ID: 925411628

View in Genome Browser
Species Human (GRCh38)
Location 2:3643054-3643076
Sequence GCAGTGCCCCCAAGCCATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 180}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925411618_925411628 18 Left 925411618 2:3643013-3643035 CCTGACAGACGCCACTGCGCCCT 0: 1
1: 0
2: 0
3: 6
4: 107
Right 925411628 2:3643054-3643076 GCAGTGCCCCCAAGCCATGGAGG 0: 1
1: 0
2: 2
3: 15
4: 180
925411619_925411628 7 Left 925411619 2:3643024-3643046 CCACTGCGCCCTTCAGCTCCCCT 0: 1
1: 0
2: 1
3: 52
4: 514
Right 925411628 2:3643054-3643076 GCAGTGCCCCCAAGCCATGGAGG 0: 1
1: 0
2: 2
3: 15
4: 180
925411616_925411628 29 Left 925411616 2:3643002-3643024 CCTCTTCCATTCCTGACAGACGC 0: 1
1: 0
2: 0
3: 7
4: 141
Right 925411628 2:3643054-3643076 GCAGTGCCCCCAAGCCATGGAGG 0: 1
1: 0
2: 2
3: 15
4: 180
925411621_925411628 -2 Left 925411621 2:3643033-3643055 CCTTCAGCTCCCCTCAGCCCTGC 0: 1
1: 0
2: 7
3: 98
4: 858
Right 925411628 2:3643054-3643076 GCAGTGCCCCCAAGCCATGGAGG 0: 1
1: 0
2: 2
3: 15
4: 180
925411620_925411628 -1 Left 925411620 2:3643032-3643054 CCCTTCAGCTCCCCTCAGCCCTG 0: 1
1: 1
2: 2
3: 76
4: 660
Right 925411628 2:3643054-3643076 GCAGTGCCCCCAAGCCATGGAGG 0: 1
1: 0
2: 2
3: 15
4: 180
925411617_925411628 23 Left 925411617 2:3643008-3643030 CCATTCCTGACAGACGCCACTGC 0: 1
1: 0
2: 1
3: 10
4: 131
Right 925411628 2:3643054-3643076 GCAGTGCCCCCAAGCCATGGAGG 0: 1
1: 0
2: 2
3: 15
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925411628 Original CRISPR GCAGTGCCCCCAAGCCATGG AGG Intronic
900514537 1:3074980-3075002 GGAGTGCTCCCAAGCTTTGGTGG + Intronic
901331214 1:8410211-8410233 GCCGTGTCCCCCAGCCAGGGCGG - Intronic
901664921 1:10820539-10820561 GAAGAGCCCCCAACCCCTGGAGG + Intergenic
907462387 1:54612601-54612623 GACGTACACCCAAGCCATGGTGG - Exonic
907884070 1:58577139-58577161 GCCGGGGCCCCGAGCCATGGTGG + Exonic
911744051 1:101419550-101419572 GCAGTTCCACCGAGCCAAGGAGG + Intergenic
912083953 1:105976402-105976424 GCAGTTCACCCCTGCCATGGAGG + Intergenic
912852637 1:113140448-113140470 ACATTGGTCCCAAGCCATGGAGG + Intergenic
919102142 1:193108069-193108091 GCAGATTCCCCAAGCCATGTAGG - Intergenic
919368881 1:196700725-196700747 CCAGTGCCCCCATGCCACTGGGG + Intronic
924610622 1:245570569-245570591 TCTGTGCCCACAACCCATGGGGG - Intronic
1063147471 10:3309040-3309062 GCTGTGCCCCCAAGCCTCAGGGG - Intergenic
1063300036 10:4842919-4842941 GCAGTGCCCTCAGGCCACGTGGG - Intronic
1064011745 10:11741772-11741794 GCAGTGACCCTAAGCCCTGGGGG + Intergenic
1066465809 10:35649354-35649376 GCAGTGATCCCAAAACATGGTGG + Intergenic
