ID: 925408436

View in Genome Browser
Species Human (GRCh38)
Location 2:3624753-3624775
Sequence ATGAACAAAAGTGTCTTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 421
Summary {0: 1, 1: 1, 2: 10, 3: 60, 4: 349}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925408436_925408443 9 Left 925408436 2:3624753-3624775 CCTACAAAGACACTTTTGTTCAT 0: 1
1: 1
2: 10
3: 60
4: 349
Right 925408443 2:3624785-3624807 TCAACATGGAAGCTTCTTTGGGG 0: 1
1: 0
2: 0
3: 20
4: 186
925408436_925408444 10 Left 925408436 2:3624753-3624775 CCTACAAAGACACTTTTGTTCAT 0: 1
1: 1
2: 10
3: 60
4: 349
Right 925408444 2:3624786-3624808 CAACATGGAAGCTTCTTTGGGGG 0: 1
1: 0
2: 5
3: 19
4: 173
925408436_925408445 11 Left 925408436 2:3624753-3624775 CCTACAAAGACACTTTTGTTCAT 0: 1
1: 1
2: 10
3: 60
4: 349
Right 925408445 2:3624787-3624809 AACATGGAAGCTTCTTTGGGGGG 0: 1
1: 0
2: 0
3: 15
4: 186
925408436_925408446 18 Left 925408436 2:3624753-3624775 CCTACAAAGACACTTTTGTTCAT 0: 1
1: 1
2: 10
3: 60
4: 349
Right 925408446 2:3624794-3624816 AAGCTTCTTTGGGGGGACTATGG 0: 1
1: 0
2: 0
3: 10
4: 103
925408436_925408440 -5 Left 925408436 2:3624753-3624775 CCTACAAAGACACTTTTGTTCAT 0: 1
1: 1
2: 10
3: 60
4: 349
Right 925408440 2:3624771-3624793 TTCATGGGGAGTTGTCAACATGG 0: 1
1: 0
2: 0
3: 15
4: 120
925408436_925408442 8 Left 925408436 2:3624753-3624775 CCTACAAAGACACTTTTGTTCAT 0: 1
1: 1
2: 10
3: 60
4: 349
Right 925408442 2:3624784-3624806 GTCAACATGGAAGCTTCTTTGGG 0: 1
1: 0
2: 0
3: 16
4: 169
925408436_925408441 7 Left 925408436 2:3624753-3624775 CCTACAAAGACACTTTTGTTCAT 0: 1
1: 1
2: 10
3: 60
4: 349
Right 925408441 2:3624783-3624805 TGTCAACATGGAAGCTTCTTTGG 0: 1
1: 0
2: 0
3: 16
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925408436 Original CRISPR ATGAACAAAAGTGTCTTTGT AGG (reversed) Intronic
901900345 1:12356243-12356265 ATGCTCAAAACTGTCTTTTTAGG + Intronic
902912223 1:19608220-19608242 ATGGACAAAAGTGTCATTGAAGG - Intronic
903400297 1:23039805-23039827 AACAACAAAAGTTTCCTTGTAGG + Intronic
905047027 1:35012896-35012918 ATGAACCAAAGGGTCATTCTTGG + Intronic
906003488 1:42447560-42447582 ATGAAGGAGAATGTCTTTGTGGG - Intronic
908998688 1:70191484-70191506 ATTAACAAACTTGTCTTTATGGG + Intronic
909794758 1:79719431-79719453 GTGAAAAAAAGTGGTTTTGTGGG - Intergenic
910491593 1:87778504-87778526 ATGAATGCAAATGTCTTTGTTGG - Intergenic
911220707 1:95242176-95242198 ATAAACATAAATGTCTGTGTTGG - Intronic
911329718 1:96512910-96512932 TTAAACAAAAGTGTTTTTCTGGG - Intergenic
911396119 1:97312938-97312960 ATGAAAGAAAGTGGCATTGTAGG + Intronic
915776914 1:158500504-158500526 ATAAAGAAAAGTGGTTTTGTTGG + Intergenic
915801748 1:158801113-158801135 ATGAAAAAAAGTCTGTTTCTTGG + Intergenic
916481878 1:165221544-165221566 TTGAACAAAGGTGTCTTTCTTGG - Intronic
917782331 1:178411665-178411687 ATGGACAAAAGTGTCACTGAAGG - Intronic
918219538 1:182424099-182424121 ATGCACAAAAGTGTCAATCTGGG - Intergenic
918497852 1:185159367-185159389 ATAAACATAAGTGTTTTTCTGGG + Intronic
918613086 1:186513912-186513934 ATGGTCAAAAGTGTCTCTGCAGG - Intergenic
919305206 1:195823525-195823547 ATGGACTAAAGTGTCATTGTGGG - Intergenic
919309774 1:195893115-195893137 CTAATGAAAAGTGTCTTTGTGGG + Intergenic
920279592 1:204832636-204832658 ATGAACAAAAATGGGTGTGTGGG - Intronic
920530193 1:206696141-206696163 ATGGACAAAAGTGTCATTGAAGG + Intronic
921978778 1:221231962-221231984 ATGAACAAAAGTATTTTTTTAGG - Intergenic
922096138 1:222444622-222444644 TTGGACAAAAGTGTCTGTGGTGG - Intergenic
924356273 1:243179587-243179609 ATGCAGAAAAATTTCTTTGTGGG + Intronic
1065573387 10:27095356-27095378 ATAAACAAAAGTGTTTCTGAAGG - Intronic
1065622736 10:27599932-27599954 ATGGACAAAAGTGCCCTTGTGGG - Intergenic
1065911533 10:30310590-30310612 AAAAAAAAAAGGGTCTTTGTAGG + Exonic
1066217948 10:33306193-33306215 ATGAACAGAAGTGTTTTTGCAGG - Intronic
1066493587 10:35918791-35918813 ATGTACAAAAATGTGTGTGTAGG - Intergenic
