ID: 925396556

View in Genome Browser
Species Human (GRCh38)
Location 2:3537460-3537482
Sequence TGGCTCTAACCCCAGCGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 930
Summary {0: 1, 1: 0, 2: 0, 3: 37, 4: 892}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925396556 Original CRISPR TGGCTCTAACCCCAGCGTGT TGG Intronic
900600856 1:3502111-3502133 TGGCTCTAGCCCCCGGGGGTGGG + Intronic
900961038 1:5920319-5920341 TGCCTATAATCCCAGCATGTTGG - Intronic
901255461 1:7822143-7822165 TGCCTATAACCCCAGCATTTTGG + Intronic
901520076 1:9776955-9776977 TGCCTGTAATCCCAGCGTGTTGG + Intronic
901555774 1:10030192-10030214 TGCCTGTAACCCCAGCATTTTGG + Intergenic
901669665 1:10848746-10848768 TGCCTGTAATCCCAGCGTTTCGG + Intergenic
901692488 1:10982485-10982507 TGCCTGTAACCCCAGCATTTTGG + Intergenic
901985386 1:13071514-13071536 TGGCTCTAATCCCAGCATTTTGG - Intronic
901996424 1:13155256-13155278 TGGCTCTAATCCCAGCATTTTGG + Intergenic
902473027 1:16662696-16662718 TGCCTGTAACCCCAGCGCTTTGG + Intergenic
902485776 1:16744744-16744766 TGCCTGTAACCCCAGCGCTTTGG - Intronic
902901108 1:19516725-19516747 TGGCTGTAATCCCAGCATGTTGG - Intergenic
903512255 1:23885058-23885080 TGCCTGTAACCCCAGCATTTTGG - Intronic
903534064 1:24054924-24054946 TGCCTGTAATCCCAGCGTTTTGG - Intergenic
903725234 1:25437657-25437679 TGGCTGTAACCCCAGCACTTTGG + Intronic
903860826 1:26363505-26363527 TGGCTGTAATCCCAGCATTTTGG + Intronic
903896217 1:26606943-26606965 TGCCTGTAACCCCAGTGTTTTGG - Intergenic
904066065 1:27752032-27752054 TGCCTATAATCCCAGCATGTTGG - Intronic
904175158 1:28622626-28622648 TGTCTGTAATCCCAGCATGTTGG + Intronic
904179854 1:28658537-28658559 TGCCTATAACCCCAGCATCTTGG + Intergenic
904474184 1:30754269-30754291 TGCCTGTAATCCCAGCGCGTTGG + Intronic
904504316 1:30938163-30938185 TGCCTGTAACCCCAGCATGTTGG - Intronic
904609892 1:31720013-31720035 TGCCTGTAATCCCAGCATGTTGG - Intergenic
904630006 1:31833937-31833959 TGCCTGTAATCCCAGCGTTTTGG + Intergenic
904779817 1:32937449-32937471 TGCCTATAACCCCAGCGCTTTGG + Intronic
905157106 1:35994207-35994229 TGGCTATAATCCCAGTGTTTTGG - Intronic
905597952 1:39224922-39224944 TGTCTGTAATCCCAGCGTTTTGG + Intronic
905779439 1:40694990-40695012 CGCCTCTAATCCCAGCGTTTTGG + Intronic
905806061 1:40878383-40878405 TGTCTCTAATCCCAGGGTTTTGG - Intergenic
906119439 1:43378914-43378936 TGCCTATAATCCCAGCATGTTGG + Intergenic
906337869 1:44950160-44950182 TGCCTGTAACCCCAGCATTTTGG + Intronic
906485300 1:46229955-46229977 TGTCTGTAATCCCAGCATGTTGG - Intergenic
906959367 1:50407352-50407374 TGTCTCTAATCCCAGCTTCTTGG + Intergenic
907228649 1:52973860-52973882 TGCCTGTAACCCCAGCATTTTGG - Intronic
907302128 1:53494506-53494528 TGCCTGTAATCCCAGCATGTTGG + Intergenic
907445647 1:54506170-54506192 TGCCTGTAATCCCAGCGTTTTGG - Intergenic
907945308 1:59130684-59130706 AGGCTCTAATCCCAGAGTGCTGG - Intergenic
909224844 1:73006151-73006173 TGGCTCTAATCCCAGCATTTTGG - Intergenic
909642069 1:77880276-77880298 TGCCTGTAATCCCAGCATGTTGG + Intergenic
909916277 1:81323511-81323533 TGCCTATAACCCCAGCATTTTGG - Intronic
910239351 1:85069644-85069666 TGGCTGTAATCCCAGCATTTTGG - Intronic
910490780 1:87767324-87767346 TGCCTCTAATCCCAGCATTTTGG + Intergenic
910580849 1:88822956-88822978 TGCCTGTAACCCCAGCATTTGGG + Intronic
910719138 1:90266200-90266222 TGCCTGTAACCCCAGCTAGTTGG + Intergenic
911652584 1:100406661-100406683 TGCCTGTAACCCCAGCATTTTGG + Intronic
913508285 1:119539481-119539503 TGCCTCTAATCCCAGCATTTTGG + Intergenic
913707394 1:121440370-121440392 TGCCTGTAATCCCAGCGTTTTGG + Intergenic
914682433 1:149948262-149948284 TGCCTGTAATCCCAGCATGTTGG - Intronic
914707602 1:150183579-150183601 TGTCTGTAATCCCAGCATGTTGG + Intergenic
914812916 1:151042550-151042572 TGCCTCTAATCCCAGCATTTTGG + Intronic
915106075 1:153535882-153535904 TGGCTGGACCCCCAGCGTGAGGG + Exonic
915164817 1:153942557-153942579 TGCCTCGTACACCAGCGTGTTGG + Exonic
915321551 1:155059191-155059213 TGACTGTAATCCCAGCGAGTAGG - Intronic
915376791 1:155403217-155403239 TGCCTCTAATCCCAGCCTTTTGG + Intronic
917089314 1:171336860-171336882 TGCCTATAACCCCAGCACGTTGG - Intronic
917894986 1:179478837-179478859 TGCCTGTAATCCCAGCATGTTGG + Intronic
918144587 1:181744354-181744376 TGCCTGTAACCCCAACGAGTCGG + Intronic
918218917 1:182417707-182417729 TGCCTGTAAACCCAGCATGTTGG - Intergenic
918742633 1:188154386-188154408 TGCCTCTAATCCCAGCATTTTGG - Intergenic
918996624 1:191769569-191769591 TGTCTGTAATCCCAGCATGTTGG - Intergenic
919056896 1:192582182-192582204 TGCCTGTAATCCCAGCATGTTGG - Intergenic
919099951 1:193083015-193083037 TGGCTGTAATCCCAGCACGTTGG - Intronic
919282415 1:195508320-195508342 AAGCTCTAACCCCAGTGTGTTGG + Intergenic
919767951 1:201139432-201139454 TGGCCCTAGCCGCAGCGTGCAGG - Intronic
919957039 1:202427908-202427930 TGCCTGTAATCCCAGCGTTTTGG - Intronic
920011029 1:202867789-202867811 TGCCTCTAATCCCAGCATTTTGG + Intergenic
920656269 1:207877622-207877644 TGGCTATAATCCCAGCATTTTGG - Intergenic
920900243 1:210102936-210102958 TGCCTGTAATCCCAGCGTTTTGG - Intronic
921074261 1:211687031-211687053 TGCCTCTAACCCCAGCACTTTGG - Intergenic
921371260 1:214425055-214425077 TGGCTGTAATCCCAGCGCTTTGG - Intronic
921377267 1:214487363-214487385 TGCCTGTAATCCCAGCATGTTGG + Intronic
921478328 1:215635812-215635834 TGCCTGTAATCCCAGCATGTTGG - Intronic
921934189 1:220780702-220780724 TGCCTGTAATCCCAGCATGTTGG - Intronic
922165662 1:223113718-223113740 TGCCTGTAATCCCAGCATGTTGG - Intronic
922515406 1:226204519-226204541 TGCCTGTAATCCCAGCATGTTGG + Intergenic
924228088 1:241939328-241939350 TGCCTGTAATCCCAGCGTTTTGG + Intergenic
924529364 1:244880351-244880373 TGGCTGTAATCCCAGCGCTTTGG - Intergenic
924640510 1:245828961-245828983 TGCCTCTAACCCCAGCACTTTGG - Intronic
1063324136 10:5080361-5080383 TGTCTGTAATCCCAGCATGTTGG + Intronic
1063344792 10:5300893-5300915 TGCCTCTAATCCCAGCATTTTGG - Intergenic
1063823321 10:9863468-9863490 TGCCTGTAATCCCAGCTTGTTGG + Intergenic
1063864654 10:10351063-10351085 TTGCTCTAACCCCAGCATTTTGG + Intergenic
1063967306 10:11356528-11356550 TGCCTGTAATCCCAGCATGTTGG + Intergenic
1064049750 10:12049764-12049786 TGCCTGTAATCCCAGCATGTTGG + Intergenic
1064379661 10:14829888-14829910 TGGCTGTAATCCCAGCGCTTTGG - Intronic
1064404197 10:15046591-15046613 TGGCTGTAATCCCAGCTAGTTGG - Intronic
1064427113 10:15239420-15239442 TGCCTCTAATCCCAGCTTCTTGG - Intronic
1064774030 10:18755535-18755557 TGCCTCTAACCCCAGCACTTTGG - Intergenic
1064985335 10:21204295-21204317 GAGCTCTAACCCCAGTGTGACGG + Intergenic
1065059388 10:21882987-21883009 CGGCTCTAATCCCAGCATTTTGG + Intronic
1065363335 10:24910033-24910055 TGCCTGTAACCCCAGCTTCTCGG + Intronic
1065799505 10:29338881-29338903 TGCCTGTAACCCCAGAGTTTTGG + Intergenic
1065829843 10:29604827-29604849 GGGCTATAACCCCAGCATTTTGG - Intronic
1065843547 10:29726180-29726202 TGCCTGTAATCCCAGCATGTTGG - Intronic
1065906692 10:30260726-30260748 TGTCTGTAACCCCAGCATTTTGG + Intergenic
1066069073 10:31786663-31786685 TGGCTGTAATCCCAGCATTTTGG - Intergenic
1066151149 10:32620181-32620203 TGCCTATAATCCCAGCATGTTGG - Intronic
1066470790 10:35695826-35695848 TGTCTCTAATCCCAGCTAGTCGG - Intergenic
1066674155 10:37871139-37871161 TGCCTATAATCCCAGCATGTTGG - Intergenic
1067042382 10:42961937-42961959 AGGCTCTCACCCCAGCTGGTAGG + Intergenic
1067118308 10:43452619-43452641 TGCCTGTAACCCCAGCATTTTGG - Intronic
1067364653 10:45614284-45614306 TGGCTGTAATCCCAGCGCTTTGG + Intergenic
1067532367 10:47083490-47083512 AGCCTCTAACCCCAGCTTTTGGG - Intergenic
1067826543 10:49578219-49578241 TGCCTGTAACCCCAGCGTTTGGG + Intergenic
1067859831 10:49834626-49834648 TGGCTGTAACCCCAGCACTTTGG + Intronic
1068087745 10:52395667-52395689 TGCCTGTAATCCCAGCGTTTTGG - Intergenic
1068258372 10:54543388-54543410 GGGCTCTGACCCCAGTGTCTAGG - Intronic
1068727565 10:60320331-60320353 TGCCTCTAATCCCAGCATTTTGG + Intronic
1069314405 10:67079587-67079609 TGCCTGTAATCCCAGCATGTTGG + Intronic
1069453150 10:68533428-68533450 TGCCTGTAATCCCAGCATGTTGG - Intergenic
1069512070 10:69050060-69050082 TGCCTGTAACCCCAGCATTTCGG + Intergenic
1069551918 10:69369996-69370018 TGCCTGTAACCCCAGCATTTTGG - Intronic
1069978006 10:72231275-72231297 TGCCTCTAATCCCAGCACGTTGG + Intronic