1068016312 10:51521001-51521023 GCAGTGCCTCCTGGGCATGGTGG + Intronic
1070510683 10:77157951-77157973 TCCCTGCCCCCAACCCATGGGGG - Intronic
1074550739 10:114439879-114439901 GCAGTGTCCCCAAGGCCTGCAGG + Intronic
1076278452 10:129225199-129225221 GCAGGGCCCCTCAGACATGGTGG - Intergenic
1077022814 11:426755-426777 TCAGTGCCCCCAAGCCACCAGGG - Intronic
1077509247 11:2947442-2947464 GCTGTGCCCTCAAGGCACGGGGG - Intronic
1077987168 11:7364840-7364862 GCAGAGCTCCCCAGCCATGAAGG - Intronic
1081537043 11:44003948-44003970 GCTGTTCCCCCAGGCCTTGGAGG + Intergenic
1083226993 11:61291489-61291511 GCAGTGCCCACCACCCATAGAGG + Exonic
1083677028 11:64332039-64332061 CCTGTGCCTCCAAGCCATGCTGG - Intergenic
1085296951 11:75436688-75436710 GCACTGACACCAAGCCATGGTGG + Intronic
1085504415 11:77048919-77048941 GTAGTGGGCCCAAGGCATGGTGG - Intergenic
1085515073 11:77107005-77107027 GCAGGGACCCCCAGCCTTGGGGG - Intronic
1089620008 11:119716755-119716777 GCTGTGCCCCCAACCCCAGGAGG + Intronic
1089621210 11:119723419-119723441 GCAGTGGTCCCAGGCCCTGGTGG - Intronic
1089679985 11:120113935-120113957 GCTGTGACCTCAAGCCAGGGAGG - Intronic
1089702115 11:120251592-120251614 GTAGTCCCCCCCAGACATGGAGG + Intronic
1090491248 11:127162722-127162744 TCAGTGCCCCCCAGCCTTGCAGG - Intergenic
1093019310 12:14188299-14188321 GCAGAGCCCCTAAGTCATGCTGG - Intergenic
1094413465 12:30192279-30192301 GGACTGACCCAAAGCCATGGGGG + Intergenic
1100981760 12:100167582-100167604 GCAGTTACCGCAGGCCATGGAGG - Intergenic
1102509420 12:113403990-113404012 TCAGTGGCCTCAAGCCAGGGGGG - Intronic
1104090772 12:125515089-125515111 GCAGTGTCGCCACTCCATGGCGG + Intronic
1104415513 12:128594203-128594225 GCAGTGTCCCCACCCCAGGGGGG + Intronic
1104847571 12:131854409-131854431 GCTGTGCCCCCAGGCCCAGGAGG + Intergenic
1104934077 12:132355267-132355289 GCGGTGTCTCCAAGCCAAGGTGG + Intergenic
1107831052 13:44374010-44374032 TCAGAGCGCACAAGCCATGGTGG + Exonic
1108486030 13:50926013-50926035 GCACTGCACACAAGCCATGCAGG - Intronic
1110185395 13:72668336-72668358 GCAGGCCCCCCAGGGCATGGTGG + Intergenic
1112499951 13:99935168-99935190 GGAGTACCCCCCAGCCATTGGGG + Intergenic
1113766483 13:112883769-112883791 GCAGGGCTGCCAAGCCAGGGCGG - Exonic
1113802563 13:113094202-113094224 GCAGTGCCCCTCAGCCAGGAGGG - Intronic
1114673944 14:24429048-24429070 GCAGAGCCCCTCAGCCATGTTGG - Exonic
1115338994 14:32272551-32272573 GCAGTGGGTCCAACCCATGGAGG + Intergenic
1115836981 14:37417222-37417244 GCAGTGAGCAGAAGCCATGGAGG - Intronic
1117932275 14:60855618-60855640 GCAGTGGGTCCAACCCATGGAGG - Intronic
