ID: 925404714

View in Genome Browser
Species Human (GRCh38)
Location 2:3598637-3598659
Sequence CCGCGTGAGCACAGGGGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 145}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925404708_925404714 -5 Left 925404708 2:3598619-3598641 CCCTTATTGTTCTAATATCCGCG 0: 1
1: 0
2: 0
3: 2
4: 33
Right 925404714 2:3598637-3598659 CCGCGTGAGCACAGGGGAGAAGG 0: 1
1: 0
2: 1
3: 7
4: 145
925404709_925404714 -6 Left 925404709 2:3598620-3598642 CCTTATTGTTCTAATATCCGCGT 0: 1
1: 0
2: 0
3: 3
4: 37
Right 925404714 2:3598637-3598659 CCGCGTGAGCACAGGGGAGAAGG 0: 1
1: 0
2: 1
3: 7
4: 145
925404707_925404714 9 Left 925404707 2:3598605-3598627 CCGCTTTTCGGTTGCCCTTATTG 0: 1
1: 0
2: 0
3: 9
4: 92
Right 925404714 2:3598637-3598659 CCGCGTGAGCACAGGGGAGAAGG 0: 1
1: 0
2: 1
3: 7
4: 145
925404706_925404714 18 Left 925404706 2:3598596-3598618 CCTGGGTTTCCGCTTTTCGGTTG 0: 1
1: 0
2: 0
3: 0
4: 46
Right 925404714 2:3598637-3598659 CCGCGTGAGCACAGGGGAGAAGG 0: 1
1: 0
2: 1
3: 7
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925404714 Original CRISPR CCGCGTGAGCACAGGGGAGA AGG Intronic
900572052 1:3363452-3363474 CCCGGTGAGCACGGGGGAGCTGG + Intronic
903163963 1:21508532-21508554 CAGCGAGAGGCCAGGGGAGATGG + Intergenic
903330042 1:22592659-22592681 CGGGGTGAGCAGAGGGGAGGAGG + Intronic
904212980 1:28897918-28897940 CAGAGTGAGCCCAGGGGAGCAGG + Intronic
905203510 1:36329636-36329658 CAGCGTTTGAACAGGGGAGACGG + Intergenic
905694470 1:39964842-39964864 CCGTGTGAGAACACGGGAGTTGG + Intronic
906029233 1:42704401-42704423 CAGTGTGAGCACAGGAGAGCAGG + Intergenic
906650258 1:47508104-47508126 CCGCGGGCGCACAGGGGACACGG - Intergenic
908792230 1:67794264-67794286 CCCTGTGAGCTCAGGAGAGATGG + Intronic
909584587 1:77275357-77275379 CCACATGAGCACTGGGGGGATGG + Intergenic
912625865 1:111204242-111204264 CGGCGTGGGCACCGGGGAGCCGG - Intronic
915339329 1:155167619-155167641 CCGTGGGAGCACTGGGCAGAGGG - Intergenic
919859787 1:201731919-201731941 CAGCATGAGCACAGGGCAGCTGG - Intronic
922729289 1:227941616-227941638 CCCTGGGAGCACAGGGGAGATGG + Intronic
923226698 1:231944421-231944443 CCGAGTTAGCACAAGGGACAAGG - Intronic
1067040940 10:42952951-42952973 CCACGTGAGGACACAGGAGAAGG - Intergenic
1075342954 10:121661803-121661825 CCGCGTGGGCACAGCGGATGTGG - Intergenic
1075501661 10:122980410-122980432 GCGCGTGCGCGCAGGGCAGACGG + Exonic
1076124374 10:127962622-127962644 CCGAGGGAGCTCAGGGGAGCAGG + Intronic
1076768852 10:132651976-132651998 CATCCTGAGCACAGGGGTGAGGG - Intronic
1076821309 10:132941315-132941337 CCGAGTGGGCACAGGGGAGCTGG - Intronic
1077219321 11:1408406-1408428 CCACGGGAGAACTGGGGAGAAGG + Intronic
1078450307 11:11436071-11436093 CTGCGTGAGCAGAGAGGCGAGGG + Intronic
1080011114 11:27460455-27460477 ATGCGTGAGCACAGGGGATTTGG - Intronic
1080691972 11:34565877-34565899 CCTGGTGGGCACAGGGAAGAGGG + Intergenic
1090388180 11:126368696-126368718 CCTTGTGAGTACAGGGGAAATGG + Intronic