1070030350 10:72670707-72670729 TGCCTGTAACCCCAGCGCTTTGG - Intergenic
1070172444 10:73942888-73942910 TGGCTCTAATCCCAGCACTTTGG + Intergenic
1070239119 10:74660390-74660412 TGTCTGTAACCCCAGCATTTTGG - Intronic
1070508483 10:77138382-77138404 TGCCTATAATCCCAGCATGTTGG - Intronic
1071556707 10:86609092-86609114 TGCCTATAACCCCAGCACGTTGG - Intergenic
1072114636 10:92358529-92358551 TGCCTCTAATCCCAGCATTTTGG - Intergenic
1072124864 10:92436756-92436778 TGCCTGTAATCCCAGCGTTTTGG + Intergenic
1072506828 10:96076199-96076221 TGCCTGTAATCCCAGCGTTTTGG + Intergenic
1072515650 10:96180138-96180160 TGCCTGTAACCCCAGCATTTTGG - Intronic
1073013528 10:100380530-100380552 TGCCTCTAATCCCAGCATTTTGG + Intergenic
1073428167 10:103469012-103469034 TGCCTGTAATCCCAGCATGTTGG - Intergenic
1073538214 10:104296903-104296925 TGGCTGTAACCCCAGCTACTGGG - Intronic
1073551756 10:104408836-104408858 TGCCTATAATCCCAGCGCGTTGG + Intronic
1074078531 10:110150563-110150585 TGGCTCTAAAGCCAGCATGCAGG - Intergenic
1074785129 10:116832424-116832446 TGCCTGTAATCCCAGCATGTTGG - Intergenic
1074914174 10:117939712-117939734 TGCCTGTAATCCCAGCATGTTGG + Intergenic
1075005443 10:118826968-118826990 TGGCTCTCACCCCTGCCTGCAGG + Intergenic
1075361776 10:121844137-121844159 TGCCTCTAACCCCAGTGCTTTGG + Intronic
1075405677 10:122194182-122194204 TGCCTCTAATCCCAGCGCTTTGG - Intronic
1077636388 11:3844204-3844226 TGGCTGTAACCCCAGCTACTCGG + Intergenic
1077648024 11:3943639-3943661 CGCCTGTAACCCCAGCATGTTGG + Intronic
1078298071 11:10095181-10095203 TGTCTCTAATCCCAGCTTTTTGG - Intronic
1079156378 11:17951845-17951867 TGGCTCTGACCCCTGAGTGGCGG - Intronic
1079777767 11:24555713-24555735 TGCCTGTAATCCCAGCATGTTGG + Intronic
1079831422 11:25274223-25274245 TGCCTGTAACCCCAGCATTTTGG - Intergenic
1080321981 11:31020695-31020717 TGCCTGTAAACCCAGCATGTTGG - Intronic
1080461308 11:32457391-32457413 TGGCTGTAATCCCAGCTTCTAGG - Intergenic
1080468017 11:32516571-32516593 TGCCTGTAATCCCAGCATGTTGG + Intergenic
1080636188 11:34125700-34125722 TGGCTCTAATCCCAGCGCTTTGG + Intronic
1081123982 11:39300265-39300287 TGCCTGTAATCCCAGCATGTTGG + Intergenic
1081127111 11:39334907-39334929 TGCCTGTAATCCCAGCATGTTGG - Intergenic
1081182244 11:39997879-39997901 TGGCTGTAATCCCAGCGCTTTGG + Intergenic
1081888383 11:46519282-46519304 TGCCTGTAATCCCAGCATGTTGG - Intronic
1081941973 11:46950885-46950907 TGGCTGTAATCCCAGCATTTTGG - Intronic
1082804890 11:57441683-57441705 TGCCTGTAATCCCAGCATGTTGG + Intergenic
1083804285 11:65064758-65064780 TGCCTGTAATCCCAGCATGTTGG + Intergenic
1084035546 11:66507801-66507823 TGCCTCTAATCCCAGCTTTTTGG - Intronic
1084159025 11:67334680-67334702 TGGCTGTAATCCCAGCGATTTGG + Intronic
1084160114 11:67343748-67343770 TGCCTATAATCCCAGCATGTTGG - Intronic
1084439048 11:69160446-69160468 TGCCTGTAACCCCAGCATTTCGG - Intergenic
1084570570 11:69957161-69957183 TGGCTCCCACCCCAGCCTGCAGG + Intergenic
1085091793 11:73722593-73722615 TGCCTATAGTCCCAGCGTGTTGG - Intronic
1085293294 11:75415545-75415567 TGCCTATAATCCCAGCATGTTGG + Intronic
1085473862 11:76776159-76776181 TGCCTCTAATCCCAGCATTTTGG - Intergenic
1085514935 11:77106397-77106419 TGGCTCTATCCCCAGAGTGCAGG + Intronic
1085632934 11:78134396-78134418 TGCCTGTAATCCCAGCGTTTTGG - Intronic
1085657557 11:78330911-78330933 TGGCTGTAACCCCAGCACTTTGG + Intronic
1086336379 11:85805228-85805250 TGCCTGTAACCCCAGTGTTTTGG + Intronic
1086778800 11:90876464-90876486 TGCCTGTAATCCCAGCGTTTTGG + Intergenic
1087278372 11:96183217-96183239 TGCCTGTAATCCCAGCGCGTTGG - Intronic
1087565538 11:99852435-99852457 TGCCTCTAATCCCAGCATTTTGG - Intronic
1087754863 11:102044541-102044563 TGCCTGTAATCCCAGCATGTTGG - Intergenic
1089130290 11:116207089-116207111 TGGCTCTATCCTCAGCCTCTGGG + Intergenic
1089238303 11:117051787-117051809 TGCCTGTAATCCCAGCGTTTTGG - Intronic
1089312572 11:117569526-117569548 TGCCTCTAACCCCAGCACTTTGG - Intronic
1089482425 11:118817415-118817437 TGGCTGTAATCCCAGCATTTTGG + Intergenic
1090301536 11:125644880-125644902 TGGCTGTAATCCCAGCTTCTCGG + Intronic
1091146805 11:133287370-133287392 TGGCTATAATCCCAGCACGTCGG - Intronic
1091173407 11:133538452-133538474 TGTCTCTAATCCCAGCGCTTTGG - Intergenic
1091380342 12:54089-54111 TGCCTGTAATCCCAGCATGTTGG + Intergenic
1091559165 12:1597640-1597662 TGCCTCTAATCCCAGCATTTTGG + Intronic
1092364815 12:7868745-7868767 TGGCTGTAATCCCAGCATTTTGG + Intronic
1092693914 12:11147446-11147468 TGTCTGTAATCCCAGCATGTTGG - Intronic
1093025441 12:14241222-14241244 TGGCTGTAAACCCAGCATGTTGG + Intergenic
1093856823 12:24114449-24114471 TGCCTGTAATCCCAGCTTGTTGG + Intergenic
1094593037 12:31839063-31839085 TGTCTGTAATCCCAGCATGTTGG + Intergenic
1094660834 12:32469084-32469106 TGCCTATAACCCCAGCATTTTGG - Intronic
1094718826 12:33040686-33040708 TGCCTGTAATCCCAGCCTGTTGG - Intergenic
1095149206 12:38771196-38771218 TGACTGTAACCCCAGCGCTTTGG + Intronic
1095443533 12:42261392-42261414 TGCCTGTAACCCCAGCATTTCGG - Intronic
1095503491 12:42866724-42866746 TGCCTGTAATCCCAGCATGTTGG - Intergenic
1096544143 12:52325716-52325738 TGCCTGTAATCCCAGCATGTTGG + Intergenic
1097551966 12:61084438-61084460 GGGCTGTAATCCCAGCGTTTTGG + Intergenic
1098121296 12:67242542-67242564 TGCCTGTAATCCCAGCTTGTTGG - Intergenic
1099482817 12:83189771-83189793 TGCCTCTAATCCCAGCTTCTCGG + Intergenic
1100209110 12:92382999-92383021 TGGCCCCAAACCCAGCATGTAGG + Intergenic
1100404267 12:94259801-94259823 TGGCTGTAATCCCAGCATTTTGG + Intronic
1101173293 12:102121677-102121699 TGCCTCTAACCCCAGCTACTTGG - Intronic
1101721364 12:107353237-107353259 TGGCTCTGAGCCCAGCATGGTGG + Intronic
1101962860 12:109262875-109262897 TGCCTGTAACCCCAGCATTTTGG - Intronic
1102158941 12:110753153-110753175 TGCCTGTAACCCCAGCATTTTGG + Intergenic
1102540403 12:113614863-113614885 TGCCTGTAACCCCAGCATTTTGG - Intergenic
1102787405 12:115616054-115616076 TATCTGTAATCCCAGCGTGTTGG - Intergenic
1102990334 12:117311123-117311145 TGCCTGTAACCCCAGCATTTTGG - Intronic
1103070414 12:117936643-117936665 TGCCTCTAATCCCAGCATTTTGG - Intronic
1103174171 12:118847528-118847550 CGCCTGTAACCCCAGCATGTTGG - Intergenic
1103281643 12:119762774-119762796 TGCCTCTAACCCCAGCACTTTGG + Intronic
1103652497 12:122443829-122443851 TGCCTCTAACCCCAGCACTTTGG - Intergenic
1103793867 12:123490215-123490237 TTGCTCTTTCCCCAGGGTGTGGG - Intronic
1104029592 12:125054943-125054965 TGTCTGTAATCCCAGCATGTTGG - Intergenic
1104456916 12:128922660-128922682 TGCCTGTAATCCCAGCGTTTTGG + Intronic
1104501143 12:129286785-129286807 TGCCTGTAATCCCAGCATGTCGG + Intronic
1104596704 12:130125130-130125152 TGCCTCTAATCCCAGCGCCTTGG + Intergenic
1104872566 12:132010679-132010701 TGCCTCTAATCCCAGCACGTTGG + Intronic
1105202074 13:18189764-18189786 TGCCTCTAACCCCAGCACTTTGG - Intergenic
1105375035 13:19836082-19836104 TGCCTGTAATCCCAGCATGTTGG - Intronic
1105568415 13:21575460-21575482 TGCCTGTAATCCCAGCATGTTGG + Intronic
1106069333 13:26392584-26392606 TGCCTATAATCCCAGCATGTTGG - Intronic
1106686513 13:32065862-32065884 TGCCTCTAACCCCAGCATTTTGG - Intronic
1107485925 13:40827423-40827445 TGCCTCTAATCCCAGCATTTTGG - Intergenic
1107909498 13:45092187-45092209 TGCCTGTAACCCCAGCATTTTGG + Intergenic
1108372450 13:49783990-49784012 TGGCTATAATCCCAGCATTTTGG + Intronic
1109795811 13:67311811-67311833 TGGCTGTAATCCCAGCATTTGGG - Intergenic
1110103677 13:71642758-71642780 TGGCTGTAATCCCAGCGCTTTGG + Intronic
1110205926 13:72913515-72913537 TGCCTTTAACCCCAGCATTTTGG + Intronic
1110206044 13:72914838-72914860 TGCCTATAATCCCAGCGTTTTGG - Intronic
1110437448 13:75490845-75490867 TGCCTGTAACCCCAGCGCTTTGG - Intergenic
1111323344 13:86659441-86659463 CGCCTGTAACCCCAGCATGTTGG - Intergenic
1111390937 13:87593945-87593967 CGCCTGTAACCCCAGCATGTTGG + Intergenic
1112724620 13:102288843-102288865 TGCCTGTAATCCCAGCATGTTGG - Intronic
1112939908 13:104848632-104848654 TGTCTCTAATCCCAGCATTTTGG + Intergenic
1113140873 13:107147546-107147568 TGCCTGTAACCCCAGCACGTAGG - Intergenic
1113148046 13:107230797-107230819 TGGCTGTAATCCCAGCACGTTGG + Intronic
1113467478 13:110522450-110522472 TGCCTGTAATCCCAGCATGTTGG + Intergenic
1114316343 14:21513004-21513026 TGCCTGTAACCCCAGCACGTTGG - Intergenic
