ID: 925404044

View in Genome Browser
Species Human (GRCh38)
Location 2:3594538-3594560
Sequence CCCTGACTAACATTTGTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 142}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925404038_925404044 25 Left 925404038 2:3594490-3594512 CCCAAAACATGCAAGATTCGGGC 0: 1
1: 0
2: 0
3: 3
4: 66
Right 925404044 2:3594538-3594560 CCCTGACTAACATTTGTTTCTGG 0: 1
1: 0
2: 1
3: 10
4: 142
925404039_925404044 24 Left 925404039 2:3594491-3594513 CCAAAACATGCAAGATTCGGGCT 0: 1
1: 0
2: 0
3: 3
4: 49
Right 925404044 2:3594538-3594560 CCCTGACTAACATTTGTTTCTGG 0: 1
1: 0
2: 1
3: 10
4: 142
925404034_925404044 27 Left 925404034 2:3594488-3594510 CCCCCAAAACATGCAAGATTCGG 0: 1
1: 0
2: 0
3: 8
4: 80
Right 925404044 2:3594538-3594560 CCCTGACTAACATTTGTTTCTGG 0: 1
1: 0
2: 1
3: 10
4: 142
925404036_925404044 26 Left 925404036 2:3594489-3594511 CCCCAAAACATGCAAGATTCGGG 0: 1
1: 0
2: 1
3: 3
4: 56
Right 925404044 2:3594538-3594560 CCCTGACTAACATTTGTTTCTGG 0: 1
1: 0
2: 1
3: 10
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925404044 Original CRISPR CCCTGACTAACATTTGTTTC TGG Intergenic
900324906 1:2103969-2103991 CCCTGCCCAACATTTGGCTCAGG + Intronic
904343411 1:29852646-29852668 CCCTGACTTACATATGGCTCAGG + Intergenic
905610918 1:39350654-39350676 CCCTAACTACAATTTGCTTCAGG - Intronic
906372939 1:45269933-45269955 CCCAGACAAACATTTGCTGCAGG + Intronic
907788875 1:57641692-57641714 CTCTGAATAATATTTGTGTCAGG + Intronic
909737089 1:78975187-78975209 TCTTGACCACCATTTGTTTCTGG + Intronic
911195674 1:94992799-94992821 CCCTGTGTTACATTTGCTTCTGG - Intronic
913115214 1:115690727-115690749 CCCTGAGAAACTTTTGGTTCAGG + Intronic
913665173 1:121041605-121041627 CCCTAACTAACATTATTCTCTGG + Intergenic
914016566 1:143824874-143824896 CCCTAACTAACATTATTCTCTGG + Intergenic
914161218 1:145136137-145136159 CCCTAACTAACATTATTCTCTGG - Intergenic
916056648 1:161073033-161073055 CCATGCCTAACACTTGTTCCTGG - Intronic
921692607 1:218167050-218167072 GTCTGACTGATATTTGTTTCAGG + Intergenic
923914642 1:238488301-238488323 CCATAACTATCATTTGTTTTTGG + Intergenic
924421261 1:243912249-243912271 GCCTGGCTAACTTTTGTTTGGGG - Intergenic
1064980391 10:21160811-21160833 CCCTGATTAAATTTAGTTTCAGG + Intronic
1068523774 10:58105606-58105628 CCATGACTAAAAATTGTTTGAGG + Intergenic
1069596606 10:69676048-69676070 CCCAGACTAAGCATTGTTTCTGG - Intergenic
1072753937 10:98004939-98004961 CCCAGAGTAACAACTGTTTCCGG - Intronic
1072867929 10:99084173-99084195 CTCTGCCTAGCATTTATTTCAGG - Intronic
1073293418 10:102424488-102424510 CCCAGACTCACCTTTGTTCCTGG + Exonic
1074132276 10:110591121-110591143 CAATGACTCACATTGGTTTCAGG - Exonic
1075208617 10:120469610-120469632 TCCTCACTTACATTTATTTCAGG + Intronic
1081410869 11:42756724-42756746 CCCTGCCTAAGCTTTGATTCAGG + Intergenic
1082725759 11:56734501-56734523 ACCTGACTAAAATTTGTTTATGG - Intergenic
1084394174 11:68898083-68898105 CCCTTCCTAACATTTGTGTGTGG - Intronic