1118633189 14:67724677-67724699 TCAGAGCCCCCAAGCCTAGGAGG - Intronic
1119070823 14:71582057-71582079 CCAGTGCACCCAACCCATGGTGG - Intronic
1122886953 14:104714435-104714457 CCAGTGCCCCCAGCCCTTGGAGG + Exonic
1123771178 15:23530981-23531003 GCTTTGCCCACCAGCCATGGGGG - Intergenic
1124099805 15:26682787-26682809 GCAGTGCCCCCTATGCATGGAGG - Intronic
1125187137 15:36944012-36944034 GCTGTGCCTCCAATCCATTGCGG - Intronic
1127457115 15:59165236-59165258 GCAGTACGCGCAAACCATGGGGG + Intronic
1128089501 15:64909776-64909798 ACAGTGGCCCCAGGCCATCGCGG - Intronic
1128520935 15:68374526-68374548 GTGCTTCCCCCAAGCCATGGAGG + Intronic
1131666178 15:94573233-94573255 GCAGTGCCTCCAGGCCAGGAAGG - Intergenic
1132225677 15:100139428-100139450 GGAGTGCCCCCGAGCTATAGGGG + Intronic
1132343074 15:101090208-101090230 GCTGGGCCACCAAGGCATGGGGG - Intergenic
1132653461 16:1031776-1031798 GCTGTGCCCGCAATCCAGGGCGG - Intergenic
1132733979 16:1376465-1376487 GGAGTGCACCCCAGCCCTGGAGG - Intronic
1133165903 16:3947040-3947062 GCAGTGGCCGCAAGCCCTGGAGG - Intergenic
1134579005 16:15356192-15356214 GCAGTGCCCTCCAGCCTGGGGGG - Intergenic
1134723581 16:16401358-16401380 GCAGTGCCCTCCAGCCTGGGGGG + Intergenic
1134943848 16:18310512-18310534 GCAGTGCCCTCCAGCCTGGGGGG - Intergenic
1135374553 16:21934373-21934395 GCAGTGCCCTCCAGCCTGGGGGG + Intergenic
1136154913 16:28376131-28376153 GCAGTGCCCTCCAGCCTGGGGGG - Intergenic
1140476686 16:75242579-75242601 GCAGGGCCTCCAGGCCCTGGGGG + Exonic
1141482830 16:84318298-84318320 CCATTGCCACCAAGCCATCGAGG - Exonic
1141975513 16:87513396-87513418 GCAGTGCCACCAAGCCTGAGGGG - Intergenic
1142225813 16:88877128-88877150 GCAGGGCCCCACAGCCGTGGTGG - Exonic
1142737399 17:1909900-1909922 AAGGTGCCCCCAGGCCATGGGGG + Intergenic
1142887068 17:2919559-2919581 GCAGGGCCTAAAAGCCATGGGGG + Intronic
1143116009 17:4582255-4582277 CCAGGGCCCCCAGGCCTTGGTGG + Intergenic
1145011762 17:19372331-19372353 GCAGGGCCCCAAGGCCATGCAGG - Intronic
1145115080 17:20202218-20202240 GCAGTGCGCTCAAGCATTGGGGG + Intronic
1146505557 17:33401501-33401523 CCAGTGCAGCCAAGCGATGGAGG - Intronic
1147210517 17:38870298-38870320 GCAGTGCTCCGAATCCAGGGAGG + Intronic
1147937956 17:44024382-44024404 GCAGTCCCCAAAAGCCCTGGAGG + Intergenic
1150090677 17:62322450-62322472 GCAGTGGCTCCAACCCACGGAGG + Intergenic
1150138403 17:62708680-62708702 TGAGTGCCCCCAACCCATGCAGG + Intronic
1150259190 17:63774406-63774428 CCAGTGCCCCCAAGGACTGGCGG - Intronic
1150851215 17:68705362-68705384 GAGGTGCTCCCAACCCATGGAGG - Intergenic
1151398689 17:73841852-73841874 TCAGTGCCACCAGGCCATGCTGG - Intergenic