1114569512 14:23656762-23656784 TGCCTGTAATCCCAGCATGTTGG + Intergenic
1114619897 14:24089195-24089217 TGCCTATAACCCCAGCGCTTTGG - Intronic
1114637743 14:24197632-24197654 TGGCTATAACCCCAGCCACTTGG + Intronic
1114753396 14:25230802-25230824 TGTCTGTAATCCCAGCATGTTGG - Intergenic
1115352775 14:32413440-32413462 TGCCTATAACCCCAGCGCTTTGG - Intronic
1115621781 14:35147603-35147625 TGCCTGTAATCCCAGCATGTTGG - Intronic
1115638796 14:35317949-35317971 TGCCTGTAACCCCAGCATGTTGG - Intergenic
1116885686 14:50218852-50218874 TGGCTATAATCCCAGCACGTTGG + Intronic
1117017252 14:51530745-51530767 TGCCTGTAATCCCAGCATGTTGG - Intronic
1117071125 14:52057301-52057323 TGGTTCTAATCCCAGCGCTTTGG - Intronic
1117139483 14:52773461-52773483 TGCCTCTAACCCCAGCTACTTGG - Exonic
1118499687 14:66347553-66347575 TGCCTCTAACCCCAGCTACTCGG + Intergenic
1118562230 14:67098547-67098569 TGCCTGTAACCCCAGCATTTTGG + Intronic
1118578269 14:67266847-67266869 TGCCTGTAATCCCAGCATGTTGG + Intronic
1118957788 14:70498663-70498685 TGCCTGTAATCCCAGCATGTTGG + Intergenic
1119009480 14:70970097-70970119 TGCCTGTAACCCCAGCATTTTGG + Intronic
1119248400 14:73132225-73132247 TGGCTGTAACCCCAGCTTCTCGG + Intergenic
1119331166 14:73795020-73795042 TGCCTGTAATCCCAGTGTGTTGG - Intergenic
1120083070 14:80237113-80237135 TGCCTGTAACCCCAGCATTTTGG - Intronic
1120627775 14:86850444-86850466 TGTCTGTAATCTCAGCGTGTTGG + Intergenic
1120903177 14:89593376-89593398 TGCCTGTAACCCCAGCGCTTTGG + Intronic
1120903571 14:89598543-89598565 TGCCTGTAATCCCAGCATGTTGG - Intronic
1120918297 14:89729982-89730004 TGCCTGTAATCCCAGCATGTTGG + Intergenic
1121189646 14:92015162-92015184 TGGCTATAACCCCAGCATTTTGG - Intronic
1121196340 14:92076183-92076205 TGCCTGTAATCCCAGCATGTTGG + Intronic
1121306119 14:92908330-92908352 TGCCTGTAACCCCAGCGCTTTGG + Intergenic
1121542836 14:94741511-94741533 TGCCTCTAACCCCAGCACATTGG + Intergenic
1121854869 14:97258834-97258856 TGCCTGTAACCCCAGCTTTTAGG + Intergenic
1122336465 14:100991293-100991315 TGCCTGTAATCCCAGCATGTTGG - Intergenic
1122447151 14:101778028-101778050 TGCCTCTAACCCCAGCACTTTGG - Intronic
1122466395 14:101936710-101936732 TGCCTCTAATCCCAGCATTTTGG + Intergenic
1122492708 14:102130227-102130249 TGTCTGTAATCCCAGCGTTTTGG - Intronic
1122638853 14:103145272-103145294 TGCCTGTAATCCCAGCATGTTGG - Intergenic
1122988881 14:105227157-105227179 TGCCTGTAATCCCAGCATGTGGG + Intronic
1123051048 14:105542646-105542668 TGCCTGTAACCCCAGCATTTTGG - Intergenic
1123742817 15:23296227-23296249 TGCCTATAATCCCAGCATGTTGG - Intergenic
1123910665 15:24963776-24963798 TGCCTCTAATCCCAGCATGTTGG + Intronic
1124065304 15:26337730-26337752 TGCCTGTAATCCCAGCGTTTTGG + Intergenic
1124594873 15:31083896-31083918 AGGCTCTCACACCAGCCTGTGGG - Intronic
1125430237 15:39586567-39586589 TTCCTCTCACCCCAGCGTTTGGG - Intronic
1125480541 15:40076654-40076676 TGGCTGTAATCCCAGCGAATGGG + Intergenic
1125808932 15:42519628-42519650 TGCCTGTAACCCCAGCACGTTGG - Intronic
1126282664 15:46974347-46974369 TGCCTGTAATCCCAGCGTGTTGG + Intergenic
1126396380 15:48222829-48222851 TGGCTCTATTCCCAGGGTCTGGG - Intronic
1126762049 15:51978256-51978278 TGCCTCTAAGCCCAGCTAGTCGG - Intronic
1126799690 15:52287848-52287870 TGCCTCTAACCCCAGCTACTTGG + Intronic
1127400840 15:58584431-58584453 TGCCTATAATCCCAGCATGTGGG - Intergenic
1127498488 15:59534578-59534600 TGCCTGTAATCCCAGCGTTTTGG - Intergenic
1127532589 15:59859342-59859364 TGCCTATAATCCCAGCATGTTGG + Intergenic
1127552877 15:60058655-60058677 TGCCTGTAATCCCAGCATGTTGG + Intronic
1127589735 15:60411251-60411273 TGCCTATAACCCCAACATGTTGG - Intergenic
1127595223 15:60474859-60474881 TGGCTGTAACCCCAGCACTTTGG + Intronic
1128048396 15:64640296-64640318 TGCCTATAATCCCAGCATGTTGG - Intronic
1128070100 15:64790205-64790227 TGCCTGTAACCCCAGCGGTTTGG + Intergenic
1128070717 15:64794978-64795000 TGCCTGTAACCCCAGCATTTTGG + Intergenic
1128182892 15:65620613-65620635 TGGGTTTACCCCCAGCGGGTAGG + Intronic
1128650492 15:69408924-69408946 TGCCTGTAATCCCAGCATGTTGG - Intergenic
1129667993 15:77590216-77590238 TGGCCCTCTCCCCAGAGTGTTGG - Intergenic
1129858239 15:78840435-78840457 TGCCTGTAATCCCAGCATGTTGG - Intronic
1130835624 15:87646778-87646800 TGGCTATAATCCCAGCGAATCGG + Intergenic
1131139118 15:89963013-89963035 TGCCTGTAATCCCAGCATGTTGG + Intergenic
1131302153 15:91209245-91209267 TGCCTCTAATCCCAGCTAGTTGG - Intronic
1131424720 15:92336181-92336203 TTGCTGTATCCCCAGTGTGTAGG + Intergenic
1131521372 15:93118451-93118473 TGGCTCTAACCCCAGCTAGCAGG - Intergenic
1131580289 15:93636272-93636294 TGGCTCTTGCCCCTGCCTGTTGG - Intergenic
1133085380 16:3358284-3358306 TGCCTGTAACCCCAGCGACTTGG + Intergenic
1133134048 16:3696984-3697006 CGGCTCTAATCCCAGCGCTTGGG - Intronic
1133343859 16:5056977-5056999 TGCCTCTAACCCCAGCACTTTGG + Intronic
1133505057 16:6403613-6403635 TGGCTACAACCCCAGCATTTTGG - Intronic
1133895017 16:9918910-9918932 TGCCTGTAATCCCAGCGTTTTGG + Intronic
1133946265 16:10351336-10351358 TGGTTGTAATCCCAGCATGTTGG - Intronic
1134026744 16:10959871-10959893 TGCCTGTAATCCCAGCATGTTGG - Intronic
1134137338 16:11686216-11686238 TGCCTGTAATCCCAGCATGTTGG - Intronic
1134271878 16:12740184-12740206 TGGCTGTAATCCCAGCATTTTGG + Intronic
1134590376 16:15448148-15448170 TGTCTGTAATCCCAGCGCGTTGG - Intronic
1134672435 16:16065691-16065713 TGCCTGTAATCCCAGCATGTTGG - Intronic
1134747924 16:16602256-16602278 TGCCTGTAATCCCAGCATGTTGG - Intergenic
1134997545 16:18751403-18751425 TGCCTGTAATCCCAGCATGTTGG + Intergenic
1135138213 16:19900330-19900352 TGGCTGTAATCCCAGCATTTTGG + Intergenic
1135313588 16:21424632-21424654 TGCCTCTAATCCCAGCATTTTGG - Intronic
1135366512 16:21856912-21856934 TGCCTCTAATCCCAGCATTTTGG - Intronic
1135445303 16:22514246-22514268 TGCCTCTAATCCCAGCATTTTGG + Intronic
1135740060 16:24967549-24967571 TGGCTGTAATCCCAGCGCTTTGG + Intronic
1136039082 16:27563786-27563808 TGCCTCTAATCCCAGCACGTTGG + Intronic
1136185001 16:28582681-28582703 TGCCTGTAATCCCAGCATGTTGG + Intronic
1137010880 16:35318750-35318772 TGCCTGTAACCCCAGCATTTTGG + Intergenic
1137042535 16:35626497-35626519 TGCCTGTAACCCCAGCATTTTGG + Intergenic
1137641489 16:50034638-50034660 TGCCTCTAATCCCAGCATTTTGG + Intronic
1138127224 16:54448634-54448656 TGTCTGTAACCCCAGCATTTTGG + Intergenic
1138788640 16:59875768-59875790 TGCCTGTAATCCCAGCGTTTTGG + Intergenic
1138939663 16:61775101-61775123 TGCCTATAACCCCAGCATTTTGG + Intronic
1139714421 16:68801374-68801396 TGCCTGTAACCCCAGCATTTTGG - Intronic
1140737249 16:77909374-77909396 TGCCTGTAATCCCAGCATGTTGG + Intronic
1140973119 16:80032583-80032605 TGGCTATAATCCCAGCATTTTGG - Intergenic
1141368341 16:83464618-83464640 TGTCTGTAATCCCAGCATGTTGG - Intronic
1141492955 16:84387259-84387281 TGCCTGTAATCCCAGCGCGTTGG + Intronic
1141663230 16:85452914-85452936 TGCCTCCAACCCCACCCTGTGGG + Intergenic
1142375640 16:89705704-89705726 TGCCTGTAACCCCAGCGGTTTGG - Intergenic
1142517815 17:444184-444206 TGTCTATAATCCCAGCGTTTTGG - Intronic
1142557074 17:786533-786555 TGCCTGTAATCCCAGCATGTTGG - Intronic
1142734053 17:1883419-1883441 TGCCTGTAACCCCAGCATTTTGG - Intronic
1142756981 17:2022410-2022432 TGGCTGTAATCCCAGCATTTTGG - Intronic
1142895169 17:2971472-2971494 TGCCTGTAATCCCAGCGTTTTGG + Intronic
1143143436 17:4756630-4756652 TGCCTGTAAACCCAGCATGTTGG + Intergenic
1143302911 17:5924286-5924308 TGGCCCAAACCCCAGTCTGTTGG + Intronic
1143664860 17:8351595-8351617 TGGCTGTAATCCCAGCATTTTGG + Intergenic
1143773013 17:9180297-9180319 TGCCTCTAATCCCAGCGCTTTGG - Intronic
1143818717 17:9542096-9542118 TGGCTGTAATCCCAGCGTTTTGG + Intronic
1143877724 17:10004749-10004771 TGCCTCTAATCCCAGCATTTTGG + Intronic
1143923163 17:10347107-10347129 TGCCTGTAATCCCAGCGTTTTGG + Intronic
1144113583 17:12063844-12063866 TGGCTGTAACCCCAGCTACTTGG + Intronic
1144372797 17:14608521-14608543 TGCCTCTAATCCCAGCATTTTGG + Intergenic
1144389174 17:14777818-14777840 TGCCTGTAACCCCAGTGTTTGGG + Intergenic
1144613656 17:16748141-16748163 TGCTTGTAACCCCAGCATGTTGG - Intronic
1144886714 17:18467898-18467920 TGGCTGTAATCCCAGCTAGTTGG + Intergenic
1145091420 17:19989122-19989144 TGCCTGTAATCCCAGCATGTTGG + Intergenic
