ID: 925404034

View in Genome Browser
Species Human (GRCh38)
Location 2:3594488-3594510
Sequence CCGAATCTTGCATGTTTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 80}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925404034_925404044 27 Left 925404034 2:3594488-3594510 CCCCCAAAACATGCAAGATTCGG 0: 1
1: 0
2: 0
3: 8
4: 80
Right 925404044 2:3594538-3594560 CCCTGACTAACATTTGTTTCTGG 0: 1
1: 0
2: 1
3: 10
4: 142
925404034_925404040 -7 Left 925404034 2:3594488-3594510 CCCCCAAAACATGCAAGATTCGG 0: 1
1: 0
2: 0
3: 8
4: 80
Right 925404040 2:3594504-3594526 GATTCGGGCTGCATAGAAGCTGG 0: 1
1: 0
2: 0
3: 6
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925404034 Original CRISPR CCGAATCTTGCATGTTTTGG GGG (reversed) Intergenic
900898281 1:5498880-5498902 CTGAGTCTTCCTTGTTTTGGGGG - Intergenic
905673348 1:39807849-39807871 CTGGTTCTTGCATTTTTTGGTGG + Intergenic
911281120 1:95930375-95930397 CTGAATCTTGAATGATTTGTAGG + Intergenic
919004862 1:191884407-191884429 CTGGTTCTTTCATGTTTTGGGGG - Intergenic
919516827 1:198535240-198535262 CCCTGTCTTGCATGTTTTGTAGG - Intronic
1074329237 10:112487422-112487444 CCTAATCTTGCATTTTTGAGAGG + Intronic
1077363252 11:2150426-2150448 TCAAATCTGGCATGTGTTGGGGG + Intronic
1079163014 11:18012411-18012433 CCGGTTCTTGCATGTGTTGGGGG - Intronic
1080859319 11:36139678-36139700 CCGAAACTGGCAGGGTTTGGTGG - Intronic
1083948188 11:65937842-65937864 CAGATTCTTGCCTGTTCTGGAGG + Intergenic
1084258119 11:67956101-67956123 CTGTGTCTTGCATGATTTGGAGG + Intergenic
1084814631 11:71639113-71639135 CTGTGTCTTGCATGATTTGGAGG - Intergenic
1087435068 11:98105920-98105942 TGCCATCTTGCATGTTTTGGTGG - Intergenic
1089803732 11:121063460-121063482 CCCAGTCTTGGATGTTTGGGTGG + Intronic
1089964055 11:122640932-122640954 CTGAATTTTGTATATTTTGGGGG + Intergenic
1091658354 12:2362422-2362444 CTGAATCCTACATGTTTTTGTGG + Intronic
1091918354 12:4285156-4285178 CTGAATATTGTACGTTTTGGGGG + Intronic
1101566028 12:105906322-105906344 CCCATTCTTGCATGGTTTAGTGG - Intergenic
1108270943 13:48759017-48759039 CCATCTCTTGCATCTTTTGGAGG - Intergenic
1110192528 13:72747434-72747456 CCAGACCTTGCATGTTTTGGGGG - Intronic
1111782501 13:92746087-92746109 CCCAATCTTACAGGTTTTGTTGG - Intronic
1113874614 13:113586189-113586211 GCGAATCCTGCATTTCTTGGGGG + Intronic
1114408990 14:22483130-22483152 CCTAAGCTGGAATGTTTTGGAGG - Intergenic
1115546391 14:34468285-34468307 CCAGATTTTGTATGTTTTGGAGG - Intergenic
1120233948 14:81869256-81869278 CCGAATCTATCAAGTTCTGGAGG + Intergenic
1128373657 15:67059734-67059756 CCTAAGCCTGCATGTTTTAGGGG + Intergenic
1130242663 15:82210910-82210932 GCCATTCTTGCATGGTTTGGTGG - Intronic
1133369855 16:5239450-5239472 CTGTGTCTTGCATGATTTGGAGG - Intergenic
1136588235 16:31201693-31201715 CCGCATCTTGCTTGGGTTGGTGG + Exonic
1140432662 16:74917867-74917889 CTGAATCTTACACTTTTTGGTGG + Intronic
1144096155 17:11902506-11902528 CTAAATCTTGCATGTTATTGGGG + Intronic
1145969053 17:28944502-28944524 CCGTATCTTCCATATTTAGGTGG + Intronic
1148797299 17:50203208-50203230 TGGAATCTTGGATGGTTTGGGGG - Intergenic
1151538336 17:74750930-74750952 CAGATTCCTGCATGTTTTGGAGG + Intronic
1158982136 18:62773537-62773559 AAAAATCTGGCATGTTTTGGAGG - Intronic
1160570263 18:79812064-79812086 CCAAATCTGGGAGGTTTTGGGGG - Intergenic
1162103970 19:8358685-8358707 CCTAATCTTTTATTTTTTGGAGG + Intronic
1164378027 19:27706658-27706680 CCGAAGCTTGAATCTTCTGGTGG + Intergenic
925320416 2:2962108-2962130 CCGAATGTTACTTATTTTGGAGG - Intergenic