1152506719 17:80754235-80754257 GCAGGGACCCCAACCCATGTGGG + Intronic
1155073692 18:22337542-22337564 GAGGTGCCCCCAAGCTCTGGAGG - Intergenic
1159781756 18:72668153-72668175 GCAGCTCCCCAAAGCCATGGGGG + Intergenic
1161468555 19:4445313-4445335 GCAGAGCCCCCATCCCTTGGGGG - Exonic
1162446987 19:10729492-10729514 GCTGTTCCCCCAAGTCCTGGCGG - Intronic
1163517243 19:17772453-17772475 TCAGCGCTTCCAAGCCATGGAGG + Exonic
1167711675 19:51115511-51115533 GCTGTCCCCCCAAGACAGGGTGG - Intergenic
1168700747 19:58437986-58438008 GCTGAGTCCCCAAGCCAAGGTGG - Intronic
925411628 2:3643054-3643076 GCAGTGCCCCCAAGCCATGGAGG + Intronic
925424047 2:3734140-3734162 GTACTGCCCCAAAGGCATGGCGG + Intronic
926615694 2:14994736-14994758 GCAGAGCCCACAATCCATGTGGG - Intergenic
926685076 2:15691910-15691932 GCAGTGTCCACAGGCCATGTTGG + Intronic
927515414 2:23669137-23669159 TCAGTGCCCCCAGGCCAGGAAGG + Intronic
927638558 2:24832792-24832814 GCAGTGCCCACAAGCCAAGGAGG - Intronic
929823871 2:45295030-45295052 ACAGTGCCCCCAGACCTTGGAGG - Intergenic
935472536 2:103477681-103477703 GCCGTGCCCCCTAGCTATGCTGG - Intergenic
935589784 2:104835792-104835814 GCAGGGCGCCAAACCCATGGAGG - Intergenic
936027806 2:109046887-109046909 GCAGTGACCCCAACCCCTGCCGG + Intergenic
939286737 2:140141017-140141039 GGAGTTGCCCAAAGCCATGGAGG + Intergenic
939988055 2:148851482-148851504 GCAGGGACCCCAAGCCAAAGAGG - Intergenic
940563137 2:155326989-155327011 GTAGTGCCCCTAAAACATGGTGG - Intergenic
941281569 2:163558311-163558333 GCTCTGCCCCCAAACCCTGGTGG - Intergenic
946441033 2:219696231-219696253 GCATTTCCCCTAAGCCATGGGGG + Intergenic
947142669 2:227033862-227033884 GCAGTGACCCCAAGCCTGGGAGG - Intronic
947666836 2:231911243-231911265 GCATTTCCCTGAAGCCATGGAGG + Intergenic
948875150 2:240822568-240822590 GCAGTGCCACCAAGCCCCTGGGG - Intergenic
948876573 2:240832729-240832751 GAAGTGCGGCCAAGCCGTGGGGG + Intergenic
948958538 2:241314929-241314951 GCAGTGCCTCCAGGCCACGCGGG + Intronic
1169213310 20:3779273-3779295 GCAGTGCGCCCCAGGCGTGGTGG - Exonic
1170912075 20:20582632-20582654 GCAGGGCACCCAAGCCAGTGAGG - Intronic
1172440290 20:34960677-34960699 GCAGTGGCCCCCAGCCAGGTGGG - Intergenic
1175961830 20:62641331-62641353 GCAGGAGCCCCAAGCCCTGGAGG + Exonic
1176166752 20:63678325-63678347 GCGGTGTCACCAAGCCAGGGAGG + Exonic
1179029506 21:37708344-37708366 ACAGTGTCCCCAAGCTGTGGAGG + Intronic
1182147096 22:28003240-28003262 GCAGTGCCACCACACCGTGGAGG + Intronic
1182335543 22:29581109-29581131 GCCCCGCCCCCAAGCCCTGGTGG + Exonic
1182494380 22:30695622-30695644 GCAGTGTCCGCCAACCATGGAGG - Intronic