1145100868 17:20075683-20075705 TGCCTCTAATCCCAGCATTTTGG + Intronic
1145133316 17:20378193-20378215 TGCTTGTAACCCCAGCATGTTGG - Intergenic
1146131421 17:30279674-30279696 TGCCTGTAATCCCAGCATGTTGG + Intronic
1146142903 17:30384538-30384560 TGCCTCTAATCCCAGCATTTTGG + Intronic
1146175820 17:30665959-30665981 TGTCTGTAACCCCAGCATGTTGG - Intergenic
1146349272 17:32082064-32082086 TGTCTGTAACCCCAGCATGTTGG - Intergenic
1146440142 17:32886854-32886876 TGCCTCTAATCCCAGCATTTTGG - Intergenic
1146749172 17:35361992-35362014 TGCCTCTAATCCCAGCATTTTGG - Intronic
1146777357 17:35633100-35633122 TGCCTCTAATCCCAGCGCTTTGG + Intronic
1147736487 17:42642009-42642031 TGGCTGTAACCCCAGCACTTTGG + Intergenic
1147949452 17:44098854-44098876 TGGCTATAATCCCAGCATTTTGG + Intronic
1148176004 17:45565824-45565846 TGCCTATAATCCCAGCGTTTTGG + Intergenic
1149069155 17:52519146-52519168 TGCCTCTAACCCCAGCTACTTGG - Intergenic
1149129936 17:53287030-53287052 TGCCTGTAATCCCAGCATGTTGG - Intergenic
1149638714 17:58189998-58190020 TGGCACCAAGCCCAGCTTGTGGG + Intergenic
1149703536 17:58675018-58675040 TGCCTATAACCCCAGCTTCTTGG + Intronic
1149711861 17:58750707-58750729 TGCCTGTAACCCCAGCATTTTGG + Intergenic
1149770390 17:59316300-59316322 TGGCTGTAACCCCAGCACTTTGG + Intergenic
1150052588 17:61979566-61979588 TGGCTGTAATCCCAGCATTTGGG - Intronic
1150725575 17:67648891-67648913 TGGCTCTAATCCCAGCACTTTGG + Intronic
1150767001 17:68010228-68010250 AAGCCCTAACCCCAGCGTGATGG - Intergenic
1150855351 17:68747037-68747059 TGGCTGTAACCCTAGCGACTCGG + Intergenic
1150868254 17:68877277-68877299 TGCCTCTAACCCCAGCACTTTGG - Intronic
1151237225 17:72729556-72729578 TGCCTGTAATCCCAGCATGTTGG - Intronic
1151555665 17:74845528-74845550 TGGCTATAACCCCAGCACTTTGG - Intronic
1151669182 17:75562692-75562714 TGGCTATAACCCCAGCTACTTGG - Intronic
1151950847 17:77352907-77352929 TGTCTCTAATCCCAGTGTTTTGG - Intronic
1152053932 17:78006965-78006987 TGCCTGTAACCCCAGCTTATGGG - Intronic
1152148438 17:78583606-78583628 TGCCTGTAATCCCAGCATGTTGG + Intergenic
1152234802 17:79133046-79133068 GGCCTCAAACCCCAGCGTGGGGG + Intronic
1152273424 17:79339314-79339336 TGCCTGTAACCCCAGCGCTTTGG - Intronic
1152807621 17:82364009-82364031 TGCCTATAACCCCAGCATTTTGG + Intergenic
1152986136 18:322962-322984 TGCCTGTAATCCCAGCGTTTTGG + Intronic
1154022618 18:10677476-10677498 TGCCTGTAATCCCAGCATGTTGG - Intronic
1154951804 18:21217470-21217492 TGCCTGTAACCCCAGCATTTTGG + Intergenic
1155124442 18:22857993-22858015 TGCCTGTAATCCCAGCGTTTTGG + Intronic
1155138754 18:23023156-23023178 TGGCTGTAATCCCAGTGTTTTGG - Intronic
1155186877 18:23394855-23394877 TGCCTGTAACCCCAGCTAGTCGG + Intronic
1155220976 18:23685488-23685510 TGCCTGTAACCCCAGCGCTTTGG - Intergenic
1155603451 18:27576075-27576097 TGCCTCTAATCCCAGCATTTTGG + Intergenic
1155955193 18:31951020-31951042 TGGCTGTAGTCCCAGCGTTTTGG + Intronic
1156187145 18:34676572-34676594 TGCCTGTAATCCCAGCATGTTGG + Intronic
1156290028 18:35739573-35739595 TGCCTATAATCCCAGCATGTTGG - Intergenic
1156306401 18:35881551-35881573 TGCCTGTAACCCCAGCATGTTGG - Intergenic
1156598424 18:38575026-38575048 TGCCTATAATCCCAGCATGTTGG - Intergenic
1157242518 18:46024396-46024418 TGCCTCTAACCCCAGCACTTTGG - Intronic
1157296014 18:46444731-46444753 TGCCTCTAATCCCAGCATTTTGG - Intronic
1157445548 18:47743987-47744009 TGCCTCTAATCCCAGCATTTTGG - Intergenic
1157537268 18:48469099-48469121 TGGCTCTAATCCCAGCACTTTGG + Intergenic
1157803760 18:50642863-50642885 TGCCTATAATCCCAGCGTTTTGG - Intronic
1158135947 18:54208364-54208386 TGCCTCTAACCCCAGCTACTCGG + Intronic
1158638960 18:59186361-59186383 TGGCTGTAATCCCAGCATTTTGG + Intergenic
1159400593 18:67927954-67927976 TGGCTCTAATCCCAGCAACTGGG - Intergenic
1159569149 18:70092011-70092033 TGCCTGTAATCCCAGCTTGTTGG - Intronic
1159952225 18:74493079-74493101 TGCCTCTAATCCCAGCATTTTGG + Intergenic
1160239544 18:77113199-77113221 TGCCTCTAATCCCAGCATTTTGG - Intronic
1161023484 19:2023235-2023257 TGCCTGTAATCCCAGCATGTTGG + Intronic
1161111405 19:2472779-2472801 TGCCTGTAATCCCAGCATGTTGG - Intergenic
1161184766 19:2909786-2909808 TGCCTGTAATCCCAGCATGTTGG - Intronic
1161429481 19:4223191-4223213 TGCCTGTAATCCCAGCGTTTTGG - Intronic
1161483126 19:4520687-4520709 TGCCTGTAACCCCAGCGCTTTGG - Intergenic
1161561603 19:4976121-4976143 TGCCTGTAATCCCAGCTTGTTGG + Intronic
1161582754 19:5089909-5089931 TGCCTCTAATCCCAGCATTTAGG + Intronic
1162412118 19:10512664-10512686 TGCCTCTAACCCCAGCACTTTGG - Intergenic
1162560396 19:11414874-11414896 TGGCTGTAATCCCAGCATTTTGG + Intronic
1162671921 19:12264956-12264978 TGCCTGTAACCCCAGCATTTTGG - Intronic
1162720738 19:12661015-12661037 TGCCTGTAATCCCAGCATGTTGG - Intronic
1162788135 19:13048597-13048619 TGCCTGTAATCCCAGCGTTTTGG + Intronic
1162803633 19:13124817-13124839 TGCCTCTAACCTCAGCATTTAGG + Intronic
1162847364 19:13403673-13403695 TGCCTGTAATCCCAGCATGTTGG + Intronic
1162983147 19:14251896-14251918 CGCCTGTAACCCCAGCATGTTGG + Intergenic
1163187764 19:15651491-15651513 TGCCTCTAATCCCAGCTAGTTGG - Intronic
1163381851 19:16974330-16974352 TGCCTCTAATCCCAGCGACTAGG + Intronic
1163624456 19:18381050-18381072 TGCCTATAACCCCAGCATTTTGG + Intronic
1163760932 19:19136393-19136415 TGCCTGTAATCCCAGCATGTTGG + Intronic
1164275666 19:23715469-23715491 TGGCTGTAATCCCAGCATTTTGG + Intergenic
1164314185 19:24072295-24072317 TGCCTCTAACCCCAGCTACTCGG - Intronic
1164987805 19:32661601-32661623 TGCCTGTAATCCCAGCGTTTTGG - Intronic
1164997688 19:32734631-32734653 TGCCTGTAATCCCAGCGTTTTGG - Intronic
1165046075 19:33106107-33106129 TGCCTGTAATCCCAGCATGTTGG - Intronic
1165219200 19:34301171-34301193 TGGCTGTAACCCCAGCACTTTGG + Intronic
1165258292 19:34593060-34593082 TGCCTCTAACCCTAGCACGTTGG + Intergenic
1165361989 19:35342427-35342449 TGGCTCTAATCCCAGGGCTTTGG - Intronic
1165441757 19:35832281-35832303 TGCCTGTAATCCCAGCATGTTGG + Intronic
1165609738 19:37141088-37141110 TGCCTGTAATCCCAGCATGTGGG + Intronic
1165757022 19:38299573-38299595 TGCCTGTAACCCCAGCATTTTGG + Intronic
1166070828 19:40386610-40386632 TGCCTATAATCCCAGCATGTTGG - Intronic
1166341881 19:42142822-42142844 TGACTATAACCCCAGCATGTAGG - Intronic
1166522817 19:43492473-43492495 TGCCTGTAACCCCAGCATTTTGG - Intronic
1166612458 19:44211071-44211093 TGCCTATAACCCCAGCGACTTGG + Intronic
1166653773 19:44595353-44595375 TGCCTCTAATCCCAGCGCTTTGG + Intergenic
1166690254 19:44818182-44818204 TTGCTCAAACCCCAACCTGTGGG - Intronic
1166819114 19:45565743-45565765 TGGCTATAATCCCAGCCTCTGGG - Intronic
1167051624 19:47082571-47082593 TGGCTATAATCCCAGCGCTTTGG - Intronic
1167207011 19:48109530-48109552 TGCCTATAATCCCAGCGTTTTGG - Intronic
1167344773 19:48938355-48938377 TGCCTGTAACCCCAGCGCTTTGG - Intronic
1167653202 19:50745018-50745040 TGCCTGTAATCCCAGCATGTTGG + Intergenic
1167874570 19:52400784-52400806 TGCCTCTAATCCCAGCATGCTGG - Intronic
1168024980 19:53637427-53637449 TGCCTCTAATCCCAGCACGTTGG + Intergenic
1168049473 19:53818040-53818062 TGCCTGTAATCCCAGCATGTTGG - Intronic
1168207324 19:54860633-54860655 TGCCTCTTATCCCAGCGTGTTGG - Intronic
1168220274 19:54955535-54955557 TGGCTGTAAGCCCAGCATGTTGG + Intronic
1168225043 19:54988643-54988665 TGGCTGTAATCCCAGCATTTTGG - Intronic
1168497041 19:56862133-56862155 TGCCTGTAATCCCAGCATGTTGG + Intergenic
1168651276 19:58093889-58093911 TGCCTCTAACCCCAGTGACTCGG - Intronic
924965652 2:74005-74027 TGCCTGTAATCCCAGCGTTTTGG - Intergenic
925396556 2:3537460-3537482 TGGCTCTAACCCCAGCGTGTTGG + Intronic
926181278 2:10645787-10645809 TGCCTGTAATCCCAGCATGTTGG - Intronic
926252430 2:11162976-11162998 TGCCTATAATCCCAGTGTGTTGG + Intronic
926284781 2:11480348-11480370 TGCCTGTAACCCCAGCATTTTGG + Intergenic
926416661 2:12656324-12656346 GGCCTGTAATCCCAGCGTGTTGG + Intergenic
927173355 2:20388608-20388630 CAGCTCTGAGCCCAGCGTGTGGG - Intergenic
927537323 2:23874059-23874081 TGCCTGTAACCCCAGCTAGTGGG + Intronic
927561134 2:24074866-24074888 TGCCTGTAATCCCAGCGTTTTGG + Intronic
927578000 2:24216493-24216515 TGCCTCTAATCCCAGCATTTCGG + Intronic
927724510 2:25411096-25411118 TGGCTGTAACCCCAGCACTTTGG + Intronic
927863671 2:26575782-26575804 TGCCTGTAATCCCAGCATGTTGG - Intronic
927927449 2:27023830-27023852 TGGCTCTACTGCCTGCGTGTGGG - Intronic