1066534960 10:36381324-36381346 GTAAACAAAAATCTCTTTGTGGG - Intergenic
1066598687 10:37080125-37080147 AGGAGCAAAAGTGTGTGTGTTGG + Intergenic
1068495932 10:57785653-57785675 AGGAACAAAAATGCCTTTTTTGG - Intergenic
1068583241 10:58766616-58766638 ATGGACAAGAGTACCTTTGTGGG + Intronic
1068638096 10:59369815-59369837 TTGAATAAAAGTGTATTTATTGG - Intergenic
1069009877 10:63360588-63360610 ATGAACAAAAATGTTTGTGTTGG - Intronic
1069228442 10:65974271-65974293 ATGAATGCAAGTGTCTTTTTGGG - Intronic
1069699400 10:70410376-70410398 AAGATAAAAATTGTCTTTGTTGG + Intronic
1071461629 10:85902488-85902510 ATTAACAAAAGTTTCATAGTAGG + Intronic
1071989933 10:91091845-91091867 ATGTACATATGTGCCTTTGTGGG - Intergenic
1072041995 10:91615652-91615674 ATGTACAAGAGTTTCTTTGTAGG + Intergenic
1072945029 10:99802185-99802207 TTGAATAAAAGTGTCATTGAGGG - Intronic
1073870395 10:107856696-107856718 ATGTTCAAAAGTGTCTTTTAGGG - Intergenic
1076163552 10:128264573-128264595 ATGAATAAAACTGTCTCTGGAGG + Intergenic
1077428013 11:2495964-2495986 AGGAATATAAGTCTCTTTGTAGG + Intronic
1077917113 11:6618667-6618689 AGGAACACAAGTGTCTTGGCAGG + Intronic
1078956593 11:16203654-16203676 GGGAACAAAAGTGTATATGTAGG - Intronic
1079091778 11:17485808-17485830 GTGAACAAATGAGTCTTTCTAGG + Intergenic
1079553468 11:21730209-21730231 ATCAGTAAAAGTGCCTTTGTGGG - Intergenic
1079671255 11:23174335-23174357 GTGAACAACAGGATCTTTGTTGG - Intergenic
1079738878 11:24033338-24033360 TTGACCTTAAGTGTCTTTGTAGG + Intergenic
1082280795 11:50269102-50269124 ATAAACAGAGTTGTCTTTGTTGG + Intergenic
1082594818 11:55064657-55064679 TTGAAAAAAACTGTCTTGGTAGG + Intergenic
1082682892 11:56200425-56200447 ATAAATACAAGTGTCTTTCTGGG + Intergenic
1083131838 11:60632326-60632348 CTGCACAAAAGTGTCTGTATGGG - Intergenic
1085684780 11:78611686-78611708 ATGAACAAAAGTAACCATGTTGG + Intergenic
1085891218 11:80581887-80581909 AGGAGCAAAAGTGTGTGTGTTGG - Intergenic
1086619165 11:88864389-88864411 ATGAACAAAGGTGTATTCTTAGG + Intronic
1086937680 11:92762873-92762895 ATGAACCACCGTGACTTTGTTGG - Intronic
1087132901 11:94684261-94684283 ACGGACAAAAGTCTCCTTGTGGG + Intergenic
1087619218 11:100523176-100523198 ATGAACACGAGTATCTTTGCAGG + Intergenic
1088775473 11:113078368-113078390 AAAAACAAAAGGGTCTTTGCAGG - Intronic
1090071222 11:123546225-123546247 ATGGACAGAAGTGTCTGTGGGGG + Intronic
1090095157 11:123735508-123735530 ATGAAGGAAGGAGTCTTTGTGGG + Intronic
1090914398 11:131150430-131150452 ATCAAAGAAAATGTCTTTGTTGG + Intergenic
1090944975 11:131421457-131421479 ATCAAAAAAAGAGTCTATGTGGG - Intronic
1092525575 12:9307635-9307657 ATGAATATAATAGTCTTTGTAGG + Intergenic
1092541704 12:9424185-9424207 ATGAATATAATAGTCTTTGTAGG - Intergenic
1092819328 12:12338649-12338671 ATGAACAAAGGTGTTTGTGTTGG - Intronic
1094219553 12:27976939-27976961 ATTAACAAAAGGGTGTGTGTGGG + Intergenic
1094511334 12:31098318-31098340 ATGAATATAATAGTCTTTGTAGG + Intronic
1095389219 12:41686075-41686097 ATGACAATAAGTGGCTTTGTAGG + Intergenic
1095797689 12:46238287-46238309 ATGAGGAAAAGTGTCTGAGTTGG + Intronic
1095881401 12:47141257-47141279 ATGGACAAAAGTGCCTTTGTGGG + Intronic
1097358574 12:58631372-58631394 ACAAACAAAAGTCTCTTTGTGGG + Intronic
1098659516 12:73074982-73075004 ATGGAAAAAAGTCTCTTTGTGGG + Intergenic
1098821248 12:75232545-75232567 ATGGACAAAATTGCCTTTGTGGG - Intergenic
1099231222 12:80027616-80027638 ATGTTCAAAAGTGCCTTTGTGGG - Intergenic
1099644874 12:85340160-85340182 ATGAAAAAAAGTGACTTTTTGGG + Intergenic
1101124590 12:101618697-101618719 ATAAATAAAAGAGTTTTTGTTGG - Intronic
1101225617 12:102685330-102685352 ATGATCAAATGTGTCATCGTTGG + Intergenic
1101527784 12:105547510-105547532 ATGGACCATGGTGTCTTTGTTGG + Intergenic
1102331947 12:112041179-112041201 AAAAAAAAAAGTGTCTTTTTAGG - Intronic
1103996450 12:124833510-124833532 CTCAGCAAAAGTGGCTTTGTAGG - Intronic
1104872647 12:132011208-132011230 ATGAACACTAGTGTCTTCTTGGG + Intronic
