ID: 925410045

View in Genome Browser
Species Human (GRCh38)
Location 2:3634790-3634812
Sequence ACGCACTGAGCACTCTGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 130}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925410041_925410045 -6 Left 925410041 2:3634773-3634795 CCCTGACGATGAAGGCAACGCAC 0: 1
1: 0
2: 0
3: 2
4: 47
Right 925410045 2:3634790-3634812 ACGCACTGAGCACTCTGGCAGGG 0: 1
1: 0
2: 1
3: 8
4: 130
925410032_925410045 30 Left 925410032 2:3634737-3634759 CCGTGGAGAGGGATTCAGAGGAG 0: 1
1: 0
2: 1
3: 18
4: 274
Right 925410045 2:3634790-3634812 ACGCACTGAGCACTCTGGCAGGG 0: 1
1: 0
2: 1
3: 8
4: 130
925410042_925410045 -7 Left 925410042 2:3634774-3634796 CCTGACGATGAAGGCAACGCACT 0: 1
1: 0
2: 0
3: 0
4: 23
Right 925410045 2:3634790-3634812 ACGCACTGAGCACTCTGGCAGGG 0: 1
1: 0
2: 1
3: 8
4: 130
925410040_925410045 -5 Left 925410040 2:3634772-3634794 CCCCTGACGATGAAGGCAACGCA 0: 1
1: 0
2: 0
3: 1
4: 38
Right 925410045 2:3634790-3634812 ACGCACTGAGCACTCTGGCAGGG 0: 1
1: 0
2: 1
3: 8
4: 130
925410039_925410045 -4 Left 925410039 2:3634771-3634793 CCCCCTGACGATGAAGGCAACGC 0: 1
1: 0
2: 0
3: 1
4: 46
Right 925410045 2:3634790-3634812 ACGCACTGAGCACTCTGGCAGGG 0: 1
1: 0
2: 1
3: 8
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925410045 Original CRISPR ACGCACTGAGCACTCTGGCA GGG Intronic
900103577 1:972955-972977 TGGCACTGAGGACTCAGGCAGGG - Exonic
900932274 1:5744934-5744956 ACGCTCTGAAGACTCAGGCAGGG + Intergenic
902113453 1:14102191-14102213 ACGCCCTCAGCACACTGGCATGG + Intergenic
902600192 1:17535697-17535719 ACTCACTGAGCACTCTGGTGAGG - Intergenic
903380907 1:22896287-22896309 AGGCAGGGAGCCCTCTGGCAGGG + Intronic
906154197 1:43604595-43604617 ACCCTCTGATCACTCTGGCCTGG + Intronic
910833753 1:91486653-91486675 ACCCACTCAGCATTCTGGCAAGG + Intergenic
912472519 1:109915306-109915328 AGGCAGTGAGCACCCTGTCATGG - Intronic
914287005 1:146236401-146236423 ATGAACTGAGCACTCTGCAATGG + Intergenic
914548037 1:148687143-148687165 ATGAACTGAGCACTCTGCAATGG + Intergenic
915315975 1:155029530-155029552 AAGCTGTGAGGACTCTGGCAAGG + Intronic
919494164 1:198242958-198242980 AAGCACTGAGCACTCTGGCGAGG - Intronic
923729197 1:236534039-236534061 ACGCAGTATTCACTCTGGCAAGG - Intronic
924549615 1:245063278-245063300 ACAGACTTAACACTCTGGCAAGG - Intronic
1065750368 10:28880299-28880321 ACACACTGAGCCCTTTGGAAAGG + Exonic
1073085841 10:100888174-100888196 AGTCACTGAGCTCTCTGGAAGGG - Intergenic
1073381063 10:103078378-103078400 AGGCACAGAGCCCTCAGGCAGGG - Exonic
1073786201 10:106892675-106892697 ACACACTATGAACTCTGGCAGGG - Intronic
1074447551 10:113533025-113533047 AGGCACTGAGCACTGAGGGAGGG + Intergenic
1077803908 11:5570651-5570673 ACATAGTAAGCACTCTGGCATGG + Intronic
1078461381 11:11517703-11517725 CGGGACTGAGCACTGTGGCAGGG - Intronic
