ID: 925404040

View in Genome Browser
Species Human (GRCh38)
Location 2:3594504-3594526
Sequence GATTCGGGCTGCATAGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 103}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925404038_925404040 -9 Left 925404038 2:3594490-3594512 CCCAAAACATGCAAGATTCGGGC 0: 1
1: 0
2: 0
3: 3
4: 66
Right 925404040 2:3594504-3594526 GATTCGGGCTGCATAGAAGCTGG 0: 1
1: 0
2: 0
3: 6
4: 103
925404036_925404040 -8 Left 925404036 2:3594489-3594511 CCCCAAAACATGCAAGATTCGGG 0: 1
1: 0
2: 1
3: 3
4: 56
Right 925404040 2:3594504-3594526 GATTCGGGCTGCATAGAAGCTGG 0: 1
1: 0
2: 0
3: 6
4: 103
925404033_925404040 0 Left 925404033 2:3594481-3594503 CCGCTATCCCCCAAAACATGCAA 0: 1
1: 0
2: 0
3: 26
4: 302
Right 925404040 2:3594504-3594526 GATTCGGGCTGCATAGAAGCTGG 0: 1
1: 0
2: 0
3: 6
4: 103
925404039_925404040 -10 Left 925404039 2:3594491-3594513 CCAAAACATGCAAGATTCGGGCT 0: 1
1: 0
2: 0
3: 3
4: 49
Right 925404040 2:3594504-3594526 GATTCGGGCTGCATAGAAGCTGG 0: 1
1: 0
2: 0
3: 6
4: 103
925404034_925404040 -7 Left 925404034 2:3594488-3594510 CCCCCAAAACATGCAAGATTCGG 0: 1
1: 0
2: 0
3: 8
4: 80
Right 925404040 2:3594504-3594526 GATTCGGGCTGCATAGAAGCTGG 0: 1
1: 0
2: 0
3: 6
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925404040 Original CRISPR GATTCGGGCTGCATAGAAGC TGG Intergenic
903434365 1:23335420-23335442 GAACCGGGCTGCATAGCAGGAGG + Intronic
906001984 1:42434475-42434497 GAATCGGGCTGCACAGCAGGTGG + Intronic
906484735 1:46225510-46225532 GATTAGTGCTGCCCAGAAGCTGG + Intergenic
909053238 1:70793089-70793111 GATTCTGGCAGCACAGTAGCTGG - Intergenic
909199185 1:72667580-72667602 GATTCTGGCTGCATAGAGCCTGG + Intergenic
910708530 1:90155138-90155160 ACTGCGGGCTGCATGGAAGCAGG - Intergenic
914405676 1:147369555-147369577 GATGCTGGCTTCATAGAATCAGG - Intergenic
917926779 1:179795721-179795743 GAATCGGGCTCAATAGCAGCTGG + Intronic
918487675 1:185046016-185046038 GAGTAGGGCTGCAGAGAGGCTGG - Intronic
923252663 1:232191803-232191825 GAGTCGGGCAGCCTAGCAGCGGG - Intergenic
923289043 1:232526582-232526604 GAACCGGGCTGCACAGAAGGAGG - Intronic
923674044 1:236065037-236065059 GATCCGGGCTGCGTGGACGCGGG - Exonic
1062973536 10:1666167-1666189 GTTCAGGGCTGCATAGAACCGGG + Intronic
1064962817 10:20984771-20984793 GAGCCGGGCTGCACAGAAGGAGG + Intronic
1065543695 10:26797003-26797025 GAACCGGGCTGCATAGCAGGAGG - Intronic
1077354689 11:2109688-2109710 CATGCGGGCTGCCTAGAAGGTGG + Intergenic
1079997030 11:27305458-27305480 GCTGAGGGCTGCATAGATGCTGG + Intergenic
1085399499 11:76227267-76227289 GACTCTGGCTTCGTAGAAGCAGG - Intergenic
1087864161 11:103202950-103202972 GATTTGGCCTGCATAGTAGCAGG + Intronic
1088685623 11:112282161-112282183 GATTTGGTCTGCATTGAAGGGGG + Intergenic
1097607116 12:61769026-61769048 TCTTCAGGCTGCATGGAAGCTGG + Intronic
1098396859 12:70028627-70028649 GAGTCGGGCTGCTCAGCAGCTGG + Intergenic
1101968642 12:109297185-109297207 GAACCGGGCTGCACAGAAGGAGG + Intronic
1104199829 12:126577616-126577638 GATACGGGCTGCATTTCAGCGGG - Intergenic