1105833479 13:24186999-24187021 ATTAAGAGAAGTCTCTTTGTTGG - Intronic
1106699581 13:32214770-32214792 CTGAACAACACTGTCTCTGTAGG - Intronic
1107192952 13:37611803-37611825 ATGAAGAAGAGTGTCTCTGCTGG - Intergenic
1108286339 13:48912459-48912481 ATGAACAAAAGTGTCCTTCCAGG + Intergenic
1111792960 13:92881911-92881933 ATGAACAAATGTGTATTAATGGG - Intergenic
1111968389 13:94884238-94884260 GAGAATAAAAGTTTCTTTGTAGG + Intergenic
1113070470 13:106415371-106415393 AAGAATAAAAGTGTTTATGTTGG + Intergenic
1113993156 14:16045004-16045026 GTGAACAAAAGTGCCTCTGCTGG + Intergenic
1114305309 14:21418031-21418053 ATATACAAACGTGACTTTGTAGG - Intronic
1114434198 14:22690537-22690559 CTGAAGAAAAGTGTACTTGTGGG - Intergenic
1115003947 14:28457119-28457141 ATGAACAAAATTGTGGTTATAGG + Intergenic
1115735447 14:36323133-36323155 ATCAACAAAAATGTCTTTTATGG + Intergenic
1116229046 14:42192688-42192710 ATGGGCAAAAGTATCTTTGTGGG - Intergenic
1116260255 14:42615235-42615257 ATGAACAAAAGTCTATTTTGGGG + Intergenic
1116354188 14:43906572-43906594 TTGAAAAAATGTGTCTCTGTTGG + Intergenic
1116681974 14:47983842-47983864 ATGGACAAAAGAGCCTTTGTGGG + Intergenic
1118456546 14:65949976-65949998 ATGAGCAAAAATGTGTTTGCAGG + Intergenic
1120104119 14:80474908-80474930 TTGAAAAAAAGGATCTTTGTAGG + Intergenic
1123104886 14:105836769-105836791 ATGAACCAAAGTGTGTTTATGGG + Intergenic
1123398799 15:19963743-19963765 AAGAACCAAAGTGTCCATGTAGG + Intergenic
1123461980 15:20481038-20481060 ATGAACAGATGTGACTTTGAAGG + Intergenic
1123501228 15:20882848-20882870 ATGGACAAAAGTGCCTTTATGGG - Intergenic
1123558480 15:21456553-21456575 ATGGACAAAAGTGCCTTTATGGG - Intergenic
1123594711 15:21893828-21893850 ATGGACAAAAGTGCCTTTATGGG - Intergenic
1123656076 15:22519348-22519370 ATGAACAGATGTGACTTTGAAGG - Intergenic
1124272666 15:28297027-28297049 ATGAACAGATGTGACTTTGAAGG + Intronic
1124309987 15:28614520-28614542 ATGAACAGATGTGACTTTGAAGG - Intergenic
1125260192 15:37814753-37814775 ATGAAATAAAGTGTATGTGTAGG - Intergenic
1125273790 15:37969715-37969737 ATGAACACAAGTGTACTTGAGGG - Intergenic
1126606954 15:50487585-50487607 GAAAACTAAAGTGTCTTTGTTGG + Intronic
1126924812 15:53572598-53572620 ATGAAAAAAAATTTCTTTGTGGG + Intronic
1128059546 15:64726279-64726301 ATGAGCAAAAGTGTCTCTTCTGG - Intergenic
1130229415 15:82085387-82085409 CTGAACAAAAGGATCTTTATAGG - Intergenic
1130680676 15:85993508-85993530 ATGCACAAGAGTGTCATTATGGG + Intergenic
1131589757 15:93735902-93735924 ATCAGCTAAAGTGTCTGTGTAGG - Intergenic
1202966830 15_KI270727v1_random:183703-183725 ATGGACAAAAGTGCCTTTATGGG - Intergenic
1133321995 16:4919941-4919963 ACCAAAAAAAGTGTATTTGTGGG + Intronic
1133957237 16:10455174-10455196 ATGGTGAAAAGAGTCTTTGTAGG + Intronic
1134863492 16:17583226-17583248 ATGATCAAAATTGTTTTTGTAGG + Intergenic
1137838991 16:51622295-51622317 AGAAACAAAAGTGTATTTTTAGG + Intergenic
1138485218 16:57337270-57337292 ATGAACAAGAGTTTATTTCTGGG + Intergenic
1140410623 16:74738511-74738533 ATGAACAAAACTGTCCTGGAGGG - Intronic
1140936635 16:79676842-79676864 GTGAACAAAAATGTATTTGGAGG - Intergenic
1141367745 16:83459024-83459046 AGGAAAACAAGTGTGTTTGTTGG - Intronic
1144666378 17:17105092-17105114 AACAACAAAAGTCTATTTGTAGG - Intronic
1144808476 17:17983406-17983428 ATGAAAACATGTGTCTCTGTTGG - Intronic
1146408299 17:32559100-32559122 ATGAACCAAATTGTCTTTCAAGG + Intronic
1146782451 17:35687044-35687066 GTGAACGAAATTGGCTTTGTGGG - Intronic
1148160743 17:45448695-45448717 GTTAACAACAGTGTCTGTGTCGG - Intronic
1148919846 17:51021074-51021096 ATGAGAAAATATGTCTTTGTGGG - Intronic
1149691401 17:58580002-58580024 AAGAACCAAAATATCTTTGTTGG - Intronic
1150392030 17:64795560-64795582 GTTAACAACAGTGTCTGTGTCGG - Intergenic
1150606653 17:66697351-66697373 ATGGACAAGAGTGTCTTTGTAGG + Intronic
1150714734 17:67562240-67562262 ATGAACAGAAGCCTCTGTGTAGG + Intronic
1151225335 17:72643725-72643747 ATGAGCAGAAGAGTCTTTGCTGG + Intergenic
1153699825 18:7681403-7681425 ATGAGCAAATGTGTAATTGTTGG + Intronic
