ID: 925399018

View in Genome Browser
Species Human (GRCh38)
Location 2:3558505-3558527
Sequence TCCCGAAGGCGGGCGAGGTC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 76}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925399009_925399018 14 Left 925399009 2:3558468-3558490 CCTGTCGGTACTTGAAGAAGCGG 0: 1
1: 0
2: 0
3: 0
4: 21
Right 925399018 2:3558505-3558527 TCCCGAAGGCGGGCGAGGTCTGG 0: 1
1: 0
2: 0
3: 1
4: 76
925399007_925399018 30 Left 925399007 2:3558452-3558474 CCGAACTCGTCAACTTCCTGTCG 0: 1
1: 0
2: 0
3: 6
4: 35
Right 925399018 2:3558505-3558527 TCCCGAAGGCGGGCGAGGTCTGG 0: 1
1: 0
2: 0
3: 1
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925399018 Original CRISPR TCCCGAAGGCGGGCGAGGTC TGG Exonic
900206300 1:1433307-1433329 TCCCAAAGGCGGGTGGGGGCAGG + Intergenic
902387440 1:16083783-16083805 TCTCGAAGGCAGGTGAGGCCTGG - Intergenic
902723479 1:18320301-18320323 TGCTGAAGGCGGGGAAGGTCAGG - Intronic
904625225 1:31798593-31798615 TCCCGAAGGCTGTGGAGGCCAGG + Exonic
905802037 1:40850547-40850569 TCCCAAAGGAGGGCGTGGTCAGG - Intergenic
906145201 1:43556487-43556509 AGGCCAAGGCGGGCGAGGTCAGG - Intronic
915357351 1:155263267-155263289 GCCCGAAGGCGGGCGAAGAAAGG + Exonic
915463222 1:156081813-156081835 CCCCCACGGCGGGCGAGGACGGG - Exonic
921060363 1:211579414-211579436 TCCCGGAGCCGGGCGTGGGCCGG + Intergenic
1067286086 10:44908563-44908585 CCCCGGAGGAGGGGGAGGTCTGG - Intergenic
1069982297 10:72260934-72260956 TCCCGAGGGTGGGCGGGGCCAGG + Intergenic
1073426465 10:103458282-103458304 GCCAGCAGGCGGGCGAGCTCGGG + Exonic
1074772489 10:116742770-116742792 TCCCGAAGCCGGGAGAGGAGAGG - Intergenic
1077609146 11:3633624-3633646 TCCCCAAGGCAGACGAGCTCTGG - Intergenic
1080852731 11:36084330-36084352 TTCTGAAGCCGGGCGAGGTGGGG + Intronic
1083458099 11:62792316-62792338 TCCAGAAGGCAGGCGAGGAGAGG + Exonic
1084334541 11:68448992-68449014 TCTCGGTGGCGGGCGAGGGCGGG - Exonic
1091973929 12:4810124-4810146 TCCCGGAGGCCGGCGGGGGCGGG + Exonic
1101870573 12:108562433-108562455 TCTCGGGGGCGGGCGGGGTCGGG - Intergenic
1102674401 12:114647027-114647049 TCCCTCTGGCGGGCCAGGTCTGG - Intergenic
1121052922 14:90831120-90831142 TCCAGAAGGCGGGCAGGGGCTGG + Intergenic
1122873312 14:104651209-104651231 TCCAGAAGGAGGGCGTGGACGGG + Intergenic
1132831209 16:1929421-1929443 CCCTGAGGGCGGGCCAGGTCCGG + Intergenic
1137617947 16:49858010-49858032 CCCGGGAGGGGGGCGAGGTCGGG - Intergenic
1139606633 16:68023383-68023405 TCCCCAAGGCTGGCCGGGTCTGG - Exonic
1141083764 16:81076978-81077000 TCCCCAGAGCGGGCGGGGTCTGG - Intronic
1141707864 16:85678630-85678652 TCCCGAAGGCAGACGAAATCCGG - Exonic
1148550992 17:48550744-48550766 TACCGAAGGCGGGTGGGGACGGG + Exonic
1160909701 19:1468932-1468954 GCTGGGAGGCGGGCGAGGTCTGG - Exonic
1162531042 19:11236699-11236721 TGCCGATGGCCGGGGAGGTCTGG - Intronic
1168064928 19:53913867-53913889 TCCCTAAAGAGGACGAGGTCTGG - Intronic
925399018 2:3558505-3558527 TCCCGAAGGCGGGCGAGGTCTGG + Exonic
927561306 2:24076274-24076296 CCCCGAAGCCGAGCGAGCTCCGG - Exonic
938909877 2:135876219-135876241 CTCCGGAGGCGGGCGAGGCCCGG + Intronic