928164901 2:28963643-28963665 TGGCTGTCATCCCAGCATGTTGG - Intronic
928908595 2:36395260-36395282 TGCCTGTAATCCCAGCGTTTTGG - Intronic
929094020 2:38246925-38246947 TGCCTGTAATCCCAGCGTTTTGG - Intergenic
929718978 2:44347068-44347090 TGCCTGTAACCCCAGCATTTTGG + Intronic
930134809 2:47891082-47891104 TGCCTGTAATCCCAGCATGTTGG - Intronic
930178491 2:48325972-48325994 TGCCTTTAACCCCAGCTAGTTGG - Intronic
930843912 2:55880506-55880528 GGGCACTAACCCCAGCATCTAGG + Intronic
931421709 2:62134060-62134082 TGCCTGTAACCCCAGCATTTTGG - Intronic
932158007 2:69435876-69435898 TGCCTGTAATCCCAGCGAGTTGG - Intronic
933662165 2:84936722-84936744 TGGCTGTAACCCCAGCACTTTGG + Intergenic
934760516 2:96853430-96853452 TGGGTCCAACCCCAGGGTGGTGG - Exonic
935121518 2:100187143-100187165 TGTCTGTAACCCCAGCATTTTGG - Intergenic
935282570 2:101531900-101531922 TGCCTGTAACCCCAGCATTTTGG + Intergenic
935292176 2:101620160-101620182 TGCCTCTAATCCCAGCTTCTTGG + Intergenic
935470332 2:103451921-103451943 TGGCTGTAATCCCAGCATTTTGG - Intergenic
935643702 2:105314686-105314708 TGCCTGTAATCCCAGCATGTTGG + Intronic
935857382 2:107289727-107289749 TGCCTCTAACCCCAGCACTTTGG + Intergenic
936100369 2:109572391-109572413 TGCCTGTAACCCCAGCGGTTTGG - Intronic
936995518 2:118409874-118409896 TGCCTGTAATCCCAGCGTGATGG + Intergenic
937426770 2:121806497-121806519 TGCCTGTAATCCCAGCATGTTGG - Intergenic
937761826 2:125613724-125613746 TGCCTCTAATCCCAGCATTTTGG - Intergenic
938004841 2:127780601-127780623 TGACTGTAACCCCAGCATTTTGG + Intronic
938607815 2:132914579-132914601 TGGCCCTACCCCCAGCATTTGGG - Intronic
938933606 2:136109211-136109233 TGGCTGTAATTCCAGCGTTTTGG + Intergenic
939148205 2:138441794-138441816 TGCCTTTAATCCCAGCATGTTGG - Intergenic
939184881 2:138848497-138848519 TGGCTGTAATCCCAGCACGTTGG - Intergenic
939205462 2:139096696-139096718 TGCCTCTAATCCCAGCATTTTGG - Intergenic
939771127 2:146320430-146320452 TGCCTGTAATCCCAGCATGTTGG - Intergenic
939850036 2:147293045-147293067 TGCCTCTAATCCCAGCATTTTGG - Intergenic
940295740 2:152122163-152122185 TGGCTTTAATCCCAGCATTTTGG + Intronic
940423119 2:153501590-153501612 TGCCTGTAATCCCAGCATGTTGG - Intergenic
941461311 2:165775013-165775035 TGGCTGTAATCCCAGCACGTTGG - Intronic
941495441 2:166195786-166195808 TGCCTGTAACCCCAGCATGTTGG + Exonic
941695126 2:168542955-168542977 CGCCTGTAATCCCAGCGTGTTGG - Intronic
941820238 2:169837348-169837370 TGGCTGTAATCCCAGCTTCTCGG + Intronic
941823808 2:169870387-169870409 TGCCTGTAATCCCAGCATGTTGG - Intronic
941838702 2:170055034-170055056 TGTCTCTAACCCCAGCTCTTTGG + Intronic
942050692 2:172137758-172137780 TGCCTATAATCCCAGCGCGTTGG - Intergenic
942265418 2:174219680-174219702 TGCCTGTAACCCCAGCATTTTGG - Intronic
943032817 2:182705637-182705659 TGCCTGTAACCCCAGCTAGTTGG - Intergenic
943119726 2:183720003-183720025 TGCCTGTAATCCCAGCATGTTGG - Intergenic
943293093 2:186101171-186101193 TGCCTGTAATCCCAGTGTGTTGG + Intergenic
943444732 2:187970690-187970712 TGCCTGTAATCCCAGCGTTTTGG + Intergenic
943774503 2:191750430-191750452 TGCCTGTAACCCCAGCATTTTGG - Intergenic
944000326 2:194827599-194827621 TGCCTGTAACCCCAGCATTTTGG + Intergenic
944569673 2:201031389-201031411 TGCCTATAACCCCAGCATTTTGG + Intronic
944910545 2:204306448-204306470 TGCCTCTAACCCCAGCTACTGGG - Intergenic
945089053 2:206161520-206161542 TGCCTGTAATCCCAGCATGTTGG + Intronic
945716621 2:213365716-213365738 TGCCTGTAATCCCAGCATGTTGG - Intronic
946578912 2:221105324-221105346 TGCCTGTAATCCCAGCATGTTGG + Intergenic
946654755 2:221934651-221934673 TGCCTGTAATCCCAGCATGTTGG - Intergenic
946941668 2:224775733-224775755 TGGCTCTAATCCCAGCACTTTGG - Intronic
947158767 2:227190643-227190665 TGGCTCTAATCCCAGCACTTTGG + Intronic
947660705 2:231864624-231864646 TGCCTGTAATCCCAGCATGTCGG - Intergenic
947667825 2:231918376-231918398 TGCCTGTAATCCCAGCATGTTGG - Intergenic
947759685 2:232594792-232594814 TGCCTGTAATCCCAGCATGTTGG - Intergenic
948385977 2:237581126-237581148 TGCCTGTAACCCCAGCATTTTGG + Intronic
1168920202 20:1527172-1527194 TGCCTGTAACCCCAGCATTTTGG + Intergenic
1169009577 20:2238959-2238981 TGCCTGTAATCCCAGCATGTTGG + Intergenic
1169121630 20:3100116-3100138 TGGCTGTAATCCCAGCGCTTTGG - Intergenic
1169258242 20:4115363-4115385 TGCCTGTAACCCCAGCATTTTGG - Intergenic
1169379344 20:5093499-5093521 TGCCTGTAACCCCAGCACGTTGG - Intronic
1169489010 20:6055835-6055857 TGCCTGTAATCCCAGCATGTTGG + Intergenic
1169979396 20:11366317-11366339 TGGCTGTAACCCCAGCTACTTGG - Intergenic
1170318330 20:15066617-15066639 TGCCTGTAACCCCAGCATTTTGG + Intronic
1170774626 20:19364713-19364735 TGCCTGTAATCCCAGCATGTTGG - Intronic
1170973127 20:21134925-21134947 TGGCTGTAATCCCAGCATTTTGG - Intronic
1171010889 20:21508904-21508926 TGGCCCTAACCCCAGCGCCCTGG - Intergenic
1171458419 20:25284684-25284706 TGCCTATAACCCCAGCCTTTTGG - Intronic
1171507875 20:25653708-25653730 TGCCTGTAATCCCAGCGTTTTGG + Intergenic
1171975143 20:31589664-31589686 TGCCTGTAACCCCAGCATTTTGG - Intergenic
1172152430 20:32799776-32799798 TGTCTCTAATCCCAGCGGTTTGG - Intronic
1172411874 20:34730345-34730367 TGCCTGTAACCCCAGCATTTTGG - Intronic
1172546151 20:35763195-35763217 TGGCTCTAATCCCAGCACTTTGG - Intergenic
1172551735 20:35805738-35805760 TGCCTGTAACCCCAGCATTTTGG - Intronic
1172888774 20:38249134-38249156 TGCCTCTAATCCCAGCATTTTGG - Intronic
1173197371 20:40926711-40926733 TGGCTGTAACTCCCGCCTGTTGG - Intergenic
1173280737 20:41625221-41625243 TGCCTGTAATCCCAGTGTGTGGG - Intergenic
1173344933 20:42190624-42190646 TGGCCCTAACCCTAGAGTTTTGG + Intronic
1173503268 20:43568434-43568456 TGCCTCTAACCCCAGCACTTTGG - Intronic
1173684556 20:44913659-44913681 TGGCTGTAATCCCAGCATTTTGG - Intronic
1173991689 20:47308479-47308501 TGCCTGTAATCCCAGCGTTTTGG - Intronic
1174371540 20:50092194-50092216 TGCCTATAACCCCAGCGACTAGG + Intronic
1174401730 20:50279482-50279504 TGCCTGTAACCCCAGCGCTTTGG + Intergenic
1174470011 20:50751225-50751247 TGGCTCTAATCCTAGCATTTTGG - Exonic
1175784752 20:61705446-61705468 TGGGTCTAACCCCTCAGTGTGGG + Intronic
1176134846 20:63517979-63518001 ATGCGTTAACCCCAGCGTGTGGG - Intergenic
1176715879 21:10348245-10348267 TGCCTCTAACCCCAGCACTTTGG + Intergenic
1178838757 21:36121320-36121342 TGCCTGTAATCCCAGCGTTTTGG + Intergenic
1179326790 21:40354491-40354513 TGCCTGTAATCCCAGCATGTTGG - Intronic
1179341053 21:40509862-40509884 TGGCTATAATCCCAGCATTTTGG + Intronic
1179599190 21:42464645-42464667 TGGCTGTAATCCCAGCGCTTTGG + Intergenic
1179669734 21:42938216-42938238 TGGCTGTAATCCCAGCGCTTTGG - Intergenic
1179777369 21:43674415-43674437 TGCCTGTAACCCCAGCATTTTGG - Intronic
1180687051 22:17677470-17677492 TGCCTGTAATCCCAGCGTGAGGG + Intronic
1180966856 22:19794031-19794053 TGCCTTTAATCCCAGCATGTGGG + Intronic
1181739176 22:24906670-24906692 TGCCTGTAATCCCAGCGTTTCGG + Intronic
1181947371 22:26528720-26528742 TGGCTGTAATCCCAGCGCTTTGG + Intronic
1182212179 22:28685886-28685908 TGCCTCTAATCCCAGCATTTTGG + Intergenic
1182248633 22:28981734-28981756 TGCCTGTAATCCCAGCGTTTTGG + Intronic
1182399206 22:30061589-30061611 TGGCTGTAATCCCAGCATTTTGG - Intergenic
1182403801 22:30106269-30106291 TGCCTGTAATCCCAGCATGTTGG - Intronic
1182553290 22:31113886-31113908 TGCCTGTAACCCCAGCATTTTGG - Intronic
1182718885 22:32381847-32381869 TGCCTGTAACCCCAGCATTTTGG + Intronic
1182937933 22:34243798-34243820 TGCCTGTAATCCCAGCATGTTGG - Intergenic
1183210916 22:36450584-36450606 CGCCTGTAATCCCAGCGTGTTGG - Intergenic
1183222130 22:36522091-36522113 TGGCTGTAACCCCAGCACTTTGG + Intronic
1183503546 22:38195775-38195797 TGCCTGTAATCCCAGCATGTTGG - Intronic
1183729769 22:39611491-39611513 TGGCTCTAACCAGAGCCTGGGGG - Intronic
1184108514 22:42382314-42382336 TGCCTGTAATCCCAGCATGTTGG - Exonic
1184237780 22:43193987-43194009 TGGCTGTAATCCCAGCATTTTGG - Intergenic
1184516514 22:44965805-44965827 TGGCACTAACCCCAGGCTGCTGG - Intronic
1184532176 22:45063165-45063187 TGGCTGTAATCCCAGCTAGTAGG - Intergenic
1185356597 22:50376192-50376214 TGCCTGTAACCCCAGCATATTGG + Intronic
949392383 3:3577446-3577468 TGTCTCTAAACCCAGCATTTGGG + Intergenic
949431092 3:3977002-3977024 TGCCTGTAATCCCAGCATGTTGG + Intronic
949713852 3:6904977-6904999 TGCCTCTAATCCCAGCGATTTGG - Intronic
