ID: 925413856

View in Genome Browser
Species Human (GRCh38)
Location 2:3656067-3656089
Sequence TCAGGTCCCCACCTAGTGAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 123}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925413853_925413856 3 Left 925413853 2:3656041-3656063 CCTGAAGAGTGGACATTTCCTCA 0: 1
1: 0
2: 0
3: 18
4: 119
Right 925413856 2:3656067-3656089 TCAGGTCCCCACCTAGTGAGCGG 0: 1
1: 0
2: 0
3: 13
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925413856 Original CRISPR TCAGGTCCCCACCTAGTGAG CGG Intergenic
900735152 1:4295073-4295095 CCAGGTCCCCACCCAGAGAAGGG - Intergenic
902536651 1:17122770-17122792 AGAGGCCCCCAGCTAGTGAGGGG - Intergenic
903016494 1:20365419-20365441 TCACTTGCCCAGCTAGTGAGAGG - Intergenic
904211349 1:28888288-28888310 TCAGGTCCTCAGCTATTGAAGGG + Intronic
905793763 1:40803858-40803880 TGAGGACCCCACCCAGTGGGTGG - Intronic
907332895 1:53682853-53682875 TGAGCTCAGCACCTAGTGAGGGG + Intronic
910732620 1:90414480-90414502 TAATGTCCCCACCTACTGAGAGG - Intergenic
916849541 1:168689570-168689592 TCAGGTCCCTGTCCAGTGAGTGG - Intergenic
919250838 1:195054426-195054448 GCAGGGCCCCACGCAGTGAGGGG + Intergenic
921873612 1:220169114-220169136 TCATGTTGCCACCTAGTGAAAGG - Intronic
922422699 1:225470387-225470409 GCAGGTCCCCACCTGATGGGAGG - Intergenic
1063156127 10:3380962-3380984 TCAGGTCCCCACCGAGGGGATGG - Intergenic
1064445120 10:15386224-15386246 TCAGCCCCCCACCTGGTGGGAGG + Intergenic
1067089030 10:43257343-43257365 TGAGCTGCCCACCTGGTGAGGGG - Intronic
1068938307 10:62657435-62657457 CCAGGTCCCCACCAAGTTGGTGG + Intronic
1071605191 10:86980951-86980973 TCAGGTCCCCTCTGAGTGTGGGG + Intronic
1071974535 10:90941581-90941603 TGAGAACCCCACCTGGTGAGGGG + Intergenic
1074411234 10:113230402-113230424 CCAGGCCCCCCCCTACTGAGAGG - Intergenic
1074947711 10:118297250-118297272 TCAAGTCCCCATCTTCTGAGAGG - Intergenic
1079022951 11:16924259-16924281 TCTGCTCCCCTCCTACTGAGGGG + Intronic
1081100606 11:38997193-38997215 TCAGGTCCCCACCCAGGAACAGG + Intergenic
1081775955 11:45676047-45676069 TTAGGTCCCCACCTGTTCAGTGG - Intergenic
1082006211 11:47420555-47420577 TCAGGCCCCCAGCTAGCCAGTGG - Intronic
1085207537 11:74745325-74745347 TTAGCTTCCCACATAGTGAGTGG + Intergenic
1085278417 11:75314557-75314579 TCAGTTACCCAGCTAGTGAGTGG - Intronic
1086897027 11:92325206-92325228 TCAGGTCCCCACCAACTGTTTGG - Intergenic
1090415833 11:126539852-126539874 TCAGGTCAACACCAAGTGAGAGG - Intronic
1090652886 11:128822981-128823003 TCAGGACAGCACCGAGTGAGAGG + Intergenic
1091068038 11:132535658-132535680 TCAGGGCCAGACCCAGTGAGAGG + Intronic
1091657806 12:2358468-2358490 TCTGGGCCACACCTAGTAAGTGG + Intronic
1094217896 12:27963982-27964004 CAAGGTCACAACCTAGTGAGTGG - Intronic
1094310029 12:29070105-29070127 TCAGAACCCCATCTAGGGAGTGG + Intergenic
1094491587 12:30964069-30964091 TCAGGTTTCCAGCAAGTGAGAGG + Intronic
1096607883 12:52779675-52779697 CAAGGTCACCACATAGTGAGAGG - Intergenic
1098805835 12:75019601-75019623 AAAGGGCCCCACCTAGTGACTGG - Intergenic
1101881648 12:108629928-108629950 TGAGGTCACCAGATAGTGAGAGG - Intronic
1106151745 13:27110518-27110540 TCAGGTCCTCAGCTGGAGAGGGG - Intronic
1108787082 13:53917552-53917574 TCAGGTCCCCAGCTTCTCAGAGG + Intergenic
1113919317 13:113898047-113898069 TCTGGTCCCATCCTGGTGAGTGG - Intergenic
1117323512 14:54647370-54647392 CCAGGTCCCCGGCTAGTAAGTGG + Intronic
