ID: 925409129

View in Genome Browser
Species Human (GRCh38)
Location 2:3628629-3628651
Sequence ATTCGAGGAGGTGGTGCGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 115}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925409114_925409129 8 Left 925409114 2:3628598-3628620 CCTGTTGGGAAAGTGAGACCCCC 0: 1
1: 0
2: 1
3: 12
4: 221
Right 925409129 2:3628629-3628651 ATTCGAGGAGGTGGTGCGGTTGG 0: 1
1: 0
2: 1
3: 7
4: 115
925409116_925409129 -10 Left 925409116 2:3628616-3628638 CCCCCCACCCCCCATTCGAGGAG 0: 1
1: 0
2: 1
3: 22
4: 199
Right 925409129 2:3628629-3628651 ATTCGAGGAGGTGGTGCGGTTGG 0: 1
1: 0
2: 1
3: 7
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925409129 Original CRISPR ATTCGAGGAGGTGGTGCGGT TGG Intronic