1086547456 11:88014663-88014685 CCCTGACAACCATGTGTTTTGGG + Intergenic
1088451686 11:109988166-109988188 CACTGCCTACCATTTGCTTCTGG - Intergenic
1089007204 11:115102213-115102235 GCTTGACTAACATTTGTTGTTGG - Intergenic
1090141134 11:124264513-124264535 CCCTGACAGAAATTAGTTTCAGG + Intergenic
1093543358 12:20315512-20315534 ATCTGACACACATTTGTTTCAGG - Intergenic
1096944129 12:55385219-55385241 CCTTGGCAAACATTTATTTCAGG + Intergenic
1097462887 12:59885551-59885573 CCCTCACTAACACTTGTCTCTGG + Intergenic
1097968827 12:65610486-65610508 CCCTAAATATCATTTGCTTCAGG + Intergenic
1098121184 12:67240911-67240933 ACCTGGCTGCCATTTGTTTCTGG - Intergenic
1099687832 12:85911700-85911722 TCCTCACTAGCATTTGTTACTGG + Intergenic
1104319478 12:127736828-127736850 CCCTGACTGAACTTAGTTTCTGG + Intergenic
1104888770 12:132128904-132128926 CCCTCACTAACACTTGGTTTTGG - Intronic
1105913556 13:24892759-24892781 CTCTGACTAACATTTGTATCTGG + Exonic
1107889404 13:44901187-44901209 GCCTGACAAACAATTGTTGCAGG - Intergenic
1107933247 13:45323855-45323877 CCCAGATTAACTATTGTTTCTGG - Intergenic
1109896802 13:68703136-68703158 TCCTCACTATCTTTTGTTTCTGG - Intergenic
1110081897 13:71323924-71323946 CCAAGACTAAAATGTGTTTCAGG + Intergenic
1112631108 13:101162127-101162149 CCCTGACCACCATTTGTGTCGGG + Intronic
1114282682 14:21208150-21208172 TCCTTAGTAACATTTTTTTCTGG - Intergenic
1118607502 14:67514759-67514781 CCCTGACACCCCTTTGTTTCAGG + Intronic
1118833849 14:69461741-69461763 CCCTAGCTACCATGTGTTTCAGG - Intronic
1119853190 14:77880691-77880713 CCTTGCCGAACATTTCTTTCAGG + Intronic
1120511780 14:85424253-85424275 GCCTGGCAAACATTTGTCTCTGG + Intergenic
1121453659 14:94025151-94025173 CCCTGACCCCCATTTGTTTTCGG - Intergenic
1125542988 15:40482143-40482165 CCCTGACTAACACTGTTTTTCGG + Intergenic
1127027306 15:54821124-54821146 CTCTCACTAACCATTGTTTCTGG + Intergenic
1130403324 15:83577397-83577419 CCCTGACTCACATCTTTTTTTGG + Intronic
1136385333 16:29922280-29922302 CCCTGAACAACTTTTGTCTCAGG - Intronic
1152403165 17:80081872-80081894 CCGTGAGTATCATTTGTTCCTGG - Exonic
1156373931 18:36495406-36495428 CCCTCACTAACATGTGTTCATGG + Intronic
1157054067 18:44204455-44204477 GCCTCACCAACATCTGTTTCTGG - Intergenic
1157289829 18:46401347-46401369 CCCTGACTGACATTTGATGTTGG - Intronic
1160061771 18:75535299-75535321 CCCTGACCATCCTTTGCTTCTGG - Intergenic
1163972875 19:20816971-20816993 TCTTAACTAACATTTTTTTCTGG - Intronic
1165918127 19:39273705-39273727 CCCTGGCTAATTTTTGTTTTTGG - Intergenic
1168224130 19:54982367-54982389 CCCAGTCTAGCATTAGTTTCTGG - Exonic
925404044 2:3594538-3594560 CCCTGACTAACATTTGTTTCTGG + Intergenic
925560474 2:5187453-5187475 CCCTGACCAACATTTGGTTTTGG - Intergenic
928322322 2:30293694-30293716 TCCTGAGTAACATTTGTGCCAGG + Intronic
933307840 2:80624166-80624188 TCCAGAGTAACATTTGTTTGGGG + Intronic
940201319 2:151154003-151154025 CACTGAGTTCCATTTGTTTCAGG - Intergenic
941612860 2:167682980-167683002 CTCTGATTAATATTTATTTCTGG + Intergenic
944653429 2:201855074-201855096 CCCTGACTAATCTTTGTATGAGG + Intronic