1104977833 12:132560167-132560189 GAGCCGGGCTGCATGGACGCGGG - Intronic
1109682980 13:65776920-65776942 GATGCGGGCTGCATCCAAGAAGG + Intergenic
1110682651 13:78334628-78334650 GGTTCTGTCTGCACAGAAGCAGG - Intergenic
1111225572 13:85266605-85266627 CTTTCTGGCTGCATGGAAGCTGG + Intergenic
1115976788 14:39005501-39005523 GACTTGGGCTGCCTACAAGCTGG - Intergenic
1119709232 14:76809338-76809360 CCTTCGGGCTGCAGAGAACCTGG - Exonic
1120309193 14:82808438-82808460 GTTTCTGGCTGCAGAGAAGGTGG - Intergenic
1122593180 14:102870372-102870394 GCTTCGGGCTGCACAGCACCAGG - Exonic
1124917827 15:33994110-33994132 GAACCGGGCTGCATAGCAGGAGG + Intronic
1125238962 15:37550670-37550692 GATGCAGGCTGCAGAGACGCTGG + Intergenic
1125375873 15:39028843-39028865 GAACCGGGCTGCACAGCAGCAGG + Intergenic
1125499737 15:40232197-40232219 GAACCGGGCTGCATAGTAGGAGG - Intergenic
1127477342 15:59347126-59347148 GAACCGGGCTGCACAGCAGCAGG + Intronic
1127772498 15:62243036-62243058 GATTGGGGCTGCCAACAAGCAGG - Intergenic
1130927355 15:88395734-88395756 GAGTCAGGCTGCACAGCAGCCGG + Intergenic
1131285010 15:91049584-91049606 GACTGGGGCTGGAGAGAAGCGGG + Intergenic
1132656121 16:1042694-1042716 GGTGGGGGCTGCAGAGAAGCAGG + Intergenic
1141239738 16:82254478-82254500 GATTTGGGGGGCTTAGAAGCAGG + Intergenic
1142940478 17:3376594-3376616 CTTTCTGGCTGCATGGAAGCTGG - Intergenic
1143859647 17:9879380-9879402 GCTTCGGACTCCAGAGAAGCTGG - Intronic
1144617825 17:16792524-16792546 GAACCGGGCTGCACAGCAGCAGG - Intronic
1144619061 17:16804657-16804679 GAACCGGGCTGCACAGCAGCAGG + Intergenic
1144893639 17:18511038-18511060 GAACCGGGCTGCACAGCAGCAGG - Intergenic
1144894879 17:18523158-18523180 GAACCGGGCTGCACAGCAGCAGG + Intergenic
1145137344 17:20421076-20421098 GAACCGGGCTGCACAGCAGCAGG - Intergenic
1145138584 17:20433236-20433258 GAACCGGGCTGCACAGCAGCAGG + Intergenic
1147053213 17:37813712-37813734 CAGTCTGGCTGCAGAGAAGCTGG - Intergenic
1150980696 17:70138426-70138448 GCTTCAGGCTGCAGAGAAACAGG + Intergenic
1156119720 18:33827517-33827539 GATTAGAGCTGCAAGGAAGCTGG + Intergenic
1167633063 19:50637840-50637862 GATTAGGGCTGCACAGATGAAGG + Exonic
1167938268 19:52924819-52924841 GACTCAGCCTGCATAGTAGCTGG + Intergenic
925404040 2:3594504-3594526 GATTCGGGCTGCATAGAAGCTGG + Intergenic
925908148 2:8551867-8551889 ACATGGGGCTGCATAGAAGCAGG - Intergenic
930994725 2:57702441-57702463 GATTGGTGGTGAATAGAAGCAGG + Intergenic
933110722 2:78397090-78397112 CTTTCAGGCTGCATGGAAGCTGG + Intergenic
935876737 2:107515417-107515439 GAGTTGGGCTGCTTAGAGGCTGG + Intergenic
937297839 2:120820459-120820481 GATGCTGGCGGCAAAGAAGCTGG + Intronic
938072550 2:128316294-128316316 GCTTCGGGCCGCCAAGAAGCCGG - Intronic
938995383 2:136672512-136672534 GATTGGGGCTGCTTCCAAGCAGG + Intergenic
945890938 2:215430299-215430321 GATTAGTGCTGTAAAGAAGCTGG - Intronic
1171024395 20:21615651-21615673 GCTTCGGGCAGCACAGAAGCTGG + Intergenic
1177928137 21:27245020-27245042 GCTTCTGCCTACATAGAAGCTGG - Intergenic
1180596102 22:16974522-16974544 GCTTCTGGCTGCACAGAGGCTGG + Intronic