1080924509 11:36742470-36742492 ATGCACTGAGAACCCTGGCTTGG + Intergenic
1083180587 11:60982248-60982270 ATGTACTGAGCCCTGTGGCAGGG + Intronic
1084778862 11:71395943-71395965 ATACACTAAGCACTGTGGCACGG - Intergenic
1085029340 11:73260192-73260214 ACACCCTGATCACTCTGGCCTGG - Intergenic
1085721492 11:78915947-78915969 ACGCACAGAGCAGTATTGCATGG + Intronic
1087056820 11:93944970-93944992 ATGAACTGAGCACTCTGCAATGG - Intergenic
1087119433 11:94558229-94558251 AAGCAGTGAACACTCAGGCAAGG + Intronic
1089347221 11:117798026-117798048 AGGCACTGGGGACTCAGGCATGG + Intronic
1090377971 11:126304873-126304895 ACGTGCTCAGCAATCTGGCAGGG + Intronic
1090529091 11:127571451-127571473 ACGCACAGAGTCCTTTGGCAAGG + Intergenic
1091785577 12:3241734-3241756 CCCCACTGGGCACACTGGCAAGG - Intronic
1091853982 12:3724092-3724114 ATGCACTGAGCACTAGGGCCGGG - Intronic
1092924274 12:13259357-13259379 AAGCACTTAGCGCTCTGGGAAGG + Intergenic
1094075020 12:26463369-26463391 AAGAACTGAGTACTCTGGCCGGG + Intronic
1096540880 12:52306311-52306333 GCACACTGAGAACCCTGGCAGGG - Intronic
1101236596 12:102795981-102796003 AAGCACAGAGCACTCAGGAATGG + Intergenic
1102965806 12:117124620-117124642 ACTCACTGAGTAGACTGGCAGGG - Intergenic
1104657005 12:130581033-130581055 ACACACTGTGCACTGAGGCAGGG + Intronic
1106119083 13:26843270-26843292 AGGCATTGAGCAATGTGGCAGGG + Intergenic
1114353262 14:21878194-21878216 ACTCACGGAGGACTCTGGCTGGG - Intergenic
1117301755 14:54437009-54437031 TCCCACTGAGCACTGTGCCAAGG - Intronic
1119327287 14:73768121-73768143 CCGCACTCAGCACTCTAGCCTGG + Intronic
1120287378 14:82521121-82521143 ACGCACTGAACACACTGGAATGG + Intergenic
1120848816 14:89150025-89150047 AGGCACTGAGCACTCCAGCCAGG + Intronic
1121888893 14:97571124-97571146 GCGTACAGAGCACTCTGGAAGGG - Intergenic
1122891104 14:104732647-104732669 GGGCACTGGGCACTCTGCCATGG + Intronic
1123020495 14:105395738-105395760 ACGCTCTGAGGACTGTGGCCTGG - Exonic
1124370051 15:29099401-29099423 ACACACTGAACTCCCTGGCAAGG + Intronic
1125720027 15:41840889-41840911 TCTCACTGAGCCCTCAGGCAAGG + Exonic
1126791960 15:52229852-52229874 ACGCACAGGGCACACTGGCTAGG + Intronic
1126794018 15:52245178-52245200 GCCCACTGAGCACTCTGCTATGG + Intronic
1128313567 15:66646438-66646460 ACGCACTGACCACTATCCCAGGG - Intronic
1132781207 16:1626829-1626851 ACACAGTGAGCACACAGGCAAGG - Intronic
1134022970 16:10934150-10934172 ACTCCCTGAGCCCTCTGGAAGGG + Intronic
1134467917 16:14495492-14495514 GAGTACTGAGCACTCAGGCAAGG + Intronic
1138222559 16:55265324-55265346 CCTCACTGAGCCTTCTGGCAAGG + Intergenic
1141955738 16:87370273-87370295 CCGCACTCAGCACACTGGGATGG + Intronic
1142075677 16:88116249-88116271 ACGCACTGAGACCACAGGCAGGG + Intronic
1144392027 17:14802547-14802569 CAGCACTGAGCAGTTTGGCATGG - Intergenic