1090390920 11:126386675-126386697 CCTTGTGAGTACAGGGGAAATGG + Intronic
1091727954 12:2858608-2858630 CAGCTTGAGCACAGGGGCAAGGG + Exonic
1092202898 12:6597868-6597890 CCAGCTGAGCACACGGGAGACGG - Intronic
1097938581 12:65279177-65279199 CCGCGCGGGCCCAGGAGAGAGGG + Intronic
1099990706 12:89718002-89718024 CCATGTGAGGACAGGGCAGAAGG - Intergenic
1101858307 12:108462692-108462714 CATCGTGATCACAGAGGAGAAGG - Intergenic
1103209141 12:119154171-119154193 CTGCGTGAGCGCGTGGGAGAGGG - Intronic
1104521786 12:129482193-129482215 ACGCATAAGCACAGTGGAGATGG - Intronic
1104695743 12:130862384-130862406 GCAGGTGAGCACAGGAGAGAAGG - Intergenic
1104809356 12:131611221-131611243 TCGGGTGTGCACAGTGGAGATGG + Intergenic
1106044071 13:26121351-26121373 TCGCGTGAGCCCAGGGGTCAAGG - Intergenic
1107598061 13:41984650-41984672 CTGCATTAGCACAAGGGAGAGGG - Intergenic
1112264229 13:97908137-97908159 CCATGGGAGCACAGGAGAGAGGG - Intergenic
1112316071 13:98363048-98363070 CAGCGTGAGAACAGGTTAGAAGG - Intronic
1113794259 13:113047835-113047857 AGGCGTGAGCAGAGGGGACAGGG - Intronic
1119424572 14:74527384-74527406 CAGCGTGAGCTCAGGGAGGAGGG + Intronic
1122602572 14:102928972-102928994 CCGGGTGAGCACTGAGGGGAGGG + Exonic
1123039476 14:105484522-105484544 CCCCCAGAGCACAGGGTAGATGG + Intergenic
1125885196 15:43224170-43224192 CCGCGTGGACACAGGGAAGAGGG - Intergenic
1127784392 15:62343117-62343139 CTGGGGGAGCACAAGGGAGAAGG + Intergenic
1132546873 16:537270-537292 CTGAGTGAGCGCAGGGGAGCAGG + Intronic
1132553547 16:563318-563340 CCGCGTGGGCACAGGGGCGAGGG + Exonic
1132567714 16:630939-630961 CCTGGTCAGCACAGGGCAGAGGG - Exonic
1132607825 16:800857-800879 CTGGGTGAGCCCAGGGGAGGGGG - Intergenic
1142034049 16:87852912-87852934 CCTCGTGAGCAGAGGAGTGAAGG - Intronic
1142131238 16:88432480-88432502 CTTCCTGGGCACAGGGGAGAAGG - Exonic
1143567665 17:7734320-7734342 CCTGGCGATCACAGGGGAGAGGG + Intronic
1147179360 17:38674661-38674683 CCGCGTGAGGAGAGCGAAGAGGG - Exonic
1147586276 17:41655504-41655526 CTGAGTGAGCACAGGGCAGCGGG - Intergenic
1148544207 17:48504473-48504495 CCACCTGAGCACAGGGGTCATGG - Intergenic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1150630214 17:66875241-66875263 CAGCGTGGGCAGAGGGGAGCAGG - Intronic
1151820345 17:76493586-76493608 CAGAGTTAGCAGAGGGGAGAGGG + Intronic
1152568113 17:81109188-81109210 GCGCGTAAACACAGGGGAGGGGG - Intronic
1152941005 17:83172908-83172930 CTGGGTGAGCACTGGGGTGAGGG + Intergenic
1156377600 18:36528842-36528864 CCGTGTGAGAACAGGTGAGGTGG - Intronic
1158200710 18:54936584-54936606 CCCCATGAGCACAGGTGGGAGGG - Intronic
1159944792 18:74436399-74436421 CCCAGAGAGCACAGGGGAAATGG + Exonic
1160921234 19:1521736-1521758 CCGCGGGCGGCCAGGGGAGAGGG + Intergenic
1162809553 19:13155733-13155755 CCCCGTGGCCACAGGGTAGAAGG + Intergenic
1163391187 19:17030993-17031015 CCTCATCAGCACACGGGAGAAGG + Intergenic
1164233466 19:23311673-23311695 CACCCTGTGCACAGGGGAGATGG + Intronic
1165070879 19:33254262-33254284 CCGCGTGGGGAGAGGGGACAGGG - Intergenic