1183246447 22:36697395-36697417 GCAGTAGACCCAAGCCACGGTGG - Intronic
1183286336 22:36966750-36966772 GCAGGTCCCCAAAGCCATCGTGG - Intergenic
1183584719 22:38746273-38746295 GCAGTGACTCTCAGCCATGGCGG - Intronic
1184373366 22:44096855-44096877 GCAGTGCCCAGAGGCCAGGGTGG - Intronic
1185070441 22:48652956-48652978 GCACGGACCCCAAGCCATGAGGG - Intronic
1185399715 22:50609553-50609575 GCAAAGCCCCGAAGCCATGGGGG + Intronic
952147990 3:30554474-30554496 GAAGTGCCCTGAAGCCATGTGGG + Intergenic
953412192 3:42696916-42696938 GCAGAGCTCCCCAGGCATGGGGG + Intronic
954539002 3:51381522-51381544 GCCGTGCTCCCAGGCCATGCGGG - Exonic
965407947 3:168293808-168293830 GCAGTGTCCCTAAGCCATGGTGG + Intergenic
968705031 4:2073746-2073768 GCAGGAGCCCCAAGCCGTGGTGG + Intronic
969684941 4:8666194-8666216 GGGGTGGCCACAAGCCATGGAGG - Intergenic
969710941 4:8843075-8843097 GCAGAGCCCCGATGGCATGGTGG + Intergenic
977683108 4:99816746-99816768 CCAGTGCCTCCAGGCCAGGGTGG + Intergenic
980148673 4:129021080-129021102 GCAGTGGGTCCAACCCATGGAGG + Intronic
981606381 4:146545651-146545673 GCTGTGTGCCCAAGCCAGGGGGG + Intergenic
985655366 5:1129015-1129037 GGAGTGCTCCCAAGCCTTGCAGG - Intergenic
985959967 5:3293937-3293959 GCAGACCCCTCAAGCCAGGGTGG - Intergenic
993655672 5:90575639-90575661 GCAGGTCCCCAAAGCCATCGTGG - Intronic
995226347 5:109705474-109705496 GCTGTGAGCCCAAGCAATGGAGG - Intronic
998191362 5:140027762-140027784 GTAGTCCCCCCAATCCATGCGGG - Intronic
999311340 5:150553966-150553988 GCAGTGCCCCAAGGCCCTGCGGG - Exonic
1001093809 5:168760994-168761016 GCAATGCAGCAAAGCCATGGGGG - Intronic
1002898222 6:1391167-1391189 GCAGTGGCCGCCAGCCCTGGAGG - Intronic
1013024949 6:106262684-106262706 GCAGTGGATCCAACCCATGGAGG + Intronic
1014430531 6:121365337-121365359 GCAGTGACTGCATGCCATGGAGG + Intergenic
1014582641 6:123157870-123157892 TCAGTGCTCCCCAGTCATGGAGG + Intergenic
1016819243 6:148332264-148332286 TCAGTTCCCCCAAGGCATTGTGG + Intronic
1016950705 6:149577051-149577073 GCCGTAACCCCAAGCCATGAGGG + Intronic
1017747851 6:157462769-157462791 CCAGTGCCCCCCAGCCCTGGAGG + Intronic
1017876546 6:158529519-158529541 GCACTGCCAGCAAACCATGGAGG - Intergenic
1017952062 6:159143610-159143632 GCAGAACACCCAAGCCATTGAGG - Intergenic
1018758606 6:166871267-166871289 GCAGTGACCACAACCCATGGGGG + Intronic
1019565047 7:1674958-1674980 GCAGTGGCCGCAAGCCACTGAGG + Intergenic
1020025684 7:4898266-4898288 AGAGTGCCCCCAGGCCATGTGGG - Intergenic
1022511432 7:30937147-30937169 GCAGAGCCCCCAGAGCATGGTGG - Intergenic
1024153707 7:46599171-46599193 CCAGTGTCCCCAAGCCCTCGTGG - Intergenic