1118716262 14:68562245-68562267 TCTGGCCCCCACCTGTTGAGTGG - Intronic
1123122315 14:105922442-105922464 TAAGGTCCCCACCTCATGGGTGG + Intronic
1123404973 15:20014007-20014029 TAAGGTCCCCACCTCATGGGTGG + Intergenic
1123514304 15:21020655-21020677 TAAGGTCCCCACCTCATGGGTGG + Intergenic
1127868464 15:63050207-63050229 TCAGTTCCCCACCCAGCAAGAGG + Intronic
1128618562 15:69129749-69129771 TCAGGCTCCCACCTAGACAGGGG + Intergenic
1129588520 15:76893169-76893191 TCAGCCCCCCACCCAGTGACAGG - Intronic
1130206261 15:81878603-81878625 TCAGATGCCCACCCAGTGAATGG + Intergenic
1130415850 15:83694078-83694100 TCAGGGCCCCATCTAGGCAGTGG - Intronic
1130671321 15:85915554-85915576 TCAGGCACCCACCTAGAGAGAGG + Intergenic
1131063498 15:89418572-89418594 TCAAGCCCCCACCTAGTGCAGGG + Intergenic
1134212268 16:12287739-12287761 TAAGGTCCCCACCTCGTGATTGG + Intronic
1138555281 16:57767308-57767330 TCAGGTCCCCAGCTACTCAGGGG - Intronic
1139791972 16:69445319-69445341 AAAGGTCTCCACCCAGTGAGTGG - Intronic
1140898510 16:79347324-79347346 CCGGGGCCTCACCTAGTGAGTGG + Intergenic
1141279732 16:82620499-82620521 TCAGGTTCCTAACTAGTGAGTGG - Intergenic
1143204498 17:5132662-5132684 TCAGGACCCCACCTAGAGGCTGG + Intronic
1144476686 17:15595002-15595024 TCAGGTACCTACCGAGTGAATGG - Intronic
1144921565 17:18768401-18768423 TCAGGTACCTACCGAGTGACTGG + Intronic
1145760224 17:27421375-27421397 TCAGGACCCCACCTAGAGACTGG + Intergenic
1146844161 17:36173151-36173173 TCAGGACCCCACCTAGAGGCTGG - Intronic
1146856466 17:36261086-36261108 TCAGGACCCCACCTAGAGGCTGG - Intronic
1146864151 17:36327289-36327311 TCAGGACCCCACCTAGAGGCTGG + Intronic
1146872376 17:36384997-36385019 TCAGGACCCCACCTAGAGGCTGG - Intronic
1146879734 17:36436082-36436104 TCAGGACCCCACCTAGAGGCTGG - Intronic
1146883659 17:36457234-36457256 TCAGGACCCCACCTAGAGGCTGG - Intergenic
1147067011 17:37927877-37927899 TCAGGACCCCACCTAGAGGCTGG + Intronic
1147075260 17:37985621-37985643 TCAGGACCCCACCTAGAGGCTGG - Intronic
1147078543 17:38007438-38007460 TCAGGACCCCACCTAGAGGCTGG + Intronic
1147086785 17:38065167-38065189 TCAGGACCCCACCTAGAGGCTGG - Intronic
1147094481 17:38131373-38131395 TCAGGACCCCACCTAGAGGCTGG + Intergenic
1147102730 17:38189130-38189152 TCAGGACCCCACCTAGAGGCTGG - Intergenic
1148399353 17:47341005-47341027 TAACGTCACCACCTAGAGAGTGG + Intronic
1149998442 17:61417040-61417062 CCAGATCCCCACCTAGTGGTAGG - Intergenic
1150085662 17:62272214-62272236 TCAGGACCCCACCTAGAGGCTGG - Intergenic
1160895708 19:1401029-1401051 TGAGGTCCCCATCTGGAGAGCGG + Intronic
1165584465 19:36901788-36901810 TCAGGTCACCACCTTGTGGATGG - Intronic
1168002582 19:53461080-53461102 TGAGGTCCCCAGTTTGTGAGGGG - Intergenic
925413856 2:3656067-3656089 TCAGGTCCCCACCTAGTGAGCGG + Intergenic
927591723 2:24362470-24362492 GCTGGTCCCCAGCAAGTGAGGGG - Intergenic
930711407 2:54554296-54554318 CCAGGGCCCCAGCTGGTGAGTGG - Intronic
935026950 2:99286102-99286124 TCAGGGCCTCACATGGTGAGAGG - Intronic
935585015 2:104792804-104792826 TCAGGTGCCCACCTATTGGAGGG + Intergenic
935838277 2:107078831-107078853 CCAAATCCCCACCTACTGAGAGG + Intergenic
946057196 2:216912523-216912545 TCAGGACCCCATCCAGAGAGTGG - Intergenic
948228585 2:236333131-236333153 TCAAGTCCCCACCAAGTGCCGGG - Intronic
948954259 2:241274245-241274267 TCATGACACCACCTAGGGAGGGG + Intronic
1172039679 20:32035058-32035080 TCAGGGCCCCACCTTGGGAGAGG - Intergenic