953495172 3:43379686-43379708 GCTGTGGGCTGCATAGGAGCTGG + Intronic
956901621 3:73722366-73722388 GAACCAGGCTGCATAGCAGCAGG + Intergenic
958643493 3:96839205-96839227 GAACCGGGCTGCATAGCAGGAGG + Intronic
960879705 3:122332088-122332110 GAATCGGGCTGCACAGCAGGAGG - Intronic
964772531 3:160239327-160239349 CTTTCGGGCTGCATGGGAGCTGG + Intronic
964820695 3:160765585-160765607 GATTCTGCCAGCAAAGAAGCAGG - Intronic
967757907 3:193190960-193190982 GCTTCAGGCTGCAGAGAAGGAGG - Intergenic
974348467 4:60713589-60713611 GATCCAGGCTACCTAGAAGCAGG + Intergenic
974532202 4:63123424-63123446 GATTTGTTCTGCATAGAAGATGG + Intergenic
975243818 4:72094630-72094652 GCTGCAGGCTGCATAGGAGCTGG - Intronic
975625717 4:76344772-76344794 AAGTCGGGCTTCATAGCAGCAGG - Intronic
976179977 4:82389660-82389682 GAATCGGGCTGCACAGGAGGAGG + Intergenic
979772647 4:124548031-124548053 TATTGGAGCTGCATAGGAGCTGG + Intergenic
981751834 4:148099709-148099731 GATTTGAGCTGCATAGGAGCGGG + Intronic
985143824 4:186872238-186872260 GATCCGGGCTGCACAGCAGGAGG + Intergenic
985216192 4:187656887-187656909 GAATAGGGCTGCATTGAAGCAGG - Intergenic
992211424 5:74483608-74483630 GAATCGGGCTGCACAGCAGGAGG + Intergenic
997122920 5:131194875-131194897 GCCTCTGGCTGCTTAGAAGCTGG - Intronic
1000360089 5:160438997-160439019 GAAGCGGTCTCCATAGAAGCTGG + Intergenic
1002142284 5:177149809-177149831 GAACCGGGCTGCATAGCAGGAGG - Intronic
1003509216 6:6765465-6765487 GATTTGGCCTTGATAGAAGCAGG + Intergenic
1004976911 6:20978154-20978176 GATTCTGACTACATAGTAGCTGG - Intronic
1006801427 6:36762182-36762204 GATTGGGGCTGCAGTGAACCAGG + Intronic
1010336876 6:74695697-74695719 CATTGGGGCTGCCTAGAGGCTGG + Intergenic
1012657795 6:101847685-101847707 GATTCAGGCTCCATGCAAGCAGG - Intronic
1013621116 6:111890224-111890246 GATGGTGGCTGCTTAGAAGCAGG + Intergenic
1018950912 6:168378394-168378416 GATTCGGGCTGCGTGGACTCAGG - Intergenic
1019406026 7:884524-884546 GCTTCGTGCTGCACAGAGGCAGG - Intronic
1022633212 7:32105604-32105626 GATCCAGGCTGAATGGAAGCTGG - Intronic
1025104813 7:56162257-56162279 GAGTCGGGCTGCTTAGTGGCCGG - Intergenic
1028162204 7:87498491-87498513 GGTGGGGGCTGCAAAGAAGCTGG + Intergenic
1029042706 7:97594519-97594541 TATTGGGGATGCATAGTAGCAGG - Intergenic
1030720735 7:112867873-112867895 GAACCGGGCTGCATAGCAGGAGG + Intronic
1039301510 8:36214331-36214353 GATACGGGCAGCACAGAAACAGG + Intergenic
1049323287 8:142008855-142008877 AATTCATGCTGCATGGAAGCAGG - Intergenic
1049420520 8:142514355-142514377 GATGCGGGCTGCGCAGATGCCGG + Intronic
1050133623 9:2439345-2439367 ATTTTGGGCTGCATAGCAGCTGG - Intergenic
1051601376 9:18878079-18878101 CTTTCGGGCTGCATGGGAGCTGG - Intronic
1051879630 9:21826812-21826834 GAACCGGGCTGCACAGAAGAAGG + Intronic
1059051597 9:110932606-110932628 GAATCGGGCTGCACAGCAGGAGG + Intronic
1062478796 9:136742188-136742210 GAGCAGGGCTGCAGAGAAGCAGG + Intronic
1203758978 EBV:2196-2218 GCTTCGAGGTGCATAGAAGCCGG + Intergenic
1199433763 X:147789671-147789693 GAGTGGGGCTGGACAGAAGCAGG - Intergenic