941003674 2:160226045-160226067 TCCCGCAGGCTGGTGAGGCCTGG - Intronic
1171233285 20:23504849-23504871 TCCCCAAAGCTGGGGAGGTCAGG + Intergenic
1172935169 20:38615128-38615150 TCCCGAAGGCAGACGAAATCCGG - Intronic
1174506980 20:51023221-51023243 TCCCGAAGCGAGGCGAGGCCAGG - Intergenic
1174803086 20:53581541-53581563 TCCAGAGGGGCGGCGAGGTCAGG + Exonic
1179657060 21:42852099-42852121 TCCAGAAGGCGGGGCAGGGCAGG - Intronic
1182410380 22:30180396-30180418 TCCTGAAGGCTGGTGAAGTCTGG + Intergenic
950660915 3:14466621-14466643 TCCTCAAGGCGGGTGATGTCAGG - Exonic
961827573 3:129606866-129606888 TCCCGGGGGCGGGCGGGGCCGGG - Intergenic
962885022 3:139616570-139616592 TCCTGAAGGAGGGCCAGATCTGG - Intronic
973754756 4:54064154-54064176 GCCCGGAGGAGGGCGAGGGCGGG - Intronic
977666815 4:99652752-99652774 TCCGGAAGGCCCGGGAGGTCAGG + Exonic
981727663 4:147864296-147864318 TCTCAAAGGCGGGCCAGGGCTGG - Intronic
985512112 5:318784-318806 TCCCACAGGCAGGCCAGGTCAGG - Intronic
985604343 5:850428-850450 TCCCGAAGGTGGCCGAGGAAAGG + Exonic
985717511 5:1470947-1470969 TGCCGAAGGCGGCCGAGCTGTGG - Intronic
1001444870 5:171775338-171775360 GCCCGAAGGAGGGGGAGGTGGGG - Intergenic
1002522733 5:179800514-179800536 TCTCGGAGGCGGGAGAAGTCAGG + Exonic
1019611643 7:1939819-1939841 CCCCGAAGGACGGCGAGGCCTGG + Intronic
1035376499 7:158410301-158410323 TCCCGAAGGCAGGAGATGTGGGG + Intronic
1037890297 8:22620566-22620588 TCCAGAAGGTGGGCCAGGGCCGG + Exonic
1045305112 8:100951589-100951611 TCCCGAAGGTGGACGAGGCATGG - Intronic
1045459354 8:102412592-102412614 TCCCGGCGGCGGACGGGGTCCGG + Exonic
1050694513 9:8263524-8263546 TCCCAAAGGCCAGAGAGGTCTGG + Intergenic
1051338046 9:16084815-16084837 TCCAGAAGGCCGGTGAGGTAAGG + Intergenic
1186897393 X:14017646-14017668 TCCAGAAGGTGGGAGAGGCCTGG - Intronic
1196442426 X:115728711-115728733 TCCCGCAGGTGGGCCAGGGCTGG - Intergenic
1196443131 X:115732193-115732215 TCCCGCAGGTGGGCCAGGGCTGG + Intergenic
1196445452 X:115844108-115844130 TCCCGCAGGTGGGCCAGGGCTGG + Intergenic
1196446123 X:115847089-115847111 TCCCGCAGGTGGGCCAGGGCTGG + Intergenic
1196446794 X:115850070-115850092 TCCCGCAGGTGGGCCAGGGCTGG + Intergenic
1196447462 X:115853053-115853075 TCCCGCAGGTGGGCCAGGGCTGG + Intergenic
1196448133 X:115856032-115856054 TCCCGCAGGTGGGCCAGGGCTGG + Intergenic
1196448802 X:115859023-115859045 TCCCGCAGGTGGGCCAGGGCTGG + Intergenic
1196449473 X:115862014-115862036 TCCCGCAGGTGGGCCAGGGCTGG + Intergenic
1196450142 X:115864997-115865019 TCCCGCAGGTGGGCCAGGGCTGG + Intergenic
1196450812 X:115867982-115868004 TCCCGCAGGTGGGCCAGGGCTGG + Intergenic
1196451483 X:115870961-115870983 TCCCGCAGGTGGGCCAGGGCTGG + Intergenic
1196452154 X:115873948-115873970 TCCCGCAGGTGGGCCAGGGCTGG + Intergenic
1196452824 X:115876917-115876939 TCCCGCAGGTGGGCCAGGGCTGG + Intergenic
1196453494 X:115879910-115879932 TCCCGCAGGTGGGCCAGGGCTGG + Intergenic
1196454163 X:115882919-115882941 TCCCGCAGGTGGGCCAGGGCTGG + Intergenic
1196454830 X:115885908-115885930 TCCCGCAGGTGGGCCAGGGCTGG + Intergenic
1196455244 X:115887990-115888012 TCCCGCAGGTGGGCCAGGGCTGG + Intergenic