1026050805 7:66945110-66945132 CCAGTCCCCCCAGGCCCTGGAGG + Exonic
1026570759 7:71528402-71528424 CCAGTGACCCCAAATCATGGTGG + Intronic
1027423183 7:78037089-78037111 CCAGTGCCCCCAAGGCATCCAGG + Intronic
1032198674 7:129804437-129804459 GCACTGCCCCAGAGCCATAGCGG + Intergenic
1033223177 7:139542312-139542334 GCAGAGCCACCAAGCCAGGCTGG - Intronic
1034972436 7:155427588-155427610 CCAGTGCCCCCACCCCATGCTGG - Intergenic
1037836840 8:22219716-22219738 GCAGGGCCCTCAGGCCATGGTGG + Exonic
1038665986 8:29538563-29538585 CCAGTGCCCCCAACCCATGAAGG - Intergenic
1041284220 8:56243878-56243900 ACAGTGCCCCCAACCCTTGTTGG - Intergenic
1042042262 8:64605049-64605071 GAAATGCCCCCAAGCCTTGCTGG - Intronic
1046280418 8:112022062-112022084 GCTGGGCCCCCCAGGCATGGTGG + Intergenic
1047121211 8:121907770-121907792 GCAGTGGGCCCAACCCACGGAGG + Intergenic
1049787967 8:144460215-144460237 ACAGAGCCCCCAGGCCAGGGAGG + Intronic
1049808186 8:144550828-144550850 TCAGTGTCCCCAGGCCATGGAGG - Intronic
1050584010 9:7091072-7091094 ATAGAGCCCCCAAGCAATGGAGG - Intergenic
1055479083 9:76692255-76692277 GCTGTGCCCCCTAGCCACAGCGG - Intronic
1057176342 9:93003019-93003041 AAACTGCCCCCAAGCCATGTGGG - Intronic
1059456319 9:114402438-114402460 GCAGTGCCCCCAACCCAACCTGG + Exonic
1060849594 9:126862694-126862716 CGAGTGCCACAAAGCCATGGGGG - Intronic
1061009875 9:127948537-127948559 CCAGAGCCCCCAAGCCAGGAGGG - Intronic
1061458099 9:130713359-130713381 GCAGTGTCCCAAAGCCGGGGCGG - Intergenic
1061674763 9:132209511-132209533 GCGGTGCCCCAAAGCCACGCGGG + Intronic
1061882888 9:133576894-133576916 GCTGTGCCCCCAAGCCAGAGAGG + Intergenic
1062175575 9:135160313-135160335 GCTCTGCCTCCCAGCCATGGGGG - Intergenic
1062466692 9:136684740-136684762 GCAGGGTCCCCAAGCCAGGATGG - Intronic
1191043933 X:56115597-56115619 GGAGTGCCCTCAGGCCATGAGGG + Intergenic
1191224645 X:58030741-58030763 GCTGTGAGCCCAAGCCAGGGGGG + Intergenic
1192209327 X:69117661-69117683 GCAAGGCCCCCAAGACCTGGGGG + Intergenic
1192934037 X:75839563-75839585 GCAGTGAGTCCAACCCATGGAGG - Intergenic
1193514307 X:82445424-82445446 GCAGTGGGTCCAACCCATGGAGG + Intergenic
1193571591 X:83151517-83151539 GCAGTGGGTCCAACCCATGGAGG + Intergenic
1194912008 X:99657062-99657084 GCAGGTCCCCAAAGCCATGAAGG - Intergenic
1194946971 X:100080812-100080834 GCAGTTCCACCAAGCCACTGGGG + Intergenic
1195127524 X:101822826-101822848 GCAGTGGGTCCAACCCATGGAGG - Intergenic
1195468960 X:105211805-105211827 GCAGTGGGTCCAACCCATGGAGG + Intronic
1200073060 X:153538416-153538438 GGAGTGCTCCCAAGACAGGGAGG - Intronic