1155501767 18:26493385-26493407 ATGAACAAAGATGTATTTTTTGG + Intronic
1156609942 18:38714016-38714038 ATGAACAATAGAGTCCTTCTAGG - Intergenic
1157467489 18:47959934-47959956 ATGAAAAGAAGTTTCTTAGTGGG - Intergenic
1158580184 18:58674010-58674032 ATGTAAAAAATTGTCTTTGGGGG + Intronic
1159422190 18:68235478-68235500 ATGAATTTAAGTGTCTTTCTAGG - Intergenic
1159624005 18:70670450-70670472 GTGGACAAAAGTGCCTTTGTGGG - Intergenic
1159843037 18:73423068-73423090 TTGTACAAAAGTGTCTTTTTAGG + Intergenic
1159942269 18:74417408-74417430 GTCATCACAAGTGTCTTTGTAGG + Intergenic
1160308962 18:77770324-77770346 AGCAACAAATGTGTGTTTGTCGG - Intergenic
1161188054 19:2936107-2936129 AAGAAAAAAAATGTCTCTGTGGG + Intronic
1162878326 19:13637697-13637719 ACAAACAAAAATGTCTTTGTGGG + Intergenic
1163374933 19:16924241-16924263 ATGAACACAAGTGGGTTTGGGGG + Intronic
1167869170 19:52353359-52353381 ATGGACAAAAGTGTATTTATAGG + Intronic
1167957331 19:53076736-53076758 ATGGACCAAATTGTCTTTGTGGG + Intronic
1168590668 19:57632032-57632054 ATGAACAAAACTGACTTTGCAGG + Intronic
925408436 2:3624753-3624775 ATGAACAAAAGTGTCTTTGTAGG - Intronic
925704704 2:6673416-6673438 TAGAACAAAAGTATCTTTGAAGG - Intergenic
926142505 2:10376198-10376220 ATAAAGAAAAGTGTCTTAATTGG - Intronic
926232160 2:11012485-11012507 ATGAAAAAATGTTTCTTTATTGG + Intergenic
927180939 2:20446561-20446583 GGGAACAAAAGTGTGTGTGTGGG + Intergenic
929372445 2:41242224-41242246 ACGAACAAAAGTGCCTTTGTGGG - Intergenic
930016640 2:46975220-46975242 ATGAAGTAGAGTGTCTTTGGGGG - Intronic
930228073 2:48814650-48814672 ATGAAAACAAGTGTGTTTGCTGG + Intergenic
930575500 2:53142281-53142303 ATGAAGAAGAGTGTCTCAGTTGG - Intergenic
932235066 2:70114393-70114415 ATGAGCAAAAATGCCTCTGTGGG + Intergenic
932280203 2:70484832-70484854 TTGAACAAAAGCAACTTTGTTGG - Intronic
933045805 2:77535251-77535273 ATGAACATATGTGTTTTGGTGGG + Intronic
933350583 2:81147304-81147326 ATGTACAAAAGGGTCTTCGTGGG - Intergenic
933575770 2:84065594-84065616 ATGAGCATAAGTGTGTTTGCTGG + Intergenic
933994057 2:87654996-87655018 ATGGACAAATGTGTCATTGAAGG - Intergenic
935139852 2:100343522-100343544 ATGAGAAAAAATGTTTTTGTGGG + Intergenic
935464412 2:103379430-103379452 ATGAACAACAGTACCTTTCTGGG - Intergenic
936299807 2:111295918-111295940 ATGGACAAATGTGTCATTGAAGG + Intergenic
938538540 2:132265858-132265880 GTGAACAAAAGTGCCTCTGCTGG - Intergenic
938665706 2:133533832-133533854 ATAAATAAAATTGTCTTTGAAGG - Intronic
939005236 2:136779356-136779378 AGAAAGACAAGTGTCTTTGTTGG + Intronic
940082809 2:149823691-149823713 ATGAACAAGAGTGCCTTTTTTGG - Intergenic
940459503 2:153946135-153946157 ATGTAGAAAAGTGTTTTTGATGG + Intronic
940890392 2:159030053-159030075 GTGAATAAAAGGGTTTTTGTGGG - Intronic
941314669 2:163977739-163977761 ATCATCAAAAGTGTTTATGTTGG + Intergenic
941454205 2:165695953-165695975 ATAAACCAAAGTATCCTTGTTGG + Intergenic
941690377 2:168495107-168495129 ATGAACAAAATTGTCCTCATTGG + Intronic
941972023 2:171361166-171361188 CTGCACAAAAATGTCTTTCTTGG + Intronic
943921821 2:193716761-193716783 ATAAACAAAAATGTCTATTTTGG - Intergenic
948611508 2:239170399-239170421 ATGAACAAAAATGTCCTATTTGG + Intronic
1169511083 20:6264674-6264696 ATAGAAAAAAGTTTCTTTGTTGG + Intergenic
1169824726 20:9754651-9754673 ATGAACCAGACTGCCTTTGTAGG - Intronic
1169904461 20:10587515-10587537 ATGAAGAAAAGTCCCTTTTTTGG + Intronic
1171811867 20:29750842-29750864 GTGAACAAAAGTGCCTCTGCTGG - Intergenic
1171907805 20:30914855-30914877 GTGAACAAAAGTGCCTCTGCTGG + Intergenic
1173412720 20:42828564-42828586 AGGAAGAAAAATGGCTTTGTGGG + Intronic
1174490056 20:50886539-50886561 AGGAACAATATTGTCCTTGTAGG + Intergenic
1175228948 20:57461403-57461425 CTGAACGAAGGTGGCTTTGTGGG + Intergenic
1176745486 21:10648486-10648508 AAGAACCAAAGTGTCCATGTAGG + Intergenic
1177390202 21:20459503-20459525 ATGGATAAAAGTGTCTTCGTGGG + Intergenic
1177460766 21:21406701-21406723 ATGAAAAGAAGTGACTTTATTGG - Intronic