949794001 3:7825911-7825933 TGACTGTAATCCCAGCATGTTGG - Intergenic
950057747 3:10040931-10040953 TGCCTTTAATCCCAGCATGTTGG + Intronic
950085181 3:10252258-10252280 TGCCTCTAATCCCAGCGCTTTGG - Intronic
950402942 3:12784547-12784569 TGCCTCTAATCCCAGCATTTTGG + Intergenic
951567107 3:24021498-24021520 TGCCTATAACCCCAGCATTTAGG - Intergenic
951886471 3:27529613-27529635 TGCCTCTAATCCCAGCATTTTGG + Intergenic
952289043 3:31997521-31997543 TGGCTGTAATCCCAGCATTTTGG - Intronic
952431837 3:33231209-33231231 TGCCTGTAATCCCAGCATGTTGG - Intergenic
953528954 3:43721464-43721486 TGGCTGTAATCCCAGCATTTTGG + Intronic
953946357 3:47151565-47151587 TGTCTATAATCCCAGCATGTGGG + Intronic
954049021 3:47957571-47957593 TGCCTGTAACCCCAGCATTTTGG - Intronic
955173874 3:56592623-56592645 TGACTATAATCCCAGCATGTTGG - Intronic
955208019 3:56915191-56915213 TGCCTCTAACCCCAGCACTTTGG + Intronic
955296560 3:57740607-57740629 TGCCTATAACCCCAGCGCTTTGG - Intergenic
955823482 3:62921080-62921102 TGCCTCTAATCCCAGCATTTTGG + Intergenic
956136137 3:66100896-66100918 TGTCTGTAATCCCAGCATGTTGG - Intergenic
956721595 3:72122839-72122861 TGCCTGTAACCCCAGCATTTTGG + Intergenic
959583833 3:108007636-108007658 TGCCTGTAATCCCAGCATGTTGG - Intergenic
960840072 3:121948707-121948729 TGGCTGTAATCCCAGCTTTTTGG - Intergenic
961616353 3:128184908-128184930 TGGCTGTAATCCCAGCATTTTGG + Intronic
961800834 3:129447769-129447791 TGCCTGTAATCCCAGCGTTTTGG - Intronic
963254977 3:143135869-143135891 TGGCTCTCACCACTGAGTGTGGG + Intergenic
963280523 3:143380615-143380637 TGGCTCTAATCCCAGTGCTTTGG + Intronic
964001036 3:151772020-151772042 TGCCTCTAGTCCCAGCGTGTTGG - Intergenic
964496439 3:157295692-157295714 TGCCTGTAATCCCAGCATGTTGG + Intronic
966179217 3:177172495-177172517 TGCCTCTAATCCCAGCATTTTGG + Intronic
966520049 3:180863948-180863970 TGCCTGTAACCCCAGCATTTTGG + Intronic
967206825 3:187131215-187131237 TGCCTCTAATCCCAGCATTTTGG + Intronic
967313088 3:188124981-188125003 TGCCTGTAATCCCAGCATGTTGG + Intergenic
967907456 3:194513412-194513434 TGTCTGTAATCCCAGTGTGTTGG + Intergenic
968146526 3:196303895-196303917 TGCCTGTAACCCCAGTGTTTTGG + Intronic
968254221 3:197251123-197251145 TGCCTGTAACCCCAGCATTTGGG + Intronic
968803832 4:2759865-2759887 TGCCTGTAACCCCAGCTAGTCGG + Intergenic
969359213 4:6651258-6651280 TGCCTGTAATCCCAGCATGTTGG + Intergenic
969419987 4:7088061-7088083 TGCCTGTAACCCCAGCATTTTGG - Intergenic
969422479 4:7105345-7105367 GGTCACTAACCCCAGTGTGTCGG - Intergenic
969553469 4:7889050-7889072 TGCCTGTAATCCCAGCATGTTGG - Intronic
969925529 4:10582181-10582203 TGGTTCTCTCCCCAGGGTGTTGG - Intronic
969951739 4:10843928-10843950 TGCCTATAACCCCAGCACGTCGG + Intergenic
970077784 4:12244549-12244571 TGCCTCTAATCCCAGCATTTTGG + Intergenic
971672397 4:29579748-29579770 TGCCTCTAATCCCAGCGCTTTGG + Intergenic
972448931 4:39176796-39176818 TGGCTGTAATCCCAGCATGTTGG + Intergenic
972564326 4:40256661-40256683 TGCCTGTAATCCCAGCGTTTTGG + Intergenic
972595630 4:40527549-40527571 TGCCTGTAACCCCAGCATTTTGG - Intronic
973567038 4:52199084-52199106 TGCCTATAATCCCAGCGTTTTGG + Intergenic
973892670 4:55383624-55383646 TGGCTGTAATCCCAGCATGTGGG + Intergenic
974110068 4:57514951-57514973 TGCCTCTAATCCCAGCATTTAGG - Intergenic
974380433 4:61133062-61133084 TGTCTGTAATCCCAGCGTTTTGG + Intergenic
974511942 4:62854773-62854795 TGCCTGTAATCCCAGCATGTTGG + Intergenic
974834513 4:67231541-67231563 TGGCTCTAATCCCAGCACTTTGG + Intergenic
974936454 4:68414368-68414390 CGACTGTAACCCCAGCGTTTTGG + Intergenic
975272831 4:72457619-72457641 CTGCTCTAACCCTAGCCTGTAGG + Intronic
975592999 4:76018765-76018787 TGCCTATAACCCCAGCATTTTGG + Intronic
975643737 4:76526105-76526127 TGCCTGTAATCCCAGCGTTTTGG + Intronic
976906572 4:90243646-90243668 TGTCTGTAACCCCAGCGCTTTGG - Intronic
977032439 4:91903091-91903113 TGCCTGTAATCCCAGCATGTTGG + Intergenic
977191469 4:94006285-94006307 TGCCTCTAACCCCAGCACTTTGG + Intergenic
977288079 4:95133828-95133850 TGCCTATAATCCCAGCGTTTTGG - Intronic
977599682 4:98922971-98922993 TGCCTGTAACCCCAGCTTCTTGG - Intronic
978778114 4:112522583-112522605 TGCCTGTAATCCCAGCGCGTTGG + Intergenic
979161118 4:117462739-117462761 TGCCTGTAACCCCAACATGTTGG + Intergenic
979341669 4:119531986-119532008 TGGCTCTATCACCAGTTTGTAGG + Intronic
979452089 4:120884901-120884923 TGCCTGTAATCCCAGCGAGTCGG + Intronic
979479277 4:121197265-121197287 TGCCTATAATCCCAGCGTTTTGG + Intronic
979519169 4:121646273-121646295 TCTCTCTAACCACAGCCTGTTGG - Intergenic
979531473 4:121773078-121773100 TGCCTGTAATCCCAGCATGTTGG + Intergenic
979561759 4:122108917-122108939 TGGATCCAAACCCAGAGTGTGGG + Intergenic
981659474 4:147148816-147148838 TGCCTGTAATCCCAGCATGTTGG - Intergenic
981717377 4:147764793-147764815 TGCCTCTAATCCCAGCGCTTTGG - Intronic
981858653 4:149327393-149327415 TGGCTCTATCCTCATCATGTAGG - Intergenic
982728535 4:158930765-158930787 TGACTCTAATCCCAGTGTTTTGG - Intronic
983960106 4:173742137-173742159 TGGCTGTAATCCCAGCATTTTGG + Intergenic
984062646 4:175010161-175010183 TGCCTGTAACCCCAGCATTTTGG - Intergenic
984378366 4:178960158-178960180 TGCCTGTAATCCCAGCGTTTTGG - Intergenic
984667677 4:182446718-182446740 TGTCTCTAATCCCAGCATTTTGG - Intronic
984675395 4:182541796-182541818 TGGCTGTAATCCCAGCATGTTGG + Intronic
984928980 4:184829824-184829846 TGCCTGTAATCCCAGCATGTTGG + Intergenic
985131195 4:186740358-186740380 TGGCCCCAACCCCAACGTGTGGG - Intergenic
985627336 5:995965-995987 TGCCTGTAATCCCAGCATGTTGG + Intergenic
986092695 5:4525765-4525787 TGGCTATAATCCCAGCATTTTGG + Intergenic
986601242 5:9475065-9475087 TGTCTATAACCCCAGCTAGTCGG - Intronic
986642112 5:9882365-9882387 TGGCTGTAATCCCAGCATTTTGG + Intergenic
987139685 5:14932316-14932338 TGGCTCTAATCCCAGTGCTTTGG + Intergenic
987938342 5:24499423-24499445 TGGCTGTAATCCCAGCATTTTGG + Intronic
988280592 5:29140980-29141002 TGCCTGTAATCCCAGCATGTTGG - Intergenic
988592661 5:32562537-32562559 TGCCTATAATCCCAGCGTTTTGG - Intronic
988786365 5:34569005-34569027 TGCCTCTAACCCCAGCACTTTGG - Intergenic
989024809 5:37055086-37055108 TGCCTGTAACCCCAGCATTTGGG + Intronic
989072081 5:37522210-37522232 TGGCTGTAATCCCAGCATTTTGG + Intronic
989312786 5:40039844-40039866 TGGCTATAACCTGAGCATGTCGG + Intergenic
989372624 5:40725106-40725128 TGCCTGTAATCCCAGCATGTTGG - Intronic
989617318 5:43349962-43349984 TGGCTCTCAGCCCAGTGTGGGGG - Intergenic
989743501 5:44799653-44799675 TGCCTGTAATCCCAGCGTTTTGG - Intergenic
991338382 5:65576633-65576655 TGCCTCTAATCCCAGCATTTTGG - Intronic
991925274 5:71698981-71699003 TGCCTGTAATCCCAGCGTTTTGG + Intergenic
992125340 5:73633835-73633857 TGCCTGTAACCCCAGCACGTTGG - Intronic
992779835 5:80117940-80117962 TGCCTGTAATCCCAGCATGTTGG + Intronic
993400290 5:87441188-87441210 TGCCTGTAATCCCAGCATGTTGG + Intergenic
993571762 5:89549581-89549603 TGCCTCTAATCCCAGCATTTTGG + Intergenic
993739541 5:91520786-91520808 TGCCTCTAATCCCAGCTTCTTGG + Intergenic
995396972 5:111697269-111697291 TGCCTCTAGGCCCAGCATGTAGG + Intronic
996202661 5:120695980-120696002 TGCCTGTAACCCCAGCACGTTGG + Intergenic
996549694 5:124717203-124717225 TGCCTGTAACCCCAGCATTTTGG + Intronic
997138635 5:131353977-131353999 TGCCTCTAATCCCAGCATTTTGG + Intronic
997169379 5:131700240-131700262 TGCCTATAACCCCAGCATTTTGG - Intronic
997448168 5:133958314-133958336 TGCCTGTAATCCCAGCGTTTTGG + Intronic
997572992 5:134947351-134947373 TGGCTGTAACCCCAGCACTTTGG - Intronic
998466775 5:142352732-142352754 TGGCTGTAATCCCAGCATTTTGG - Intergenic
999471967 5:151863140-151863162 TGCCTGTAATCCCAGCATGTTGG + Intronic
999988778 5:157030403-157030425 TGCCTCTAATCCCAGCATTTTGG + Intronic
1000169506 5:158688022-158688044 TGGCTCTCACACCAGCTTCTAGG + Intergenic
1000764183 5:165265375-165265397 TGCCTGTAACCCCAGCGCTTTGG + Intergenic
1001142768 5:169159122-169159144 TGCCTGTAATCCCAGCGTTTTGG + Intronic
1001418345 5:171565198-171565220 TGCCTGTAATCCCAGCATGTTGG - Intergenic
1001454708 5:171851862-171851884 TGCCTGTAATCCCAGCGTTTTGG + Intergenic
1002111500 5:176917444-176917466 TGCCTGTAACCCCAGCTTCTCGG + Intronic
1002141777 5:177145961-177145983 TGCCTGTAATCCCAGCGTTTTGG + Intronic
1002206835 5:177568804-177568826 TGCCTGTAACCCCAGCATTTTGG + Intergenic
