ID: 925398804

View in Genome Browser
Species Human (GRCh38)
Location 2:3557371-3557393
Sequence GCCTTATGGTGCTGGTGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 134}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925398804_925398807 12 Left 925398804 2:3557371-3557393 CCAGCACACCAGCACCATAAGGC 0: 1
1: 0
2: 0
3: 12
4: 134
Right 925398807 2:3557406-3557428 CAAAGCATAACAAAATACTGCGG 0: 1
1: 0
2: 8
3: 51
4: 456

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925398804 Original CRISPR GCCTTATGGTGCTGGTGTGC TGG (reversed) Intronic
901066822 1:6498193-6498215 GCCTCCTGGTGCCAGTGTGCAGG - Intronic
901173177 1:7279109-7279131 GCCTGAGGGGGCTGGTGAGCAGG + Intronic
901617482 1:10553291-10553313 GGCTTAGGGAGCTGGTGTGGAGG + Intronic
901696094 1:11009346-11009368 GCCTCATGGAGCTGATGAGCTGG + Intergenic
904832084 1:33311848-33311870 GCTCTATGGTGTTGGTGTCCAGG + Intronic
906115790 1:43356260-43356282 GGCTTCTGGTGGTGGTTTGCCGG - Intergenic
907850117 1:58248177-58248199 GCCTGGTGATACTGGTGTGCAGG - Intronic
907883041 1:58569190-58569212 TCTTTCTGGTCCTGGTGTGCTGG + Intergenic
910714206 1:90212986-90213008 TTCTTATGGTGTTGGTGTGCTGG + Intergenic
915743377 1:158137311-158137333 GCCTTATGGTTCTGGAGATCAGG - Intergenic
916120719 1:161525771-161525793 GGCCTATGGGGCTGCTGTGCAGG + Exonic
916130486 1:161607404-161607426 GGCCTATGGGGCTGCTGTGCAGG + Intronic
918357828 1:183722788-183722810 GCCTTGTACTGCAGGTGTGCTGG - Intronic
919881928 1:201906573-201906595 GCCTTACAGGGCTGGTGTGCAGG + Intronic
920031761 1:203041738-203041760 GCCTTTTGGTGGTGGTGTCATGG + Intronic
920742307 1:208592897-208592919 TCCTTATAGTGCTAGTGTGAAGG + Intergenic
922676035 1:227550612-227550634 GCCCTCTGTTGCTGGTATGCTGG - Intergenic
1062820571 10:531630-531652 GCCCTATGGTGTGGGTTTGCCGG - Intronic
1066048835 10:31617582-31617604 GCCTCTTGGAGCTGGTGTGGGGG - Intergenic
1069911115 10:71760533-71760555 GCCATAGGGGGCTGGTGGGCAGG + Intronic
1070481070 10:76883195-76883217 GCCTTATGATGCTGCTGTGTTGG - Intronic
1071599269 10:86949391-86949413 GCATGATGGTGTTGATGTGCAGG - Intronic
1077527314 11:3074990-3075012 GCCTTTAGGGCCTGGTGTGCGGG + Intergenic
1078086876 11:8239223-8239245 GCCAGATGGTGCTGGGGTGGGGG + Intronic
1079034980 11:17013701-17013723 GGATTCGGGTGCTGGTGTGCGGG - Intronic
1079309216 11:19349648-19349670 TCCTGATGGTGCTGGTGTTGGGG + Intergenic
1081993338 11:47349207-47349229 GCCTTAAGGTTCTGGTGGGCAGG + Intronic
1083966629 11:66047590-66047612 GCCTTCAGGGGCTGGTGTCCAGG - Intronic
1085040643 11:73324445-73324467 GCCCTATGTTGCTGCTGTCCTGG + Intronic
1089180211 11:116578448-116578470 GCCTTATGGGGCTGGGGGGCAGG - Intergenic
1089690050 11:120181546-120181568 GCCTTGTCGTGCTGATGTGGTGG - Intronic
