ID: 925398915

View in Genome Browser
Species Human (GRCh38)
Location 2:3558086-3558108
Sequence CGACCCCGATGCCGGCAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 53}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925398907_925398915 -5 Left 925398907 2:3558068-3558090 CCGGGCTCCGGCCTCCCTCGACC 0: 1
1: 0
2: 3
3: 28
4: 317
Right 925398915 2:3558086-3558108 CGACCCCGATGCCGGCAGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 53
925398904_925398915 8 Left 925398904 2:3558055-3558077 CCGCCGGGGTTAGCCGGGCTCCG 0: 1
1: 0
2: 0
3: 3
4: 66
Right 925398915 2:3558086-3558108 CGACCCCGATGCCGGCAGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 53
925398897_925398915 22 Left 925398897 2:3558041-3558063 CCGCCAGGCTCCCGCCGCCGGGG 0: 1
1: 0
2: 2
3: 29
4: 254
Right 925398915 2:3558086-3558108 CGACCCCGATGCCGGCAGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 53
925398902_925398915 12 Left 925398902 2:3558051-3558073 CCCGCCGCCGGGGTTAGCCGGGC 0: 1
1: 0
2: 0
3: 15
4: 75
Right 925398915 2:3558086-3558108 CGACCCCGATGCCGGCAGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 53
925398903_925398915 11 Left 925398903 2:3558052-3558074 CCGCCGCCGGGGTTAGCCGGGCT 0: 1
1: 0
2: 0
3: 3
4: 49
Right 925398915 2:3558086-3558108 CGACCCCGATGCCGGCAGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 53
925398906_925398915 5 Left 925398906 2:3558058-3558080 CCGGGGTTAGCCGGGCTCCGGCC 0: 1
1: 0
2: 1
3: 15
4: 95
Right 925398915 2:3558086-3558108 CGACCCCGATGCCGGCAGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 53
925398899_925398915 19 Left 925398899 2:3558044-3558066 CCAGGCTCCCGCCGCCGGGGTTA 0: 1
1: 0
2: 0
3: 19
4: 85
Right 925398915 2:3558086-3558108 CGACCCCGATGCCGGCAGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925398915 Original CRISPR CGACCCCGATGCCGGCAGGG AGG Intronic
900387213 1:2416181-2416203 GGACCCCGAGGAGGGCAGGGTGG + Intergenic
900569868 1:3352952-3352974 GGGCCCCGAAGCCTGCAGGGTGG - Intronic
900594243 1:3473240-3473262 CGGCCCCGAGGCCCGCAGGGTGG + Intronic
900645555 1:3707189-3707211 AGACCCCGATGCCGCCCGGAGGG + Intronic
918114327 1:181483827-181483849 CTGCCCCGAGGCCGGCACGGGGG - Exonic
919650844 1:200147770-200147792 CGGCACGGATGCCGGCACGGTGG + Intronic
1067081724 10:43216175-43216197 CGCCCCCGCTCCTGGCAGGGTGG - Intronic
1073076464 10:100827959-100827981 CGCGCCCGAGTCCGGCAGGGTGG - Exonic
1077098429 11:809973-809995 CGACCTCGGTGGCGACAGGGAGG - Exonic
1077486207 11:2839446-2839468 CAACCCAGATGCAGGGAGGGAGG + Intronic
1088709235 11:112491745-112491767 AAACCCCGATGGAGGCAGGGTGG + Intergenic
1097198210 12:57256236-57256258 CGACCCCCATGCCAAGAGGGAGG - Intronic
1102952624 12:117040674-117040696 CCACCCCGGGGCTGGCAGGGCGG - Intronic
1103085718 12:118060942-118060964 CGACCCCGGGGCGGGCTGGGCGG - Intronic
1104702651 12:130918720-130918742 CCAGCCCGATGCCTGCAAGGTGG - Intergenic