1002598417 5:180339252-180339274 TGCCTCTAACCCCAGCTACTCGG + Intronic
1002841190 6:908856-908878 TGGTTGTAACCCCACCGTTTTGG - Intergenic
1003184211 6:3816598-3816620 TGGCTGTAATCCCAGCATTTTGG + Intergenic
1003286867 6:4742098-4742120 TGCCTCTAACCCCAACATTTTGG + Intronic
1003313241 6:4987245-4987267 AGGCCCTAACCCCAGTGTGATGG - Intergenic
1003346992 6:5279115-5279137 TGCCTGTAACCCCAGCATTTTGG + Intronic
1003627363 6:7754367-7754389 TGCCTCTAATCCCAGCGCTTTGG - Intronic
1003890270 6:10557750-10557772 TGGCTATAATCCCAGCATTTTGG - Intronic
1004041352 6:11979870-11979892 TGGCTGTAATCCCAGCATTTCGG + Intergenic
1004220443 6:13742325-13742347 TGCCTGTAATCCCAGCGTTTTGG - Intergenic
1004272187 6:14205425-14205447 TGGCTCTAATCCCAGCACTTTGG - Intergenic
1004663639 6:17731621-17731643 TGCCTGTAATCCCAGCATGTTGG - Intergenic
1005076206 6:21910331-21910353 TGCCTGTAATCCCAGCGTTTTGG + Intergenic
1005450576 6:25967788-25967810 TGCCTCTAATCCCAGCATTTTGG - Intronic
1005648217 6:27862580-27862602 TGCCTGTAATCCCAGCCTGTTGG - Intronic
1006104560 6:31708798-31708820 TGCCTCTAACCCCAGCTACTCGG + Intronic
1006327278 6:33363995-33364017 TGCCTGTAACCCCAGCATTTTGG + Intergenic
1006420255 6:33929095-33929117 TGCCTGTAACCCCAGCGCTTTGG + Intergenic
1006485372 6:34336006-34336028 TGGCTGTAATCCCAGCATTTTGG + Intronic
1006722303 6:36164229-36164251 TGCCTGTAATCCCAGCGTTTTGG - Intergenic
1006777565 6:36607591-36607613 TGGCTGTAATCCCAAAGTGTTGG + Intergenic
1007150187 6:39682836-39682858 TGCCTGTAACCCCAGCATTTTGG - Intronic
1007771635 6:44196992-44197014 TGCCTGTAACCCCAGCATGTTGG + Intergenic
1007803026 6:44413843-44413865 TGCCTGTAATCCCAGCGTTTTGG - Intronic
1007936780 6:45739423-45739445 TGCCTATAACCCCAGCATTTTGG + Intergenic
1008092441 6:47307632-47307654 TGCCTGTAATCCCAGCGTTTTGG - Intronic
1008277250 6:49555864-49555886 TGCCTATAAGCCCAGCATGTTGG - Intronic
1008917090 6:56799883-56799905 TGCCTGTAATCCCAGCATGTTGG - Intronic
1009569328 6:65361739-65361761 TGCCTGTAATCCCAGCATGTTGG - Intronic
1010659317 6:78550479-78550501 TGCCTCTAACCCCAGCTACTCGG - Intergenic
1011049743 6:83131895-83131917 TGGCTGTAATCCCAGCATCTTGG - Intronic
1011202987 6:84858111-84858133 TGACTCTAACCCCACAATGTGGG - Intergenic
1011722069 6:90167617-90167639 TGCCTATAACCCCAGCATTTTGG - Intronic
1011910634 6:92433008-92433030 TGCCTCTAACCCCAGCACTTTGG - Intergenic
1011924853 6:92629305-92629327 TGCCTGTAACCCCAGCATTTTGG - Intergenic
1011989350 6:93493784-93493806 TTGCTGTAACCCCAGTGTCTAGG + Intergenic
1012086851 6:94837331-94837353 TGCCTCTAACCCCAGCACTTTGG - Intergenic
1012205398 6:96455174-96455196 TGGCTGTAATCCCAGCCTCTTGG - Intergenic
1012278676 6:97303028-97303050 TGGCTGTAATCCCAGCATTTTGG - Intergenic
1012328514 6:97955480-97955502 TGGCTGTAATCCCAGCATTTTGG + Intergenic
1012452756 6:99370607-99370629 TGCCTCTAATCCCAGCATTTTGG - Intronic
1012853737 6:104476564-104476586 TGGCTATAATCCCAGCGCTTTGG - Intergenic
1013035672 6:106379838-106379860 TGCCTGTAATCCCAGCATGTTGG - Intergenic
1013186989 6:107767998-107768020 TGCCTGTAACCCCAGCGCTTTGG + Intronic
1013434321 6:110086828-110086850 TGTCTGTAATCCCAGCATGTTGG - Intergenic
1013570970 6:111425196-111425218 TGCCTGTAATCCCAGCGTTTTGG + Intronic
1013818465 6:114127124-114127146 TGCCTGTAACCCCAGCATTTTGG + Intronic
1014458836 6:121670323-121670345 TGCCTCTAATCCCAGCATTTTGG + Intergenic
1015370658 6:132448572-132448594 TGCCTCTAATCCCAGCATTTTGG + Exonic
1015651188 6:135462638-135462660 TGCCTGTAACCCCAGCATTTTGG + Intronic
1015832885 6:137388783-137388805 TGCCTGTAATCCCAGCATGTTGG + Intergenic
1016255838 6:142104136-142104158 TGCCTCTAAACCCAGCATTTTGG - Intergenic
1016732143 6:147438660-147438682 TGACTCTAATCCCAGCTAGTCGG - Intergenic
1017504742 6:155057804-155057826 TGCCTGTAACCCCAGCATTTTGG - Intronic
1017796894 6:157852831-157852853 TGCCTGTAACCCCAGCATTTTGG - Intronic
1017897651 6:158694553-158694575 TGCCTGTAACCCCAGCATTTTGG - Intronic
1018007769 6:159639526-159639548 TGCCTGTAACCCCAGCATTTTGG + Intergenic
1018280407 6:162179472-162179494 TTCCTCTAACCCCAGTCTGTGGG + Intronic
1018489875 6:164280772-164280794 TGGTTGTAATCCCAGCATGTTGG + Intergenic
1019082417 6:169444046-169444068 TGGCTCTATTCCCAGGGTCTGGG + Intergenic
1019370188 7:658909-658931 TGTCTATAACCCCAGCATTTTGG - Intronic
1019376845 7:697317-697339 TGCCTGTAATCCCTGCGTGTAGG - Intronic
1019881573 7:3865756-3865778 TGCCTGTAATCCCAGCGTTTTGG - Intronic
1020059324 7:5140577-5140599 TGCCTTTAACCCCAGCATATTGG - Intergenic
1020798643 7:12706074-12706096 TGCCTGTAATCCCAGCATGTTGG - Intergenic
1021057546 7:16068401-16068423 TGGCTCTAAGCCTTGCCTGTTGG + Intergenic
1021683960 7:23163430-23163452 TGCCTCTAATCCCAGCATTTTGG - Intronic
1022219094 7:28294599-28294621 TGCCTGTAATCCCAGCATGTTGG + Intergenic
1022909951 7:34891219-34891241 TGCCTGTAATCCCAGCATGTTGG - Intergenic
1023086364 7:36573455-36573477 CGCCTGTAACCCCAGCGTTTTGG + Intronic
1023119190 7:36892361-36892383 TGGATCTAACCCAAGCTTGAGGG - Intronic
1023729200 7:43174099-43174121 TGCCTGTAATCCCAGCATGTAGG - Intronic
1024272354 7:47652040-47652062 TGCCTGTAACCCCAGCATTTTGG + Intergenic
1025163860 7:56692832-56692854 TGCCTATAATCCCAGCATGTTGG - Intergenic
1025273937 7:57556854-57556876 TGCCTCTAATCCCAGCATTTTGG - Intergenic
1025742451 7:64208515-64208537 TGCCTATAACCCAAGCCTGTTGG - Intronic
1025746375 7:64246461-64246483 TGGCTGTAACCCCAGCACTTTGG + Intronic
1025914618 7:65855701-65855723 TGCCTCTAATCCCAGCATTTTGG + Intergenic
1026238271 7:68548604-68548626 TGCCTATAACCCCAGCATTTTGG + Intergenic
1026804407 7:73420947-73420969 TGCCTGTAATCCCAGCATGTTGG + Intergenic
1026838042 7:73651154-73651176 TGCCTCTAACCCCAGCGCTTTGG + Intergenic
1026986253 7:74556882-74556904 TGCCTGTAACCCCAGCATTTTGG - Intronic
1027178371 7:75919650-75919672 TGCCTGTAATCCCAGCGTTTTGG - Intronic
1027418528 7:77997668-77997690 TGCCTGTAATCCCAGCATGTTGG - Intergenic
1027803760 7:82789443-82789465 TGCCTCTAATCCCAGCATTTTGG + Intronic
1027815697 7:82967433-82967455 TGTCTCTAATCCCAGCATTTTGG - Intronic
1028092981 7:86726241-86726263 TGGCCCTCACCCCAAAGTGTGGG + Intronic
1028260529 7:88658843-88658865 TGTCTGTAACCCCAGCATCTTGG + Intergenic
1028458945 7:91070055-91070077 TGGCTATAATCCCAGCATTTTGG - Intronic
1028705025 7:93832138-93832160 TGCCTCTAACCCCAGCTACTTGG + Intronic
1028846299 7:95484065-95484087 TGGCTGTAATCCCAGCGCTTTGG + Intronic
1028878518 7:95851788-95851810 TGCCTCTAAACCCAGCTAGTTGG - Intronic
1028919839 7:96298691-96298713 TGCCTGTAATCCCAGCGTTTTGG - Intronic
1029170375 7:98625883-98625905 TGCCTGTAATCCCAGTGTGTTGG + Intronic
1030178618 7:106681185-106681207 TGCCTGTAATCCCAACGTGTTGG - Intergenic
1030235925 7:107262149-107262171 TGCCTGTAATCCCAGCATGTTGG - Intronic
1030830907 7:114220127-114220149 TGGCTCTAATCCCAGCACTTTGG - Intronic
1031429877 7:121654242-121654264 TGCCTATAATCCCAGCGTTTGGG - Intergenic
1031541922 7:123005354-123005376 TGCCTGTAACCCCAGCTTGATGG - Intergenic
1032354266 7:131195248-131195270 TGGCTGTAATCCCAGCATTTTGG + Intronic
1033087505 7:138356103-138356125 TGCCTCTAACCCCAGCTACTTGG - Intergenic
1033201259 7:139372677-139372699 TGCCTATAATCCCAGCATGTTGG + Intronic
1033786138 7:144732963-144732985 TGGCTCTAATCCCAGCACTTTGG + Intronic
1033820976 7:145133749-145133771 TGCCTGTAACCCCAGCGTTTTGG - Intergenic
1034278198 7:149833470-149833492 TGCCTGTAACCCCAGCGCATTGG - Intergenic
1034508551 7:151516815-151516837 TGGCTCTACCCCCAGAATATAGG + Intronic
1035514805 8:223648-223670 TGCCTCTAACCCCAGCACTTTGG + Intergenic
1035760511 8:2065308-2065330 TGCCTGTAATCCCAGCATGTTGG + Intronic
1036017356 8:4800176-4800198 TGCCTATAACCCCAGCACGTTGG + Intronic
1037184556 8:16047180-16047202 TGGCTGTAACCTCAGCCTTTTGG + Intergenic
1037198984 8:16226485-16226507 TGCCTGTAACCCCAGCGTTTTGG - Intronic
1037553227 8:19995280-19995302 TGCCTCTAATCCCAGCTAGTTGG + Intergenic
1037841686 8:22249567-22249589 TGCCTCTAATCCCAGCGCTTTGG + Intronic
1038202846 8:25431089-25431111 TGCCTGTAACCCCAGCATTTTGG - Intronic
1038412787 8:27371152-27371174 TGCCTGTAATCCCAGCGTTTGGG - Intronic
1038469686 8:27803986-27804008 TGACTGTAATCCCAGCGTTTTGG - Exonic
1038661245 8:29498897-29498919 TGCCTGTAATCCCAGCGTTTTGG - Intergenic