1165939690 19:39408838-39408860 CAGCGTGAGGTCAGGGGAGTGGG - Exonic
1166130498 19:40742981-40743003 TGGCCTGAGCACAGGGGAGGTGG + Intronic
1166391000 19:42408900-42408922 CAGAGTGAGCAGTGGGGAGAGGG + Intronic
1166731043 19:45059210-45059232 GAGCGAGAGGACAGGGGAGAAGG - Intronic
1168284287 19:55322688-55322710 CTGGGTGAGCTCAGGGAAGAAGG + Exonic
1168327566 19:55546027-55546049 CAGTGTGCGGACAGGGGAGAGGG - Intergenic
925387641 2:3473220-3473242 CGGCGTGAGCACAGCAGAGCCGG - Intronic
925404714 2:3598637-3598659 CCGCGTGAGCACAGGGGAGAAGG + Intronic
926365137 2:12126074-12126096 CCGCTGGAGCCCAGGGGAGGGGG + Intergenic
931922681 2:67038134-67038156 CCACATGGGAACAGGGGAGAAGG - Intergenic
932744106 2:74317479-74317501 CGGGCTGAACACAGGGGAGATGG + Intronic
935086114 2:99846999-99847021 CAGCCAGAGCACAGGAGAGAAGG + Intronic
935749679 2:106220389-106220411 CCTCGTGAGGACAAGAGAGAAGG + Intergenic
938019318 2:127893146-127893168 CCGGGAGAGCACTGGGGACAGGG + Intergenic
941200008 2:162496391-162496413 CCGCATGCGCACTGGGGGGATGG + Intronic
944938011 2:204589889-204589911 CCCAGTGAGCAGATGGGAGATGG + Intronic
947295653 2:228627678-228627700 CCACGTGAGAACATGTGAGAAGG - Intergenic
948465388 2:238149500-238149522 CCCCTTGAGGACAGGGGTGACGG + Intronic
1175269191 20:57721898-57721920 TCACTTGAGCCCAGGGGAGATGG - Intergenic
1175771724 20:61628330-61628352 CCGGCTGAGCACAGGGGTGGGGG - Intronic
1176270154 20:64232125-64232147 CGGGGTGAGTACAGGGGCGAAGG - Intronic
1179409366 21:41150235-41150257 CTGCGTGAGCACAGGGGGGCTGG + Intergenic
1180963956 22:19776061-19776083 CCACGTGGGCACAGGTGGGAGGG + Intronic
1181521224 22:23449833-23449855 CCGCGTGAGCACCGTGCTGAGGG - Intergenic
1181530517 22:23514536-23514558 CTGGGTGGGCAGAGGGGAGAGGG - Intergenic
1182358821 22:29734936-29734958 CCGCGGGAGCAGAGGGAAGGTGG + Intronic
1183584626 22:38745808-38745830 GCACCTGTGCACAGGGGAGAGGG + Exonic
1184550712 22:45202913-45202935 GGCCGTGAGCACGGGGGAGACGG + Intronic
1184854448 22:47138811-47138833 CCGTGTGAGGACATGGCAGAGGG - Intronic
949577587 3:5353536-5353558 GTGTGTGTGCACAGGGGAGAGGG + Intergenic
955339257 3:58112326-58112348 CCAGGGGAGCAGAGGGGAGAAGG - Intronic
956062049 3:65357503-65357525 ACGGGTGGGCACAGGGGAAAAGG - Intronic
960875943 3:122295526-122295548 CCACGTGTGCACAGAGGAAAGGG - Intergenic
961222440 3:125211821-125211843 CGCCCTGAGCAGAGGGGAGAGGG + Intronic
961829760 3:129617499-129617521 CCGCAGGAGGCCAGGGGAGAAGG - Intergenic
962203330 3:133416903-133416925 ACGGGTGAGTAGAGGGGAGAGGG - Intronic
962203538 3:133417717-133417739 ACGGGTGAGTAGAGGGGAGATGG - Intronic
962203583 3:133417917-133417939 ACGGGTGAGTAGAGGGGAGATGG - Intronic
964148687 3:153497763-153497785 CAGCGAGAGCTGAGGGGAGAGGG - Intronic
968430241 4:554154-554176 CCACGTCAGCACGGGTGAGAGGG + Intergenic
969444834 4:7238909-7238931 CAGCGAGGGCACAGGGGTGATGG - Intronic
970994572 4:22250587-22250609 CCCCCTGAGCACAGGTAAGATGG - Intergenic