925404034 2:3594488-3594510 CCGAATCTTGCATGTTTTGGGGG - Intergenic
929673246 2:43896369-43896391 CCTAATCTTGCATTTTTTAAGGG + Intronic
929934285 2:46282971-46282993 TGGAAACTTGCAGGTTTTGGAGG + Intergenic
939952612 2:148493294-148493316 CAGAATCTTGGATTCTTTGGTGG - Intronic
945427297 2:209722648-209722670 TTGAACCTTGCATCTTTTGGAGG - Intronic
945627066 2:212222764-212222786 CCTAATTTTGCATATTTTGGGGG + Intronic
1169295409 20:4393145-4393167 CTGAATCTTGAATGTAGTGGTGG + Intergenic
1171079201 20:22160939-22160961 CTAAATCTTACATGATTTGGAGG + Intergenic
1175300912 20:57942155-57942177 CCGAATCATGCCAGTTTTTGCGG - Intergenic
1183160138 22:36107744-36107766 CCCAAACCTGCATGGTTTGGAGG - Intergenic
1183684398 22:39353230-39353252 CTGAAGCTTACATGATTTGGGGG - Intronic
955132044 3:56179717-56179739 CCCAATCTTCCCTGTCTTGGTGG - Intronic
955288286 3:57666337-57666359 CCCATTCTGTCATGTTTTGGAGG + Intronic
957073065 3:75580614-75580636 CTGTGTCTTGCATGGTTTGGAGG + Intergenic
957293344 3:78306080-78306102 CCACATCTTGAATGTTTTGCTGG - Intergenic
961187248 3:124926467-124926489 CCCAATCTTTCATGTTTGGAGGG - Intronic
961230498 3:125303281-125303303 CTGAATCTTGATTGCTTTGGTGG + Intronic
963502709 3:146147959-146147981 CAGAATCTTTCTTGTTTTGGAGG - Intronic
964623940 3:158741011-158741033 CTGTATCTTGCATGCTCTGGGGG + Intronic
967528590 3:190522737-190522759 CAGAATCTTTCATGTGTAGGAGG + Intronic
969016666 4:4107911-4107933 CTGTGTCTTGCATGATTTGGAGG + Intergenic
969737291 4:9000404-9000426 CTGTGTCTTGCATGATTTGGAGG - Intergenic
969796494 4:9531992-9532014 CTGTGTCTTGCATGATTTGGAGG - Intergenic
969842206 4:9890953-9890975 CCGAATCTTCCTTGCTATGGTGG + Intronic
971293290 4:25365224-25365246 CTGAATGTTGCATGCTTTTGTGG - Intronic
977963869 4:103119746-103119768 CTGAATCTGACCTGTTTTGGGGG - Intronic
984127700 4:175832697-175832719 AGAAATCTTGCATGGTTTGGGGG - Intronic
989174206 5:38505344-38505366 CTGTATCTTGCATGTGGTGGTGG + Intronic
994468175 5:100165584-100165606 CCTAATCTTGCATATTTTCTAGG - Intergenic
999373060 5:151067972-151067994 CTGAGTGTTGCGTGTTTTGGAGG - Intronic
1002626301 5:180531816-180531838 CTGGTTCTTGCATTTTTTGGTGG - Intronic
1013076698 6:106778086-106778108 CCCAAACTTGTCTGTTTTGGAGG + Intergenic
1018657350 6:166051160-166051182 CCGTATCTTGGATGTGGTGGTGG - Intergenic
1018920605 6:168169795-168169817 GTGATTCTCGCATGTTTTGGGGG + Intergenic
1029075141 7:97928711-97928733 CTGTGTCTTGCATGATTTGGAGG + Intergenic
1030815263 7:114028338-114028360 CATAATCTAGCATGTTTGGGAGG + Intronic
1031937527 7:127750987-127751009 CTGTATCTTGTCTGTTTTGGTGG + Intronic
1032890393 7:136189161-136189183 CTGCTTCTTGCTTGTTTTGGGGG - Intergenic
1032895026 7:136240818-136240840 CAGAATCTTGACTGTTTTGGAGG + Intergenic
1040523732 8:48199796-48199818 CAGAATCTGGCAGGTTTGGGGGG - Intergenic
1044382676 8:91552890-91552912 CCGAATCTTGAAGGTTTTACTGG + Intergenic
1048863977 8:138745815-138745837 CTGAATCCTGAATGTTTTGGCGG - Intronic
1056057633 9:82844029-82844051 CCAAATCTTGCATGTATTTTGGG - Intergenic
1057102865 9:92379796-92379818 CCGAAGCCTGCATTTTTTTGTGG + Exonic
1057605490 9:96495589-96495611 CCACAACTTGCATGTTTTGCTGG + Intronic
1059221155 9:112620287-112620309 CCAAATCTTGATTGTTTTGTTGG + Intronic
1060575945 9:124694272-124694294 TGTAATTTTGCATGTTTTGGGGG + Intronic
1185478316 X:428249-428271 CGGAATCTTGCAAGTGTGGGAGG - Intergenic
1187831138 X:23381963-23381985 CACAATCTTGAATGTTTTGGGGG + Intronic
1195056043 X:101145918-101145940 TCAAATCTTTCATTTTTTGGGGG - Intronic