1038732561 8:30140346-30140368 TGCCTGTAACCCCAGCATTTTGG - Intronic
1038795518 8:30706048-30706070 TGCCTGTAATCCCAGCATGTTGG + Intronic
1039693743 8:39888128-39888150 TGGCTGTAAGCCCAGCATTTTGG + Intergenic
1039694564 8:39896898-39896920 TGCCTGTAATCCCAGCATGTTGG - Intergenic
1040002735 8:42592878-42592900 TGCCTGTAATCCCAGCATGTTGG - Intergenic
1040584277 8:48725676-48725698 TGCCTCTAATCCCAGCTAGTCGG + Intronic
1041170682 8:55139273-55139295 TGCCTCTAATCCCAGCATTTTGG + Intronic
1042548486 8:69972237-69972259 TGCCTGTAATCCCAGCATGTTGG - Intergenic
1044978961 8:97695370-97695392 TGCCTCTAAACCCAGCATTTTGG - Intronic
1045284921 8:100782332-100782354 TACCTCTAATCCCAGCATGTTGG + Intergenic
1045542718 8:103101878-103101900 TGGCTGCAACCCCAGCATTTTGG - Intergenic
1045869356 8:106907545-106907567 TGGCTTTAACCCCAGCACTTTGG - Intergenic
1045913342 8:107436164-107436186 TGCCTCTAACCCCAGCACTTTGG - Intronic
1046198166 8:110890083-110890105 TGCCTGTAATCCCAGCATGTTGG - Intergenic
1046432855 8:114151532-114151554 TGCCTGTAATCCCAGCATGTGGG - Intergenic
1046980171 8:120328490-120328512 TGCCTGTAATCCCAGCATGTTGG - Intronic
1047006354 8:120624196-120624218 TGCCTGTAATCCCAGCATGTTGG - Intronic
1047379694 8:124348014-124348036 TGCCTGTAACCCCAGCTTCTCGG - Intronic
1049255135 8:141609656-141609678 TGGCTCTGAGTCCAGCGTGAGGG + Intergenic
1049590546 8:143458858-143458880 TGCCTGTAACCCCAGCATTTAGG + Intronic
1049721858 8:144120495-144120517 TGCCTGTAATCCCAGCATGTTGG - Intergenic
1049723895 8:144136474-144136496 TGCCTATAATCCCAGCGTTTTGG - Intergenic
1049992429 9:1002550-1002572 TGGCTGTAATCCCAGCATTTTGG - Intergenic
1050436825 9:5619901-5619923 TGGCTGTAATCCCAGCATTTTGG - Intergenic
1050558914 9:6813294-6813316 TGGCTATAATCCCAGCATTTTGG - Intronic
1051207081 9:14699299-14699321 TGCCTATAATCCCAGCATGTTGG - Intergenic
1051634099 9:19166029-19166051 TGCCTATAATCCCAGCATGTTGG - Intergenic
1051654713 9:19368387-19368409 TGGCTGTAATCCCAGCACGTTGG - Intronic
1052543030 9:29835563-29835585 TGCCTCTAATCCCAGCTAGTCGG - Intergenic
1052962759 9:34314424-34314446 TGCCTGTAACCCCAGCGCTTTGG - Intronic
1053442863 9:38130280-38130302 TGCCTGTAATCCCAGCATGTTGG + Intergenic
1053800541 9:41761266-41761288 TGTCTATAATCCCAGCATGTTGG - Intergenic
1054144651 9:61553569-61553591 TGTCTATAATCCCAGCATGTTGG + Intergenic
1054164999 9:61716191-61716213 CGCCTCTAATCCCAGCGTTTTGG + Intergenic
1054188972 9:61973418-61973440 TGTCTATAATCCCAGCATGTTGG - Intergenic
1054649546 9:67615199-67615221 TGTCTATAATCCCAGCATGTTGG + Intergenic
1054718348 9:68579852-68579874 TTGCCCTAACCCCAGTGTGATGG + Intergenic
1054911234 9:70457170-70457192 TGCCTATAATCCCAGTGTGTTGG + Intergenic
1055033083 9:71790231-71790253 TGGCTGTAACCCCAGCTACTCGG + Intronic
1055092959 9:72381235-72381257 TGCCTCTAATCCCAGCATTTTGG + Intergenic
1055224386 9:73976629-73976651 TGGCTGTAATCCCAGCGGCTTGG - Intergenic
1055276456 9:74622783-74622805 TGCCTGTAATCCCAGCATGTTGG - Intronic
1055336729 9:75239288-75239310 TGGCTCCAAGCCAAGCGTGAGGG + Intergenic
1056860266 9:90174835-90174857 TGCCTGTAATCCCAGCATGTTGG + Intergenic
1056868996 9:90259023-90259045 TGCCTCTAATCCCAGCGCTTTGG - Intergenic
1056962197 9:91135504-91135526 TGCCTGTAATCCCAGCATGTTGG + Intergenic
1057511940 9:95687712-95687734 TGCCTGTAATCCCAGCATGTTGG + Intergenic
1057575824 9:96241672-96241694 TGCCTGTAATCCCAGCATGTTGG + Intronic
1057625395 9:96671802-96671824 TGCCTGTAATCCCAGCATGTTGG - Intergenic
1057640029 9:96810691-96810713 TGCCTGTAATCCCAGCATGTTGG + Intergenic
1057665840 9:97044858-97044880 TGTCTCTAATCCCAGCGCTTTGG + Intergenic
1057771422 9:97971379-97971401 TGCCTCTAACCCCAGAGCTTTGG + Intergenic
1058062764 9:100515525-100515547 TGCCTGTAATCCCAGCGTTTTGG + Intronic
1058433606 9:104941164-104941186 TGCCTATAATCCCAGCATGTTGG - Intergenic
1058649374 9:107160438-107160460 TGCCTGTAACCCCAGCATTTTGG + Intergenic
1058708574 9:107658650-107658672 TGCCTATAATCCCAGCATGTTGG + Intergenic
1059159226 9:112018342-112018364 TGCCTATAACCCCAGCATTTTGG - Intergenic
1059319055 9:113452261-113452283 TGCCTGTAATCCCAGCATGTTGG - Intronic
1059361275 9:113743734-113743756 GGGCTCCAACCCCAGTGTGCAGG + Intergenic
1059758900 9:117319694-117319716 TGCCTGTAATCCCAGCATGTTGG - Intronic
1059949363 9:119445611-119445633 TGCCTGTAATCCCAGCATGTTGG - Intergenic
1060003409 9:119978813-119978835 TGGCTCTATCCCCACCATATTGG + Intergenic
1060174453 9:121487081-121487103 TGGCTCTTGCCCCAGGTTGTCGG + Intergenic
1060383586 9:123200839-123200861 TGCCTGTAATCCCAGCATGTTGG - Intronic
1060417909 9:123445608-123445630 TGCCTGTAATCCCAGCATGTTGG + Intronic
1060530421 9:124344402-124344424 TGGCGCTGACCCCAGCTAGTGGG + Intronic
1060568904 9:124619521-124619543 TGCCTGTAACCCCAGCGCTTTGG - Intronic
1060690212 9:125651090-125651112 TGCCTGTAACCCCAGCATGTTGG - Intronic
1060712033 9:125876715-125876737 TGCCTCTAACCCCTGCGTTAAGG + Intronic
1060904728 9:127294560-127294582 TGCCTGTAATCCCAGCATGTTGG - Intronic
1061103733 9:128512907-128512929 TGCCTGTAATCCCAGCATGTTGG - Intronic
1061224034 9:129270151-129270173 TGGCTCTAATCCCAGCAATTTGG - Intergenic
1061243720 9:129390315-129390337 TGCCTGTAACCCCAACATGTTGG + Intergenic
1061315618 9:129794067-129794089 TGCCTGTAATCCCAGCATGTTGG + Intergenic
1061467741 9:130795929-130795951 TGCCTCTAATCCCAGCATTTTGG + Intronic
1061756374 9:132815295-132815317 TGGCTGTAATCCCAGCTTTTTGG + Intronic
1062288037 9:135782076-135782098 TGGCTGTAACCCCAGCTACTTGG + Intronic
1062329885 9:136034831-136034853 TGCCTGTAACCCCAGCATTTTGG + Intronic
1185493037 X:533574-533596 TGTCTGTAATCCCAGCATGTTGG - Intergenic
1185613743 X:1407942-1407964 TGTCTTTAACCCCAGCATTTTGG + Intronic
1186320371 X:8417696-8417718 TGCCTGTAACCCCAGCATTTGGG + Intergenic
1186332008 X:8544653-8544675 TGCCTTCAACCCCAGCGTTTTGG + Intronic
1186806095 X:13141139-13141161 TGCCTGTAATCCCAGCGTTTTGG - Intergenic
1187085977 X:16044334-16044356 TGGCTGTAATCCCAGCATTTTGG + Intergenic
1187220487 X:17320998-17321020 TGCCTGTAATTCCAGCGTGTTGG - Intergenic
1187314121 X:18176416-18176438 TGTCTGTAACCCCAGTGTTTTGG + Intronic
1187402101 X:18969977-18969999 TGCCTCTAACCCCAGCACTTTGG + Intronic
1188225809 X:27595745-27595767 TGCCTGTAATCCCAGCATGTTGG + Intronic
1189748203 X:44191495-44191517 TGCCTGTAATCCCAGCATGTTGG - Intronic
1190195824 X:48317411-48317433 TGCCTGTAATCCCAGCATGTTGG - Intergenic
1190392616 X:49947080-49947102 TGCCTCTAATCCCAGCATTTTGG - Intronic
1190523355 X:51302832-51302854 TGCCTCTAATCCCAGCATTTTGG + Intergenic
1190662525 X:52667773-52667795 TGCCTGTAATCCCAGCATGTTGG - Intronic
1192332847 X:70191984-70192006 TGTCTGTAATCCCAGCATGTTGG + Intronic
1192416246 X:70983645-70983667 TGCCTGTAATCCCAGCATGTTGG + Intergenic
1192769183 X:74169324-74169346 TGCCTCTAACCCCAGCTACTTGG - Intergenic
1194140148 X:90198848-90198870 TGCCTCTAACCCCAGCACTTTGG + Intergenic
1196421198 X:115523560-115523582 TGCCTGTAATCCCAGCATGTTGG + Intergenic
1196421358 X:115525155-115525177 TGCCTGTAATCCCAGCATGTTGG - Intergenic
1196646810 X:118126957-118126979 TGCCTCTAATCCCAGCATTTTGG + Intergenic
1196832645 X:119788271-119788293 TGCCTGTAATCCCAGCATGTTGG + Intronic
1197455055 X:126669160-126669182 TGCCTGTAACCCCAGCATTTTGG - Intergenic
1197546335 X:127829310-127829332 TGCCTGTAATCCCAGCGTTTTGG - Intergenic
1199180811 X:144851672-144851694 TGCCTGTAACCCCAGCATTTTGG - Intergenic
1199396522 X:147344972-147344994 TGCCTGTAATCCCAGCGTTTTGG - Intergenic
1199730826 X:150630352-150630374 TGCCTGTAATCCCAGCATGTTGG - Intronic
1200204526 X:154306181-154306203 TGCCTCTAATCCCAGCTTTTCGG + Intronic
1200485893 Y:3767815-3767837 TGCCTCTAACCCCAGCACTTTGG + Intergenic
1200813464 Y:7507487-7507509 TGCCTATAATCCCAGCATGTTGG - Intergenic
1201268698 Y:12233649-12233671 TGCCTGTAATCCCAGCATGTTGG - Intergenic
1201285950 Y:12378878-12378900 TGGCTTTAATCCCAGCATTTTGG + Intergenic
1201309394 Y:12582146-12582168 TGCCTGTAACCCCAGGATGTTGG - Intergenic
1201738696 Y:17300469-17300491 TGCCTGTAACCCCAGCATTTTGG + Intergenic
1201848858 Y:18454064-18454086 TGGCTATAATCCCAGCTTTTCGG + Intergenic
1201884460 Y:18866311-18866333 TGGCTATAATCCCAGCTTTTCGG - Intergenic
1201890188 Y:18934964-18934986 TGCCTCTAATCCCAGCATTTTGG - Intergenic