1177941648 21:27419522-27419544 ATGAAGCATAGTGTATTTGTTGG + Intergenic
1179035328 21:37754440-37754462 ATGAACTGATGTGTCTTTCTAGG + Intronic
1179231746 21:39509924-39509946 GTTAACAAAAGTTTCTTTGGGGG - Intronic
1180314112 22:11262509-11262531 GTGAACAAAAGTGCCTCTGCTGG - Intergenic
1180341246 22:11621025-11621047 GTGAACAAAAGTGCCTCTGCTGG + Intergenic
1181854967 22:25774940-25774962 ATGCACAGAAGTGTGCTTGTAGG - Intronic
1182746473 22:32609654-32609676 ATAAATAAAAGTGTTTTTGGAGG + Intronic
1182752427 22:32652428-32652450 AAGAAACAAAGTTTCTTTGTTGG + Intronic
1184811245 22:46833846-46833868 ATAAACAAAGGCGTTTTTGTGGG + Intronic
949288981 3:2441442-2441464 ATGAACAAGAGTCTCTTTCGGGG - Intronic
949334972 3:2964749-2964771 CTGAATAATTGTGTCTTTGTAGG - Intronic
951181275 3:19661986-19662008 ATGAAAAAAAAAGTCTTTGTGGG + Intergenic
951342956 3:21511273-21511295 ATCAACAACATTTTCTTTGTGGG + Intronic
951733439 3:25836492-25836514 ATGAACAAAACTGCCTTTGTGGG + Intergenic
951846375 3:27089042-27089064 ATGAACTATAGAATCTTTGTTGG + Intergenic
953220030 3:40961074-40961096 ATGGACAAATGTGCCTTTGTAGG - Intergenic
954022089 3:47751196-47751218 CTGAATAAAAGTTACTTTGTCGG - Intronic
954493700 3:50931985-50932007 ATGGACAAGAGTACCTTTGTGGG - Intronic
955773428 3:62408706-62408728 ATTAACAGTAATGTCTTTGTAGG - Intronic
956512039 3:70004908-70004930 ATGAAAAAAAGTGGCTAAGTGGG - Intergenic
956840309 3:73134125-73134147 GGGAAGAAAAGTGCCTTTGTAGG + Intergenic
956967561 3:74479745-74479767 AGGAACAAAATTGTCTTTCTGGG - Intronic
958695963 3:97527378-97527400 ATGATAAAAAATTTCTTTGTGGG - Intronic
958729991 3:97951214-97951236 TTTAACAAAAGTGTCTATGAGGG + Intronic
958777147 3:98499464-98499486 ATGTAAAAAAGTGTGATTGTGGG + Intronic
959357146 3:105346240-105346262 ATCAACAACAGTATCTTTCTGGG - Intergenic
960114207 3:113877280-113877302 ATATAGAAAAATGTCTTTGTTGG - Intronic
960331762 3:116368347-116368369 ATTAACAAAAGTGGTTTTGGGGG - Intronic
962887842 3:139644125-139644147 ATGATAAAAAGGGTATTTGTTGG - Intronic
964642623 3:158926347-158926369 ATGAGCAACAGTGCCTTTGTGGG + Intergenic
965166517 3:165200101-165200123 ATGAACAAATGTTTATTTATAGG + Intergenic
965837956 3:172871684-172871706 ATGAACATAAGTGCCGTTGGGGG + Intergenic
966567259 3:181396902-181396924 ATGGAAAAAAGTGCCATTGTGGG - Intergenic
967051278 3:185786762-185786784 ATGAAAAAAAATGTATATGTAGG - Intronic
967416914 3:189229468-189229490 ATGAACAAAATTCTCTATCTTGG + Intronic
967450885 3:189621025-189621047 ATGAAAGAAAGTGTCTTAGATGG - Intergenic
968508659 4:985093-985115 AGCAACAGAATTGTCTTTGTGGG - Intronic
969263961 4:6052344-6052366 ATGAACAAAAGTCATTTTGTAGG + Intronic
970349735 4:15190203-15190225 ATTAACAAAAATGTCTTTCAGGG + Intergenic
970497654 4:16643159-16643181 AGGGATAAAAGTATCTTTGTGGG + Intronic
970632989 4:17974222-17974244 CTGATCAAAAGTGTATTAGTTGG + Intronic
971735476 4:30443893-30443915 ATGAACAAGAGTAGTTTTGTGGG - Intergenic
971747856 4:30607703-30607725 ATGAACATATGTGTGTGTGTGGG + Intergenic
972294773 4:37726489-37726511 ATTAATACAAATGTCTTTGTTGG + Intergenic
972756985 4:42057568-42057590 AGGAAGAAAAGTGGTTTTGTGGG - Intronic
973211823 4:47623697-47623719 ATGAACAAAAGGATCCTTGGAGG - Exonic
974417300 4:61625802-61625824 ATGAACAGAAGTGTGGGTGTTGG + Intronic
974481185 4:62445744-62445766 ATAGACAAAAGTTCCTTTGTGGG + Intergenic
974901484 4:68004470-68004492 GTGAATATAAGTCTCTTTGTAGG - Intergenic
977089028 4:92646732-92646754 ATGAACATAAGTATCCTTGAGGG + Intronic
977775158 4:100909519-100909541 ATGAACTGAAGAGTTTTTGTTGG + Intergenic
979245543 4:118500044-118500066 ATGCAGAAAAATTTCTTTGTGGG - Intergenic
979415121 4:120428307-120428329 ATGAATAAAAATATGTTTGTAGG - Intergenic
979801461 4:124914177-124914199 ATAGACAAAATTGCCTTTGTGGG - Intergenic
980784576 4:137535574-137535596 ATGAAGCAAAGTGTCTCTTTTGG + Intergenic
982166009 4:152614206-152614228 ATGGACAAAGGTGTCATTGAAGG + Intergenic