1111013736 13:82348709-82348731 CCACCCAGAGGCCGGCACGGTGG + Intergenic
1129810717 15:78507710-78507732 CGACCCCGACTCCCGCAGCGGGG - Intronic
1132518803 16:378058-378080 AGACCCAGATGCCAGGAGGGTGG - Intronic
1132931155 16:2459913-2459935 GGCCCCCGAGGCCGCCAGGGAGG - Intergenic
1133040730 16:3058745-3058767 GGACCCCCATCCCCGCAGGGTGG - Intronic
1136403419 16:30030501-30030523 TGACCCCGATGGTGGCCGGGGGG - Exonic
1136546597 16:30958225-30958247 CGACCCCGAATCCGGGCGGGGGG - Intronic
1140470674 16:75212509-75212531 AGACGCCAAGGCCGGCAGGGTGG + Intergenic
1141696692 16:85623625-85623647 GGACCCCGGTGCCTGCAGGCAGG + Intronic
1147891490 17:43720643-43720665 CGCCCCCGCTGCCGCCAGAGAGG + Intergenic
1151550538 17:74820168-74820190 TGACCCAGAGGCTGGCAGGGGGG + Intronic
1152656823 17:81523711-81523733 CTCCTCCGATGCCTGCAGGGAGG + Intronic
1155799412 18:30081899-30081921 CGACCCTGCTGCTGGGAGGGAGG + Intergenic
1160928783 19:1559991-1560013 CCAACCCGATGCAGTCAGGGTGG - Intronic
1161299418 19:3535720-3535742 CGTCCCCCATGCCTGCTGGGTGG + Intronic
1162420906 19:10565636-10565658 CGACCCCGATGTAGACGGGGGGG - Intronic
1166753732 19:45178134-45178156 CGACCCCGACCCCGGCCCGGGGG - Exonic
1167338503 19:48900990-48901012 AGACCCCGGTGCCCGTAGGGCGG + Intronic
925398915 2:3558086-3558108 CGACCCCGATGCCGGCAGGGAGG + Intronic
930662077 2:54064311-54064333 CGACCCAGATACTGGCTGGGTGG - Intronic
936530753 2:113275918-113275940 CGACCCCGTGGCAGGCTGGGCGG + Intronic
1172394161 20:34587653-34587675 GGTTACCGATGCCGGCAGGGTGG - Intronic
1176187632 20:63789843-63789865 CCACCCCGACGTCGGCAGGAAGG + Exonic
1180039169 21:45267060-45267082 CGTCCCCGAGGCCGGGAGCGTGG - Intronic
1180039198 21:45267178-45267200 CGTCCCCGAGGCCGGGAGCGTGG - Intronic
955674585 3:61435040-61435062 CGACCCCGACCCCGTCTGGGAGG - Intergenic
972503351 4:39697994-39698016 GGCCCCAGACGCCGGCAGGGCGG + Intergenic
981093603 4:140756833-140756855 CGACGCCCATCCCAGCAGGGAGG + Intergenic
984888804 4:184473688-184473710 CGACCCCGAGCCCGGCAGGCAGG + Intronic
985713932 5:1445487-1445509 CGACCCCGTCGGCGGGAGGGCGG - Intergenic
990347470 5:54884193-54884215 CGACCCGGAGCCCGGCAAGGGGG + Intergenic
1002064392 5:176644826-176644848 AGACCCCAATGCAGGCAAGGGGG - Intronic
1024093868 7:45969052-45969074 CTTCCTCGAGGCCGGCAGGGCGG + Intergenic
1024547150 7:50531696-50531718 CCACCCCGATGCCACCAGGGTGG + Intronic
1026522985 7:71132421-71132443 GGACTCCGAGGCCGGCAGGCGGG - Exonic
1037363657 8:18099922-18099944 AGACTAGGATGCCGGCAGGGAGG - Intergenic
1038423851 8:27451950-27451972 AGACCCTGTTGCAGGCAGGGAGG + Intronic
1041040641 8:53843059-53843081 CGCACCCAAAGCCGGCAGGGAGG + Exonic
1049600936 8:143507224-143507246 TGACCTCGATGCAGGCTGGGAGG - Intronic
1061163422 9:128909261-128909283 GGAGGCCGATGTCGGCAGGGAGG - Exonic
1062636808 9:137495808-137495830 CAGGCCGGATGCCGGCAGGGAGG - Intronic
1192166341 X:68829621-68829643 CGACACCGAAGCCGGCGGGAGGG + Exonic