944820556 2:203426116-203426138 CCCTAAAGAAAATTTGTTTCTGG - Intronic
946807498 2:223485839-223485861 CCCTGAGTTCCATTTGTTTTTGG + Intergenic
1169672418 20:8117343-8117365 CCCTGACTAATATTAGAGTCAGG + Intergenic
1172972902 20:38886498-38886520 CCCTGACTAGGATGGGTTTCTGG - Intronic
953545236 3:43859596-43859618 CCCTGAGCAACATTTGATTGAGG + Intergenic
954061644 3:48072642-48072664 CCCTAATTATCCTTTGTTTCTGG - Intronic
954323574 3:49848576-49848598 CCCTTACTTACTTTTATTTCTGG - Intronic
956660129 3:71589231-71589253 ACCTGTCTGGCATTTGTTTCTGG - Intergenic
960646265 3:119887853-119887875 CCCTGTCTATAATGTGTTTCTGG - Intronic
960933900 3:122883684-122883706 CTCTGATTTACATTTGTTTGTGG + Intergenic
960950396 3:122995207-122995229 CCCAGACTAACATTTTTCCCAGG - Intronic
961313698 3:126019984-126020006 CCCAGACGAAGACTTGTTTCAGG - Intronic
966226066 3:177599407-177599429 CCCTCACCAACAATGGTTTCTGG - Intergenic
966821328 3:183927100-183927122 CCAAGACCAACTTTTGTTTCTGG - Intronic
967957669 3:194890114-194890136 CCGTGACTCAAATTGGTTTCAGG + Intergenic
968898313 4:3418148-3418170 CTCTGCCTAACTTTTGTTACAGG - Intronic
971984485 4:33804333-33804355 TCCAGACCAAGATTTGTTTCTGG + Intergenic
972131261 4:35836844-35836866 CCCTGACAATCATTTTCTTCAGG - Intergenic
973260123 4:48154942-48154964 GGCTGACCAACAATTGTTTCAGG + Intronic
976741685 4:88363406-88363428 CCCTGCCTACCACTTGTGTCTGG + Intergenic
977047460 4:92085273-92085295 CAATGACTAACAATTGTTTAGGG + Intergenic
977076615 4:92460090-92460112 CTCTGACTAATATATGCTTCAGG + Intronic
977267919 4:94878184-94878206 GTATGACTAATATTTGTTTCAGG + Intronic
977340482 4:95751257-95751279 CCCTGATTCACATTTCTATCAGG + Intergenic
977542521 4:98334712-98334734 GCCTGACTAACAATTGCTTAGGG - Intronic
979680599 4:123455334-123455356 CCCAGGCAATCATTTGTTTCAGG - Intergenic
980294087 4:130887607-130887629 GCCTGACTAACAATTGTTTAGGG - Intergenic
980338716 4:131512535-131512557 CACTGAATAAAATTTGTTTTGGG - Intergenic
984410784 4:179395273-179395295 CACTGACTATCATTTTTCTCAGG - Intergenic
985480339 5:106592-106614 CTCTAACTGAAATTTGTTTCAGG - Intergenic
987582820 5:19818838-19818860 ACATGACTATAATTTGTTTCAGG + Intronic
991746132 5:69743528-69743550 GCCTAACTAACACTTGTTTATGG - Intergenic
991751573 5:69811713-69811735 GCCTAACTAACACTTGTTTATGG + Intergenic
991797734 5:70323481-70323503 GCCTAACTAACACTTGTTTATGG - Intergenic
991825510 5:70618842-70618864 GCCTAACTAACACTTGTTTATGG - Intergenic
991830860 5:70686606-70686628 GCCTAACTAACACTTGTTTATGG + Intergenic
991890078 5:71322805-71322827 GCCTAACTAACACTTGTTTATGG - Intergenic
992168720 5:74080819-74080841 CACTTACTAACATGTATTTCTGG - Intergenic
993560306 5:89398824-89398846 CCCTGATTACCATTTCTTTGTGG + Intergenic
993734206 5:91456802-91456824 CCCTGAAAAACATTTTTATCTGG + Intergenic
995986491 5:118182027-118182049 CCCTGGCAAAGAATTGTTTCTGG + Intergenic
996475500 5:123915295-123915317 CCCTGACTTACAATAGTTTGAGG + Intergenic
998318717 5:141209162-141209184 CCCTGTCTAGCATTTCTCTCAGG - Exonic