1091397234 12:161528-161550 TCCTTATGATGCTGGAGTGGTGG + Intronic
1094715580 12:33011766-33011788 TCCTTGTGGAGCTGGAGTGCAGG + Intergenic
1095376542 12:41535843-41535865 GCCTCATGGTTCTGGAGGGCTGG - Intronic
1098172300 12:67759202-67759224 GCCTCATGGAGCTGGTATTCTGG + Intergenic
1100357109 12:93841845-93841867 GTCATATGCTGCAGGTGTGCGGG - Intronic
1112109227 13:96276123-96276145 GCCCTTTGTTGCTGGTGTGGAGG + Intronic
1113457807 13:110461406-110461428 GCCCAATGGTGCAGATGTGCAGG - Intronic
1121410661 14:93746308-93746330 GGCTGAGGGTGCTGGGGTGCAGG + Intronic
1121866945 14:97371294-97371316 GCGTTTTGGTTCTGGTTTGCAGG - Intergenic
1122904896 14:104797118-104797140 GGCTCATGGTGCAGGTTTGCTGG - Intergenic
1127373832 15:58363790-58363812 CCCTTCTGCTGCTGGTCTGCTGG - Intronic
1127546783 15:60000030-60000052 GCCTTGCGGTGCTGGGGGGCTGG + Intergenic
1129375361 15:75126830-75126852 GCTTTATGGTGCAGGGGTGAAGG + Intergenic
1130028120 15:80287093-80287115 GGCTTAAGGTGCTGGTGCACAGG + Intergenic
1131058808 15:89391898-89391920 TCCTTGTGGTGCTGGGGGGCGGG + Intergenic
1131807473 15:96137549-96137571 GCTCTATTGTGCTGGAGTGCAGG + Intergenic
1141431173 16:83970794-83970816 GCTTTAAAGTGCTGGTGGGCAGG + Intronic
1141449079 16:84085071-84085093 CACCTATGGTGCTGGCGTGCGGG - Exonic
1142848338 17:2692601-2692623 ACCTCATGCTGCTGGTGTTCGGG - Exonic
1143975344 17:10825325-10825347 GACTCATGATGCTGGTGTGCGGG - Exonic
1144005292 17:11094172-11094194 TCCTTATGGTGCTGGTACACAGG - Intergenic
1149299057 17:55287453-55287475 GCCTTATGGTGTTGTTATGCTGG - Intronic
1151573269 17:74937858-74937880 GCCTTCTGGTGCTACTTTGCTGG - Intronic
1151879052 17:76883949-76883971 GCCTGCTGGTGCTGGGCTGCTGG + Intronic
1152580154 17:81162243-81162265 CCCTTAGGCTGCAGGTGTGCAGG - Intronic
1154154971 18:11936851-11936873 GTCTTAGGGTGCTTGGGTGCCGG - Intergenic
1154412592 18:14149366-14149388 ACCCTATGGTCCTGGGGTGCAGG + Intergenic
1159988765 18:74877139-74877161 GGCCTTCGGTGCTGGTGTGCGGG + Intronic
1163338606 19:16689694-16689716 GCCTTGTGCTGCTGCTGGGCGGG + Exonic
1163389467 19:17021656-17021678 GTCTAATGGTTCAGGTGTGCTGG + Intronic
1167114981 19:47483905-47483927 GCGCTATGGTGCTGGGGGGCGGG - Intronic
925270886 2:2606600-2606622 GGCTCATGGTTCTGCTGTGCAGG - Intergenic
925398804 2:3557371-3557393 GCCTTATGGTGCTGGTGTGCTGG - Intronic
926311433 2:11678688-11678710 TCCTTCTGGGGCTGGTGTCCAGG + Intronic
928461597 2:31478627-31478649 GCCTTATGGTGTTGGGATGAGGG - Intergenic
928500133 2:31882713-31882735 GCCTTATGATGACAGTGTGCAGG - Intronic
931153435 2:59600579-59600601 AGCTTTTGGTGCTGATGTGCTGG - Intergenic
937345686 2:121124020-121124042 GCCTTATCGTGCTGTGCTGCAGG + Intergenic
938927177 2:136054824-136054846 GCCTTCTTGTGCTGGTTTACAGG - Intergenic