974351905 4:60759331-60759353 CAGCTTGGGCACAGGGGAGGTGG + Intergenic
977761719 4:100745966-100745988 CCCCATGATCTCAGGGGAGAAGG - Intronic
987924877 5:24327819-24327841 TCACGTGAGGACTGGGGAGATGG - Intergenic
995013930 5:107288974-107288996 CCTAGTGGGAACAGGGGAGAGGG - Intergenic
997234803 5:132266579-132266601 CAGAGTGAGCCCAGGGCAGAGGG + Intronic
1006750213 6:36372311-36372333 CAGCAGGAGCACGGGGGAGAAGG + Intronic
1007165791 6:39828029-39828051 CTGTGGGAGCACAGGTGAGAGGG - Intronic
1007597913 6:43062937-43062959 CCACCTGAGCACAGTGGAGTCGG + Exonic
1011502561 6:88007052-88007074 ACTCTTGAGCACAGAGGAGAGGG - Intergenic
1012384190 6:98658885-98658907 CCAGGTGAGCACAAAGGAGATGG + Intergenic
1013273091 6:108560502-108560524 CCGCGGGCGAAGAGGGGAGAGGG + Intronic
1013631470 6:111990065-111990087 CCGGGTGTTCACAGGTGAGAAGG + Intergenic
1018918750 6:168156068-168156090 CAGCGTGTGCACCGGGGGGATGG - Intergenic
1019294044 7:264604-264626 CCGCAAAAGCACAGGGGTGAGGG + Intergenic
1019339746 7:503408-503430 CCCCCTGAGCACAGGGGCGTGGG + Intronic
1019590114 7:1826645-1826667 CCGCGTGAGCACCGCGCTGAGGG + Intronic
1019826958 7:3292402-3292424 CCCCGTGAGCACAGTGTTGATGG - Intergenic
1022345773 7:29512904-29512926 CCACGTGAGAACAAGGGTGAAGG + Exonic
1022761068 7:33351843-33351865 CCGCGAGCGCACTGGGGAAATGG - Intronic
1024606860 7:51028699-51028721 CTGCGTGGGCACAGGGGTGGAGG + Exonic
1026898499 7:74024131-74024153 GGGCTTGAGGACAGGGGAGAGGG - Intergenic
1027360756 7:77406885-77406907 CCGCCTTAGCAGCGGGGAGAGGG - Intronic
1027503050 7:78979422-78979444 CCCTGGGAGCACAGAGGAGAAGG - Intronic
1028905753 7:96152327-96152349 CCTAGGGAGCAGAGGGGAGAGGG + Intronic
1029591845 7:101512166-101512188 CTGAGTCAGCACAGGGGAGGAGG + Intronic
1033781864 7:144680361-144680383 CAGCCTGAGCAGAGGAGAGAAGG + Intronic
1040906798 8:52477417-52477439 CCGCCTGAGTACAGGAGACAAGG + Intergenic
1047610811 8:126518973-126518995 CCAGCTGAGCAGAGGGGAGAAGG + Intergenic
1049708883 8:144054934-144054956 CAGAGTGGGCACAGGGGAGCAGG + Intronic
1050092736 9:2031752-2031774 CTGCGTGAGGACACGGGTGAGGG + Intronic
1050548554 9:6729454-6729476 CTGCTTGAGCCCAGGGGAGTGGG + Intronic
1054751011 9:68906101-68906123 TCGCTTGAGCCCAGGAGAGAAGG - Intronic
1055673161 9:78627410-78627432 CTGCAAGAGCAGAGGGGAGAGGG - Intergenic
1060154608 9:121310644-121310666 CAGCATTAGCCCAGGGGAGAAGG - Intronic
1061856373 9:133443886-133443908 CCACGTGGGCACGGGGGAGATGG - Intronic
1062451106 9:136616188-136616210 CCGAGTGGGCAGAGGGGAGACGG - Intergenic
1062464649 9:136675670-136675692 CTGGGAGAGCAGAGGGGAGACGG - Intronic
1062488018 9:136790925-136790947 CTGCTAGAGCGCAGGGGAGAGGG - Intergenic
1062488228 9:136791566-136791588 CCGGGTGGGCATAGGGGAGGTGG + Intronic
1187665921 X:21609321-21609343 CCGCCTGTGCTCTGGGGAGATGG - Exonic
1195903206 X:109819529-109819551 CTGAGGGAGCACAGGGAAGATGG + Intergenic
1198674760 X:139120073-139120095 GCGAGTGAGCTCAGGGGAAATGG - Intronic
1200234056 X:154459792-154459814 ACGCCTGAGCTGAGGGGAGAGGG - Intronic