9:130134206-130134228 TGGTCTATGAGGGAACTGGGTGG - Intronic
1196840299 X:119853152-119853174 TGGGCCGCGAGGGGATTGGGTGG - Intergenic