1147614085 17:41818303-41818325 AGGCACTGGGGACTGTGGCATGG + Intronic
1152962309 18:87113-87135 ATCCACTGAGCACTCTGCTAGGG - Intergenic
1153343866 18:4005555-4005577 ACGTACTGGGTACTCTGGGATGG + Intronic
1156217133 18:35011139-35011161 CAGCACTCAGCACTCTGGAATGG - Intronic
1156340420 18:36205572-36205594 TTGCACTGAGCACTCAGGCATGG + Intronic
1163583395 19:18151513-18151535 ACCCACTGGGCACTCTGGTGAGG + Exonic
1164743624 19:30594936-30594958 CAGCACTGAGCACACAGGCATGG - Intronic
1166717043 19:44975180-44975202 ACTCACAGAGCACTCAGGCTTGG + Intronic
1166863073 19:45820887-45820909 ACTCACTGAGCACTCTGCGCTGG - Intronic
925410045 2:3634790-3634812 ACGCACTGAGCACTCTGGCAGGG + Intronic
927040957 2:19229912-19229934 ACCAACTGAGCAATCTGGAAAGG - Intergenic
929836322 2:45403942-45403964 ACGTGCAGAGCACTGTGGCAGGG + Intronic
931972498 2:67604597-67604619 ACACACTCATCACACTGGCATGG + Intergenic
937251518 2:120527042-120527064 ACGCACACAGCACACGGGCATGG + Intergenic
938458805 2:131484457-131484479 ACGCAAGGAGCACACTGCCAAGG + Intronic
940902358 2:159137399-159137421 AGGCACTGGGCACTCTGGGCAGG + Intronic
940985692 2:160049941-160049963 ACACACTGAGGCCTGTGGCAGGG + Intronic
945680899 2:212912968-212912990 AGGCAGAAAGCACTCTGGCACGG - Intergenic
1173135207 20:40433322-40433344 AGGCACTGAGCACCCTGCCCTGG + Intergenic
1173567275 20:44051017-44051039 CTGGACTGAGCTCTCTGGCAGGG + Intronic
1173984355 20:47249703-47249725 ACACACTGAGCCATCTGGCTGGG - Intronic
1176251382 20:64122138-64122160 AGGAGCTGAGAACTCTGGCAGGG - Intergenic
1178054251 21:28781407-28781429 ATGCATTGGGAACTCTGGCATGG - Intergenic
1179494783 21:41764605-41764627 AAGCACTGAGAAATGTGGCAGGG + Intronic
1181001589 22:19990233-19990255 ATGCAATGAACACTGTGGCAGGG + Intronic
1185198622 22:49489073-49489095 TCGTCCTGAGCACTCTGGCCAGG + Intronic
951334002 3:21399207-21399229 ACAAACTGTGAACTCTGGCATGG - Intergenic
956119902 3:65955850-65955872 ACAAACAGAACACTCTGGCATGG - Intronic
956768362 3:72503795-72503817 ACACACGGAGGACTGTGGCATGG - Intergenic
961552990 3:127679737-127679759 ATGCCCTGAGCAGGCTGGCAGGG - Intronic
962691910 3:137907543-137907565 ACACACTAAGCTCCCTGGCAGGG + Intergenic
969511197 4:7618918-7618940 CCGCACTGTGCACACAGGCATGG - Intronic
971056082 4:22914238-22914260 AGGAACTGAACACTCTGGAATGG - Intergenic
974033344 4:56795890-56795912 ATTCAGGGAGCACTCTGGCAAGG - Intergenic
975363014 4:73493925-73493947 AAACACTGAGCACTCTGACTTGG - Intronic
975521464 4:75306127-75306149 ACGCCTTGGGCACTCTTGCAAGG - Intergenic
992940960 5:81760865-81760887 AGGCACTAAGCACTCTAGAAAGG - Intergenic
994118938 5:96091892-96091914 ACACAGTGAGCACTCAGTCAGGG + Intergenic
999490383 5:152044436-152044458 AGGCACTGAGCACTATTCCAAGG + Intergenic
1002162110 5:177320493-177320515 AGGCACTGAACACTCTAGCCTGG - Intergenic