982695802 4:158598741-158598763 ATGAATAAAAGTTTATTTATGGG - Intronic
982778422 4:159465775-159465797 ATAGACAAAAGTTTCTTTGTGGG - Intergenic
985992825 5:3577467-3577489 ATGAACAAAAGAGGCTTAATTGG - Intergenic
986028450 5:3872563-3872585 ATGACCAAAATTATCTTTATGGG - Intergenic
986135460 5:4973541-4973563 ATAGACAAAAGTGTCGTTGGAGG - Intergenic
986135470 5:4973607-4973629 ATAGACAAAAGTGTCGTTGGAGG - Intergenic
986516300 5:8567304-8567326 AGGAACAAAAGTGTTTTGGAGGG - Intergenic
986814633 5:11395114-11395136 CTGAACAATAGTGTCATTATTGG + Intronic
987869456 5:23596125-23596147 ATGAACCAAAATGTGTTTCTAGG - Intergenic
987886032 5:23814234-23814256 AAGAACAAAAGTGTCTTAATTGG + Intergenic
989365667 5:40652756-40652778 CTGTACAAAAGAGTCTGTGTGGG - Intergenic
989506906 5:42236678-42236700 ATGATTAAAAGTGTCCTGGTTGG + Intergenic
990327897 5:54696212-54696234 ATGAACAGAGGAGTCTTTATGGG + Intergenic
990770368 5:59237014-59237036 ATGACCAGAAGTATCTTTGGAGG - Intronic
990801158 5:59605416-59605438 AAGAACAAAATTGTGTTTGATGG - Intronic
991991053 5:72339652-72339674 GTGAATTAAAGTGTCTTTGAAGG + Intronic
992048071 5:72917361-72917383 ATGAAGTAAAGGGTCATTGTAGG + Intergenic
992127012 5:73652573-73652595 AAGAAATAAAGAGTCTTTGTAGG + Intronic
992702787 5:79357983-79358005 ATAAAGACAAGTGTCTTTCTGGG - Intergenic
992824738 5:80537514-80537536 ATGGATAAAAGTACCTTTGTGGG - Intronic
992987848 5:82251720-82251742 ATCAATAATAGTGTTTTTGTTGG + Intronic
993111861 5:83667205-83667227 AAGAACAAAAGTATATATGTAGG - Intronic
993194393 5:84722445-84722467 ATGGACAAAAGTGCCTTTGTGGG + Intergenic
993862017 5:93147761-93147783 ATGATCAAAATTCTCTTTGTTGG - Intergenic
994409224 5:99385155-99385177 TTTAAAAAAAGTGTCTTTTTGGG + Intergenic
995012444 5:107272884-107272906 ATGAACAAACGCCCCTTTGTGGG + Intergenic
995852684 5:116562665-116562687 ATGGACAAAAGTGTCATTGAAGG - Intronic
996237686 5:121152359-121152381 ATGAACATACGTGTGTTTTTTGG + Intergenic
997554553 5:134784007-134784029 ATGGACAAAAGTTTCTTTTTGGG - Intronic
997863542 5:137441531-137441553 ATGAGCAAATGTGTATTTGCAGG + Intronic
999294140 5:150447605-150447627 ATGGACAAAAGTGTCATTGAAGG + Exonic
999625960 5:153520535-153520557 ATCATTAAAATTGTCTTTGTGGG + Intronic
999833692 5:155346060-155346082 ATTAAGGAAAATGTCTTTGTAGG - Intergenic
999879879 5:155850526-155850548 ATGATCAAAAGTGACATTGTGGG + Intergenic
1000171929 5:158711027-158711049 ATGTACCAAAATGTTTTTGTAGG + Intronic
1000670204 5:164052268-164052290 ATGTTAAAAAGTATCTTTGTGGG - Intergenic
1001068370 5:168559132-168559154 ATAAACAGAGTTGTCTTTGTTGG - Exonic
1001206131 5:169764791-169764813 ATGAATAAAAGGGCCTTGGTTGG + Intronic
1001427661 5:171634345-171634367 AAGAAAAAGAGTATCTTTGTTGG - Intergenic
1002311534 5:178318156-178318178 ATGAACAAGAGGGCCTTTTTTGG - Intronic
1002676135 5:180914760-180914782 ATGAACAAAAGTATTTTTGTAGG + Intronic
1003593300 6:7453655-7453677 ATGAATAAATGTGTCTCAGTTGG + Intergenic
1003703248 6:8494367-8494389 ATGCAGAAAAGTGAATTTGTGGG - Intergenic
1005020389 6:21412411-21412433 ATTAATCAACGTGTCTTTGTAGG - Intergenic
1007190929 6:40017798-40017820 CTGGACAAAAGTGTCCTTGTGGG + Intergenic
1008775606 6:55033566-55033588 ATTAACACAAGTGTATATGTAGG + Intergenic
1009735041 6:67665586-67665608 ATAATCAAAAATGTATTTGTAGG - Intergenic
1009914279 6:69973737-69973759 ATTAACAAAAATCTCTTTTTTGG + Intronic
1010832269 6:80544878-80544900 GTGAACAAAAGTGTCTTGTGAGG + Intergenic
1011781912 6:90799250-90799272 ATAAAGAAAAGTGGTTTTGTTGG + Intergenic
1011979657 6:93357115-93357137 AAGAACAAAAGGATCTGTGTGGG + Intronic
1014117403 6:117681088-117681110 ATGAACAATAGCCTCTTGGTAGG - Intronic
1014263742 6:119250707-119250729 ATGATTAAAAGTGTGTATGTCGG - Intronic
1014587716 6:123220907-123220929 ATGAACAAAAATGTCTAATTTGG + Intronic
1014759633 6:125342367-125342389 ATGAACAAAGATGTCTTTGGGGG + Intergenic
1014806086 6:125831289-125831311 ATGAACATAATTATCTTTTTTGG - Intronic
1014894013 6:126877789-126877811 ATGGACAAGAGTATCCTTGTAGG - Intergenic