999494674 5:152085333-152085355 CCCTGACTAGCTTTTCTTTTGGG + Intergenic
1000701387 5:164455533-164455555 CTCTGAGTTACATTTGTTTCTGG + Intergenic
1000908628 5:166994397-166994419 CCCTGATTCTCATTTGTTTGGGG + Intergenic
1000932378 5:167267137-167267159 ATCTGACTGACATTTGATTCTGG + Intergenic
1002434383 5:179221904-179221926 GCCTGCCCAACCTTTGTTTCTGG + Intronic
1003408759 6:5845055-5845077 CCCTGCCAAACAATTGGTTCAGG - Intergenic
1003955381 6:11160177-11160199 TCCTCACTAACACTTGTTACTGG - Intergenic
1005556793 6:26993987-26994009 GCCTAACTAACACTTGTTTATGG - Intergenic
1012340327 6:98113740-98113762 CCTAATCTAACATTTGTTTCTGG + Intergenic
1012771790 6:103446881-103446903 TCTTGACAAATATTTGTTTCAGG + Intergenic
1012785681 6:103622604-103622626 ACCTGTCTAACATTTCATTCAGG + Intergenic
1017879989 6:158555352-158555374 GCCTGACTAATAATTGTTTGGGG - Intronic
1018522147 6:164661995-164662017 CCCTGATTTATTTTTGTTTCTGG + Intergenic
1021169609 7:17382886-17382908 CTATGAATAACATTGGTTTCTGG + Intergenic
1021228122 7:18052249-18052271 CCCTAATTAACATCTGTTTTGGG + Intergenic
1022585104 7:31601430-31601452 CCTTGACTATCTTTTGGTTCTGG + Intronic
1024117553 7:46208335-46208357 CCCTGACTCACATGTCCTTCTGG + Intergenic
1025830585 7:65045766-65045788 CTCAGACTAACATTTGATCCAGG + Intergenic
1030803959 7:113890259-113890281 CCCTGAATAGCATTTGTACCAGG - Intronic
1030844201 7:114389381-114389403 CCCGGAATAACATTTCTTTAAGG - Intronic
1036164284 8:6418048-6418070 CCCTGAACAACATGTGTTTGAGG - Intronic
1040418093 8:47214155-47214177 GCCTGACTGACAGTTGTTTAGGG - Intergenic
1042921118 8:73921069-73921091 GCCTGACTAACAATTGCTTAGGG - Intergenic
1044496017 8:92884149-92884171 CCATGTCTAAAATTTGTGTCTGG + Exonic
1046506076 8:115139389-115139411 CCCTGGCTAACAGTGGTTTCAGG - Intergenic
1048011461 8:130459913-130459935 CTGTCACTAACATTTGTCTCTGG + Intergenic
1048805196 8:138234584-138234606 ACCTGAAAAACATTTTTTTCTGG + Intronic
1050844144 9:10192791-10192813 TCCTCATTAACATTGGTTTCAGG - Intronic
1051369839 9:16348974-16348996 TCCTGACTAACAGTTCTTTGAGG + Intergenic
1051649430 9:19306528-19306550 CCCTGAAAAACAATTATTTCAGG + Intronic
1052249030 9:26375393-26375415 CCCTGTATAACATATGATTCTGG - Intergenic
1059769183 9:117411868-117411890 TCCTGCCTAACGTTTGTCTCTGG - Intronic
1186764083 X:12753178-12753200 CACAGACTAGCATTTGTTCCTGG + Intergenic
1186965449 X:14781927-14781949 CCATGACCAACATTTCTTTCTGG - Intergenic
1188318399 X:28705272-28705294 CCCTGATTCACATTTGTCCCAGG - Intronic
1189632245 X:42967158-42967180 CCCTACCTAACAGTTGTTTAGGG - Intergenic
1193193136 X:78597134-78597156 TCCTCACTAACATTAGTTTTTGG - Intergenic
1195256966 X:103100428-103100450 GCCTGGCTAACAATTGCTTCGGG - Intergenic
1195800169 X:108699998-108700020 GCCTGATTAACAGTTGGTTCTGG + Intergenic
1198861121 X:141071530-141071552 CCCTGACTCACATTTCTCTCTGG + Intergenic
1198901571 X:141515853-141515875 CCCTGACTCACATTTCTCTCTGG - Intergenic
1199413007 X:147547459-147547481 CCCTGAAAAATGTTTGTTTCTGG + Intergenic