1003399095 6:5776796-5776818 ACCCACTGAGGACTCAGGCCTGG - Intergenic
1003406199 6:5829007-5829029 ACCTACTGACCTCTCTGGCATGG + Intergenic
1005281949 6:24283856-24283878 AGGCACTGGGCACTGTGCCAGGG + Intronic
1005911364 6:30312642-30312664 TGGCACTGAGCACTCAAGCAAGG + Intergenic
1010036856 6:71335691-71335713 ACCCACTGAGCACTGTGGCTAGG - Intergenic
1018649733 6:165983386-165983408 AGACCATGAGCACTCTGGCATGG + Intronic
1018867968 6:167760059-167760081 ATGGAGTCAGCACTCTGGCAGGG + Intergenic
1018913268 6:168116562-168116584 AAGCACTGTGCTCCCTGGCAAGG + Intergenic
1020513170 7:9084881-9084903 ACACACTAAGCAGTCTGACAAGG + Intergenic
1021085958 7:16421255-16421277 CCGCGCTGACCACTCAGGCAAGG + Exonic
1023009063 7:35909022-35909044 AAGTAATGAGCACTCTGGCATGG + Intergenic
1023017116 7:35979571-35979593 AAGCAATGAGCACCCTGGCATGG + Intergenic
1024112548 7:46161903-46161925 ACACACTGAGCTCTGTGCCAGGG - Intergenic
1024684595 7:51731364-51731386 ACTCAATGAGCACACTGGGAGGG + Intergenic
1027580055 7:79981536-79981558 AGGCATAAAGCACTCTGGCATGG - Intergenic
1028271284 7:88793386-88793408 AGGCACTGAGGAATATGGCAGGG - Intronic
1029629642 7:101742476-101742498 ACGTACTGACCACTCTGAGAAGG + Intergenic
1030386011 7:108869176-108869198 AAGCAGTGAGCATTCTGGGAGGG + Intergenic
1031484980 7:122315042-122315064 AGAAACTGAGCACTCTGGAAAGG - Intergenic
1033542550 7:142370624-142370646 ATGCACTGATCTCTTTGGCATGG + Intergenic
1034203171 7:149294994-149295016 TCGCACTGCGCACACTGGAAGGG - Intronic
1039966281 8:42286455-42286477 ACACACAGAGGACTGTGGCAAGG - Intronic
1040545360 8:48394571-48394593 AGGCACTGAGGATTCTGGCCGGG + Intergenic
1041183433 8:55272625-55272647 AGGCACTGAACATACTGGCAGGG - Intronic
1047773143 8:128046696-128046718 ACTCACAGAGCAGTGTGGCATGG - Intergenic
1048187026 8:132250742-132250764 GCTCACTGGGCACTCTGTCATGG + Intronic
1048199407 8:132359404-132359426 ACACAGTGAGCACCCTGGTAGGG - Intronic
1052824629 9:33166393-33166415 TTGCACTGAGAACTCTGGTAGGG - Intronic
1053559807 9:39179501-39179523 ACTCTCTCAGCACTCTGTCAGGG + Intronic
1053823918 9:41999729-41999751 ACTCTCTCAGCACTCTGTCAGGG + Intronic
1054137309 9:61439454-61439476 ACTCTCTCAGCACTCTGTCAGGG - Intergenic
1054606654 9:67187634-67187656 ACTCTCTCAGCACTCTGTCAGGG - Intergenic
1057952537 9:99381152-99381174 AAGCACTTAGCACTGTGGCCTGG - Intergenic
1061027893 9:128062397-128062419 AGGCACTGAGCGGTGTGGCAGGG + Exonic
1062435327 9:136544467-136544489 GCTCACTGAGGAGTCTGGCAGGG + Intronic
1062735833 9:138137004-138137026 ATCCACTGAGCACTCTGCTAGGG + Intergenic
1190312620 X:49127777-49127799 AAGCTCTGGGCATTCTGGCATGG + Intergenic
1193768559 X:85561328-85561350 ACACACTGAGCTCTCTGGGCAGG - Intergenic
1197675203 X:129322526-129322548 ACGTACTGAGCCCTATGGGAGGG - Intergenic
1201314892 Y:12634200-12634222 CTGCACTGAGCACTCCAGCAAGG + Intergenic