1015336886 6:132049289-132049311 ATGAAATAAAGTGTTTTTTTTGG + Intergenic
1016071117 6:139740304-139740326 CTGAAGAAAACAGTCTTTGTGGG - Intergenic
1017341288 6:153325127-153325149 ATGTTCATCAGTGTCTTTGTAGG + Intergenic
1017387103 6:153899179-153899201 ATGAAATAAAATGTCTTTATTGG + Intergenic
1018151176 6:160940728-160940750 ATGGACAAAAGTGCCTCTGTGGG - Intergenic
1020410849 7:7889944-7889966 ATGATCAAACCTGTCTTTGGTGG - Intronic
1021413569 7:20355654-20355676 ATGAAAATAAGTATCTTTATGGG - Intronic
1021508243 7:21408536-21408558 ATGAACAAAATTCTGTTTGATGG + Intergenic
1021900293 7:25278542-25278564 AGAAACAAAAGTGTAGTTGTAGG - Intergenic
1021944643 7:25714804-25714826 ATTCAGCAAAGTGTCTTTGTTGG - Intergenic
1022027711 7:26464480-26464502 ATGAAAGAAAATGTCCTTGTTGG - Intergenic
1022071465 7:26919558-26919580 ATGTCCAACAGTTTCTTTGTGGG - Intronic
1022612224 7:31887587-31887609 ATGAACAAAATTGACCTAGTTGG + Intronic
1022837986 7:34135200-34135222 ATGAACAAAAATGGTTTGGTAGG + Intronic
1022974790 7:35547075-35547097 ATGAATGAAAGTGTCTTTTGGGG - Intergenic
1024778348 7:52815993-52816015 ATAGACAAAACTGCCTTTGTGGG + Intergenic
1024827226 7:53405283-53405305 ATGAACTAAAGTGTATCTATTGG - Intergenic
1027790271 7:82632765-82632787 ATTCACAAAAGTCTATTTGTTGG + Intergenic
1028897428 7:96057955-96057977 ATGGACTGAGGTGTCTTTGTAGG - Intronic
1030661476 7:112223671-112223693 CTGGACAAAAGCGCCTTTGTGGG - Intronic
1030694026 7:112564844-112564866 ATGAGCACATGTGTCTTTTTTGG + Intergenic
1030790156 7:113715712-113715734 AGCAACAAAAATGTCTTTGTAGG - Intergenic
1031391385 7:121218937-121218959 AGGAACAAACCTGTTTTTGTAGG - Intronic
1031502857 7:122542902-122542924 CTGAAAAATACTGTCTTTGTTGG - Intronic
1031692761 7:124810817-124810839 AAGAACAAAAATCCCTTTGTAGG - Intergenic
1033576557 7:142690848-142690870 GTTAACATAAGTGTCTTTGCAGG + Intergenic
1033671480 7:143497716-143497738 CTGAACAACAGTCTCTTGGTAGG + Intergenic
1035163861 7:156971971-156971993 TTTAACAAGAGTGTCTTTGCTGG + Exonic
1036023658 8:4878423-4878445 ATGATTAAAAATGTCCTTGTGGG + Intronic
1037987370 8:23298431-23298453 AAGGAAAAAAGTGTCTTTATTGG + Intronic
1039222220 8:35345128-35345150 ATGGAGAAAAGTGTATTTTTAGG - Intronic
1039659202 8:39445142-39445164 TTGAATAAAAGTGTTTTTGATGG - Intergenic
1039897172 8:41724810-41724832 ATGAATGAAAATCTCTTTGTCGG - Intronic
1041620221 8:59958509-59958531 ATGATCAAAGGTGTAATTGTAGG - Intergenic
1042316510 8:67431815-67431837 AAGAACAAAATTCTCTTTTTTGG + Intronic
1042330155 8:67570813-67570835 ATGAACAAAATGGTATTTGTAGG + Intronic
1042691566 8:71505430-71505452 TTTCACAAAAGTGTTTTTGTTGG - Intronic
1042733339 8:71961443-71961465 AGAAACAAAAGAGTCTTTGCTGG - Intronic
1042911229 8:73828626-73828648 ATTAAAAAAATTGTTTTTGTGGG + Intronic
1043508861 8:80930519-80930541 AGGAACCAAAGTAGCTTTGTGGG - Intergenic
1046441905 8:114267097-114267119 TTGATCAAAAGTATCTTTATAGG - Intergenic
1047316132 8:123734980-123735002 ACAAACAAAAGTGTCTCAGTAGG + Intronic
1047599331 8:126410558-126410580 ATGATCAAAAATGTGTTTGTAGG + Intergenic
1047791396 8:128207270-128207292 TTGAACAAATGTGACTTAGTAGG - Intergenic
1048016845 8:130505259-130505281 ATGAACTAAACAGTCTCTGTAGG - Intergenic
1050203044 9:3168820-3168842 ATGAAGAAAAGTGTCTTCTCTGG + Intergenic
1051511175 9:17879389-17879411 ATCAACAAAATTGTGTGTGTGGG - Intergenic
1051689131 9:19690723-19690745 ATGAACACAAGTGATTCTGTAGG + Intronic
1052116367 9:24652394-24652416 GGGAAAAAAAGTGCCTTTGTGGG - Intergenic
1052284254 9:26766995-26767017 ATGAGCAAACTTCTCTTTGTTGG - Intergenic
1055175618 9:73314155-73314177 GAGAAAAAAAGTGGCTTTGTGGG - Intergenic
1056285636 9:85084970-85084992 AGGTACAAAATTGTCTTTGTTGG + Intergenic
1056858696 9:90159327-90159349 ATGAGGAAAAGTATCTGTGTAGG + Intergenic
1057428185 9:94971164-94971186 AACAACAAAAGTCTCTTTGTGGG - Intronic
1058113947 9:101063756-101063778 ATTAAGAAAGGTGTCTTTGATGG - Intronic