1172765876 20:37350474-37350496 TTAGGTCCCCACCTGGTGGCTGG + Intronic
1172973075 20:38887808-38887830 TGAGGTCACCACCCAGTAAGAGG - Intronic
1175739977 20:61413439-61413461 TCAGGTCACCAGCTAGGCAGTGG - Intronic
1180853681 22:19033754-19033776 TCAGGACCCCTCCTAGGCAGAGG - Intergenic
1181026562 22:20130934-20130956 ACAGATCTCCACCTAGGGAGGGG + Intronic
1182927687 22:34141366-34141388 TAAGGTCCACACCTTGTGACTGG + Intergenic
1183011374 22:34949690-34949712 TAAGGTCCTCACCTGGTGAGGGG - Intergenic
1184486626 22:44783667-44783689 GCAGGTCCCCACCCCGTCAGCGG + Intronic
950109814 3:10411866-10411888 TCCGGTCCCCACATGATGAGGGG - Intronic
953631003 3:44617437-44617459 TCATGCCCCCAGCTAGTAAGAGG - Intronic
954664621 3:52245389-52245411 TCAGGTCCCCACCCAGCAGGAGG + Intergenic
954678565 3:52328848-52328870 TCTGCTCCCCACCTGGTGGGTGG + Intronic
956918511 3:73900576-73900598 TCAGGTCCCCTCGGGGTGAGGGG - Intergenic
966780402 3:183579597-183579619 GCAGGTACCCACATAGAGAGAGG - Intergenic
968603762 4:1521970-1521992 TCGGGTCCCCACCTGGAAAGAGG + Intergenic
969603949 4:8192837-8192859 TCATGTCGCCACCTGGTGATTGG + Intronic
970017920 4:11533517-11533539 TCAGTTCACCTCCTGGTGAGAGG + Intergenic
971462081 4:26910762-26910784 TCTGGTTCCCACCTATAGAGAGG + Intronic
973537503 4:51898228-51898250 TCAGTTCCCCACCTGCTTAGCGG - Intronic
974923809 4:68273821-68273843 TCAACTTCTCACCTAGTGAGAGG + Intergenic
975110728 4:70623514-70623536 TCTGGGCCCCTCCTAGGGAGTGG - Intergenic
990042443 5:51390169-51390191 CCAGGTCCCAACCTCGTGGGTGG + Intronic
991976038 5:72184346-72184368 TGAGGCTCCCACCTAGTAAGAGG - Intronic
997280872 5:132644427-132644449 CAAGGTCCCCAGCTAGTGAGTGG - Exonic
999504813 5:152183755-152183777 TGCTGTCACCACCTAGTGAGGGG - Intergenic
1001595982 5:172899012-172899034 GCAGGTCCCCTCCTAGAGGGTGG - Intronic
1002981672 6:2144182-2144204 TCAGGTCACCAGCTAGAAAGAGG + Intronic
1005055197 6:21722630-21722652 TCAGGTCCCCACCCAGGAACAGG + Intergenic
1020211808 7:6163541-6163563 TCTGGGCCCCACCTACAGAGAGG - Exonic
1023880052 7:44313162-44313184 TCAGGACCCCAGCTAGGCAGCGG - Intronic
1024979298 7:55144374-55144396 TGAGGGCCCCAGCTAGTGAATGG + Intronic
1030597770 7:111561060-111561082 TGAGCTCCCAACCTTGTGAGAGG + Intronic
1034819426 7:154203044-154203066 CAAGGTCACCACCTAGTAAGCGG - Intronic
1035070289 7:156139784-156139806 TCATGTCCCCACCCAGAGGGAGG + Intergenic
1035073535 7:156161966-156161988 TCAGGAGCCCACCTTGTGAAAGG + Intergenic
1038869315 8:31476899-31476921 TCAGGTGCCCACATCCTGAGTGG - Intergenic
1040808668 8:51424939-51424961 GCAGGGCCCCACCAGGTGAGAGG + Intronic
1045016876 8:98008034-98008056 TAAGGTCACCAGCTAGTGAGTGG + Intronic
1045111689 8:98942672-98942694 TCAGGTCACCACCCCGTGAGTGG + Intronic
1047520208 8:125590168-125590190 TCAGATGCCCAGCTAGTAAGAGG - Intergenic
1056198148 9:84248689-84248711 CCAGCTCCCCACCTACTGACAGG - Intergenic
1057906404 9:98986995-98987017 CCAGGTCCCCAGCTTGTCAGCGG - Intronic
1060416337 9:123433232-123433254 GAAGGTCACCAGCTAGTGAGTGG + Intronic
1060799732 9:126536009-126536031 TCAGGTCCCCACTTATGAAGCGG + Intergenic
1187420069 X:19126283-19126305 TAAGGTCCACAGCTAGTAAGTGG + Intergenic
1189545122 X:42034904-42034926 TGAGGTCCTCTCCAAGTGAGGGG + Intergenic
1194268158 X:91779732-91779754 TGAGGTCCACACTTAGTGCGCGG + Intronic
1198536822 X:137594718-137594740 CCAGGACCCCACATGGTGAGAGG - Intergenic
1200585359 Y:5000653-5000675 TGAGGTCCACACTTAGTGCGCGG + Intronic