941284662 2:163594635-163594657 GCCTGAAGCTGCTGGTGTGAGGG - Intronic
941818511 2:169822759-169822781 AGCTTATGGTGCTTGTGTTCTGG - Intronic
941990747 2:171554580-171554602 GCCTTCTGATCCTGGTGTTCGGG + Exonic
944474053 2:200085757-200085779 CCCCTGTGGTGCTGGTGTACAGG + Intergenic
947616071 2:231557619-231557641 GCCTCAGGGTGCTTGTGTGAGGG - Intergenic
948109761 2:235445185-235445207 GCCTTAAGCTGCTGGGGGGCAGG - Intergenic
948364843 2:237448254-237448276 GTCTTCTGGAGCTGGGGTGCAGG - Intergenic
948366314 2:237457246-237457268 GCCTTATGTTGCTGTTGTGGGGG + Intergenic
1168775070 20:440449-440471 GCCTTATAGCGCTGGTGAGAAGG + Intronic
1169909706 20:10637348-10637370 GCCTTGGAGTGCTGGTGTTCTGG - Intergenic
1174572135 20:51509323-51509345 GCCCTGTGGAGCTGATGTGCTGG - Intronic
1176860413 21:14008889-14008911 ACCCTATGGTCCTGGGGTGCGGG - Intergenic
1177415998 21:20794236-20794258 GCCAGATGTTGCTGGTGTTCAGG + Intergenic
1181045523 22:20212353-20212375 ACTTTGTGTTGCTGGTGTGCAGG + Intergenic
1182429612 22:30292062-30292084 GGGTTAGGGTGCTGGTGTGAGGG - Exonic
950368946 3:12511023-12511045 GCCTTTGTGTGCTGGTGGGCAGG + Intronic
953460172 3:43075957-43075979 GCTTTATGCTGCTGCTGTGGTGG + Intergenic
953466863 3:43129557-43129579 GCCTCAGGGTGCTGCTGTTCTGG + Intergenic
953546772 3:43869315-43869337 GCATCATGGTGGTGGAGTGCAGG - Intergenic
962983377 3:140510622-140510644 GACTCAGGGTGCTGGAGTGCAGG - Intronic
966855881 3:184193571-184193593 GCTTTATCAGGCTGGTGTGCCGG + Exonic
968278474 3:197458392-197458414 GCCTTAGGGTGCCTGTGTGCAGG - Intergenic
968278480 3:197458443-197458465 GCCTTAGGGTGCCCGTGTGCAGG - Intergenic
968393407 4:211699-211721 GCTCTTTGGTGCTGGTGTGGTGG - Intergenic
969615917 4:8252527-8252549 GCCTGAGGGAGCTGGTCTGCGGG + Intergenic
971276837 4:25206303-25206325 ACCATATGGTGCTGATGTGTCGG - Intronic
977473709 4:97475870-97475892 GCCTGATGGTGGTGGTTGGCTGG - Intronic
977632879 4:99263068-99263090 GCCCTCTGGTGCAGGTCTGCTGG + Intergenic
978405894 4:108378309-108378331 ACCTTGTGGGGCTGCTGTGCAGG + Intergenic
982419852 4:155182198-155182220 TCCTTTTGGTGGTGGTGTGAGGG - Intergenic
984906584 4:184633285-184633307 GGCTTCTGGTGCTGATGTGTTGG + Intronic
985522666 5:385133-385155 TTCTTATGGTGCAGGTCTGCTGG + Intronic
986767186 5:10938837-10938859 GCTTTGGGGTGCTGGTGTGGGGG + Intergenic
987392205 5:17386937-17386959 GCCTCATTCTGTTGGTGTGCGGG + Intergenic
992606739 5:78465200-78465222 GCCTTATGGTGCATGTATTCTGG + Intronic
995042480 5:107604974-107604996 TCTTTAGGCTGCTGGTGTGCAGG - Intronic
999500482 5:152142077-152142099 GCCTTATGTTGCTGTTTTCCTGG + Intergenic
999913192 5:156228830-156228852 TCCTTATAGTGGTGGTGTGATGG + Intronic