1058226184 9:102366946-102366968 ATGTACAAAATTATCTTTGGGGG + Intergenic
1058284113 9:103154057-103154079 ACAAACAAAAGTCTCTCTGTGGG - Intergenic
1059572552 9:115455670-115455692 ATGAAGATAACTGTGTTTGTTGG + Intergenic
1059600029 9:115767110-115767132 AGGAACCAAAGTGTGTTTCTAGG + Intergenic
1060285826 9:122251437-122251459 AATAACAAAAGAGTCTTTGTGGG + Intronic
1061052045 9:128202672-128202694 GTGAAAAAAGGTATCTTTGTGGG - Intronic
1061875110 9:133539706-133539728 CTGGACAAAAATGCCTTTGTCGG + Intronic
1061992239 9:134165785-134165807 AAAAACAAAAGTGAATTTGTAGG + Intergenic
1203362424 Un_KI270442v1:228628-228650 GTGAACAAAAGTGCCTCTGCTGG - Intergenic
1185823005 X:3222633-3222655 ATGAGCACAAGTGTTTTTGTAGG + Intergenic
1185985418 X:4827263-4827285 AGAAACAAAAGTATCTCTGTAGG + Intergenic
1186042034 X:5491192-5491214 ATGCACATAATTTTCTTTGTAGG - Intergenic
1186067523 X:5782053-5782075 ATAAAATAAAGTATCTTTGTTGG + Intergenic
1186083537 X:5960295-5960317 ATGAATAAATGTGTGTGTGTGGG + Intronic
1186750751 X:12619432-12619454 ATGGACAAAAGTGGCTTTGTGGG + Intronic
1187135640 X:16544603-16544625 ATGAACAGAAATGTCTTCCTTGG + Intergenic
1187689651 X:21852404-21852426 ATGAACAAGAGTCTATTTATTGG + Intronic
1189409410 X:40756339-40756361 ACAGACAAAAGTGTCTTTGTGGG - Intergenic
1190246119 X:48691471-48691493 ATGAATAAAAGGGACTTTGGGGG - Intergenic
1190512182 X:51184942-51184964 ATGGACAAAAGTCTCTTTGTGGG + Intergenic
1191729502 X:64318162-64318184 AGGAACAGAAGTGTCTTTTAGGG + Intronic
1192299512 X:69885622-69885644 ACAGACAAAATTGTCTTTGTAGG + Intronic
1192332665 X:70190360-70190382 ATGGACCAAAGTACCTTTGTGGG + Intronic
1192494503 X:71606073-71606095 CTGAAGAAAAGTGTCTTGTTTGG - Intronic
1192776766 X:74253755-74253777 AAGAAGAAAAGTGTCTTGCTGGG - Intergenic
1192872122 X:75194742-75194764 ACCAACAAAAGTGTTTGTGTAGG + Intergenic
1193469384 X:81880538-81880560 ATGAACACAAGTGTCACTGAAGG - Intergenic
1193632928 X:83911948-83911970 ATGCATAAAAGTGCTTTTGTAGG + Intergenic
1193870095 X:86786773-86786795 ATGAACAAAATTATTTTTGGAGG - Intronic
1194534847 X:95094022-95094044 ATTGACAAAAGTGTCTTTGTGGG + Intergenic
1194606470 X:95985171-95985193 AGAAAAAAAAGTGTCTTTTTTGG + Intergenic
1194862427 X:99017371-99017393 ATGAACCAAAGTATATTTCTTGG - Intergenic
1195128083 X:101828649-101828671 ATGAACAACAGTGTATTTTTTGG + Intergenic
1196916711 X:120543809-120543831 ATGTAAAAAACTATCTTTGTAGG - Exonic
1197327505 X:125111908-125111930 ATGAACAAAAATGGATTTGAGGG + Intergenic
1197547677 X:127846065-127846087 ATGAACAAAATGGTGTTTGCCGG - Intergenic
1197678631 X:129358169-129358191 ATAAACAAAAAAGTCTGTGTTGG - Intergenic
1198551612 X:137751226-137751248 AGGTAAAAAAGTTTCTTTGTTGG + Intergenic
1199081279 X:143579356-143579378 AGGAAGAAAAGGGTCTTTTTTGG + Intergenic
1199200416 X:145081183-145081205 ATGGACAAAAGTGGCTGAGTTGG - Intergenic
1199265316 X:145820964-145820986 ATGCACCAATGTGTCTGTGTAGG - Exonic
1199347634 X:146760772-146760794 ATGGACAAAAGTGCCTTTGTAGG + Intergenic
1199470575 X:148191204-148191226 GTGAAGAAAAGTTTCCTTGTAGG + Intergenic
1200290104 X:154863667-154863689 ATGGACAAAAGTGTCTTTGTGGG + Intronic
1200925769 Y:8653273-8653295 AAGAAGAAAAGTATCTTTGTTGG - Intergenic
1200938967 Y:8762880-8762902 AAGAACAAGAGTTTCTTTGTTGG + Intergenic
1200981144 Y:9264287-9264309 AAGAACAAGAGTTTCCTTGTTGG + Intergenic
1201075824 Y:10187632-10187654 GTGAACAAAAGTGCCTCTGCTGG + Intergenic
1201774464 Y:17648308-17648330 GTGAACAAAAGTGCCTCTGCTGG + Intergenic
1201827092 Y:18257681-18257703 GTGAACAAAAGTGCCTCTGCTGG - Intergenic
1202129281 Y:21595453-21595475 AAGAACAAGAGTTTCCTTGTTGG - Intergenic
1202129738 Y:21598790-21598812 GAGAACAAAAGTGTCCTTGCTGG + Intergenic
1202173050 Y:22071830-22071852 ATGAAAAAAAGTGTTGTTGGAGG + Exonic
1202218310 Y:22514541-22514563 ATGAAAAAAAGTGTTGTTGGAGG - Exonic
1202324875 Y:23681514-23681536 ATGAAAAAAAGTGTTGTTGGAGG + Intergenic
1202545896 Y:25988540-25988562 ATGAAAAAAAGTGTTGTTGGAGG - Intergenic