1000204784 5:159048441-159048463 GTCCCAGGGTGCTGGTGTGCAGG - Intronic
1001725083 5:173889821-173889843 GCATTTTGGTGATGGTGTGGAGG - Exonic
1002687375 5:181024334-181024356 GGATTCTGGTGCTGGGGTGCTGG - Intergenic
1002796077 6:471854-471876 GGGCTATGGTGCTGCTGTGCAGG + Intergenic
1006143337 6:31944005-31944027 GACTTATGGTGCTTGAGAGCTGG + Intronic
1012732776 6:102902811-102902833 GCTTTATCATGCTGGTGTGAGGG - Intergenic
1014725154 6:124963314-124963336 CCCTCATGGTGCTGATGTGCCGG + Exonic
1017517093 6:155166182-155166204 GCCCTTTGGTGCTGGTGAACAGG - Intronic
1017912733 6:158808217-158808239 GCCTTAAAGTGCTTGTGGGCTGG - Intronic
1019760697 7:2810380-2810402 CCCTTAAGGTGCTGGTGTTAGGG - Intronic
1022788793 7:33665675-33665697 CCCATATGGCGCTGGTGTGTGGG + Intergenic
1023673962 7:42610961-42610983 GTGTTTTGGTGCTGGTGTGCTGG - Intergenic
1026779888 7:73258683-73258705 GCCTTATGGGTCAGGTGTGGCGG + Intergenic
1027020742 7:74812101-74812123 GCCTTATGGGTCAGGTGTGGCGG + Intronic
1027067283 7:75133829-75133851 GCCTTATGGGTCAGGTGTGGCGG - Intronic
1032248664 7:130234145-130234167 TCCTTAAGGTAGTGGTGTGCTGG + Intergenic
1032802927 7:135330879-135330901 TCCTTACAGTGGTGGTGTGCTGG + Intergenic
1034157022 7:148964396-148964418 GCCTTGTGCTGCTGGTGAGAGGG + Intergenic
1043818345 8:84831492-84831514 TCCTTAAGATGCTGGTGTTCAGG - Intronic
1044714512 8:95088249-95088271 GCCCTAGAGTCCTGGTGTGCTGG + Intronic
1047046632 8:121060925-121060947 TCATTATGGTGGTGGTGTACAGG + Intergenic
1049830747 8:144699565-144699587 GGCTTAGGGGGCTGGTGGGCTGG + Intergenic
1056846129 9:90039718-90039740 GCCTCATGGTGTGGGTGTGAAGG - Intergenic
1057212164 9:93206262-93206284 GCCCTCTGGTGCTGGTGGACAGG + Intronic
1060349890 9:122851129-122851151 TCCTTTTGGTGCTGCTGTACTGG + Exonic
1061676348 9:132218139-132218161 CCCCCATGGTGCTGGTGGGCAGG - Intronic
1188032321 X:25277732-25277754 GCAGAATGCTGCTGGTGTGCTGG + Intergenic
1188106396 X:26152477-26152499 GGAGAATGGTGCTGGTGTGCAGG + Intergenic
1189023865 X:37370915-37370937 GCAGTTTGGTGCTGGCGTGCAGG + Intronic
1190157140 X:48003544-48003566 GCCTTCGGGTGCGGGGGTGCAGG + Exonic
1190413059 X:50156154-50156176 TCCCTATGGTGTCGGTGTGCAGG + Intergenic
1194285742 X:92007987-92008009 GCCTTATCCTGCTGTGGTGCAGG + Intronic
1195937253 X:110137557-110137579 TCCTTTTGGTGGTTGTGTGCAGG - Intronic
1198651990 X:138873209-138873231 GCCTTATAGTGCAGGTCTCCTGG - Intronic
1199717444 X:150516561-150516583 ACACTATGGTGCTGGGGTGCTGG - Intergenic
1201784517 Y:17759487-17759509 ACCTTATGGTAATGCTGTGCAGG + Intergenic
1201817036 Y:18146500-18146522 ACCTTATGGTAATGCTGTGCAGG - Intergenic
1201850847 Y:18478294-18478316 CCCTTCTGCTGCAGGTGTGCTGG + Intergenic
1201882471 Y:18842083-18842105 CCCTTCTGCTGCAGGTGTGCTGG - Intergenic