ID: 925417651

View in Genome Browser
Species Human (GRCh38)
Location 2:3682443-3682465
Sequence ATTCTGTTTTTTATTAAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1688
Summary {0: 1, 1: 0, 2: 8, 3: 110, 4: 1569}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925417645_925417651 27 Left 925417645 2:3682393-3682415 CCACCATCACCCACTGGCTGTTT 0: 1
1: 0
2: 0
3: 31
4: 284
Right 925417651 2:3682443-3682465 ATTCTGTTTTTTATTAAACATGG 0: 1
1: 0
2: 8
3: 110
4: 1569
925417646_925417651 24 Left 925417646 2:3682396-3682418 CCATCACCCACTGGCTGTTTTGA 0: 1
1: 0
2: 3
3: 10
4: 180
Right 925417651 2:3682443-3682465 ATTCTGTTTTTTATTAAACATGG 0: 1
1: 0
2: 8
3: 110
4: 1569
925417648_925417651 17 Left 925417648 2:3682403-3682425 CCACTGGCTGTTTTGATCAGTGA 0: 1
1: 1
2: 0
3: 10
4: 146
Right 925417651 2:3682443-3682465 ATTCTGTTTTTTATTAAACATGG 0: 1
1: 0
2: 8
3: 110
4: 1569
925417647_925417651 18 Left 925417647 2:3682402-3682424 CCCACTGGCTGTTTTGATCAGTG 0: 1
1: 0
2: 0
3: 12
4: 176
Right 925417651 2:3682443-3682465 ATTCTGTTTTTTATTAAACATGG 0: 1
1: 0
2: 8
3: 110
4: 1569

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925417651 Original CRISPR ATTCTGTTTTTTATTAAACA TGG Intronic
900303731 1:1991865-1991887 TTTCTGTTTTTTAGTAGAGATGG - Intronic
901877827 1:12177004-12177026 ATTCTGTTTTTTTTTTGAGATGG + Intronic
901926053 1:12566880-12566902 CTTTTTTTTTTTTTTAAACATGG - Intergenic
902347549 1:15829487-15829509 ATTCTATTTTTTTTGAGACAGGG + Intergenic
903091243 1:20919910-20919932 ATTCTTTTTTTTTTTTAAGACGG + Intronic
903143874 1:21357289-21357311 TTTCTTTTTTTTTTTAGACAAGG + Intergenic
903242189 1:21990552-21990574 ATTCTTTTTTTTTTTTAAGAAGG - Intronic
903245699 1:22013739-22013761 ATTCTTTTTTTTTTTTAAGAAGG - Intergenic
903306966 1:22419717-22419739 TTTCTTTTTTTTTTTAGACAGGG - Intergenic
903321351 1:22545155-22545177 ATTCTGCCTTTTATTAAGCCAGG + Intergenic
903386005 1:22927149-22927171 TTTTTGTTTTTTAGTAAAGATGG + Intergenic
903530336 1:24025293-24025315 TTTTTTTTTTTTTTTAAACAGGG - Intergenic
903787972 1:25874184-25874206 TTTTTTTTTTTTTTTAAACAGGG + Intergenic
903990579 1:27265642-27265664 AATTTTTTTTTTTTTAAACAGGG - Intronic
904080755 1:27871351-27871373 ATTCTTTTTTTTAAGAGACAGGG + Intergenic
904096111 1:27978791-27978813 ATTTTGTTTTTTAGTAGAGACGG - Intronic
904153553 1:28463558-28463580 AATCTTGTTTTTGTTAAACATGG + Intronic
904167773 1:28569386-28569408 ATTTTGTTTTTTAAGAGACACGG - Intronic
904211729 1:28890339-28890361 ATTCTGATATTTATTAAAGGGGG + Intronic
904215669 1:28916795-28916817 ATTTTTTTTTTTTTTAAACAGGG + Intronic
904341734 1:29839496-29839518 ATTTTATTTTTTAATGAACAGGG - Intergenic
904655512 1:32042907-32042929 CTTCTTTTTTTTATTATAAAAGG - Exonic
906066655 1:42985717-42985739 TTTTTTTTTTTTTTTAAACACGG + Intergenic
906233966 1:44191982-44192004 ATCATGCTTTTTTTTAAACAAGG + Intergenic
906359965 1:45147079-45147101 TTTTTTTTTTTTTTTAAACAGGG + Intronic
906392223 1:45428507-45428529 TTTTTATTTTTTTTTAAACAGGG + Intronic
906980669 1:50625068-50625090 ATTTTGTATTTTAATAAAGACGG + Intronic
907004436 1:50896276-50896298 ATACTCTTTTTTTTTAGACAGGG - Intronic
907036144 1:51218125-51218147 TTTCTTTTTTTTTTTAAACAGGG + Intergenic
907054580 1:51353471-51353493 TTTGTATTTTTTATTAGACAGGG + Intergenic
907150365 1:52280371-52280393 TTTTTTTTTTTTTTTAAACAGGG - Intronic
907449296 1:54532935-54532957 ATTTTTTTTTTTTTGAAACAGGG + Intergenic
907493324 1:54825221-54825243 TTTCTGTTTTTTAGTAGAGACGG + Intronic
907561717 1:55396859-55396881 ATTCTGTTTTGTTTTAATCGTGG + Intergenic
907816209 1:57920488-57920510 ATTTTCTTTTTTTTGAAACAGGG + Intronic
907839882 1:58146707-58146729 ATTCTGTTATATATTATAAATGG - Intronic
907895908 1:58691105-58691127 TTTCTGTTTTTTAGTAGAGATGG - Intronic
908196984 1:61754885-61754907 ATTCTATTTTTTCAGAAACAGGG - Intronic
908236734 1:62154487-62154509 TTTGTGTTTTTTAGTAAAGACGG - Intronic
908253569 1:62284263-62284285 ATTCTGTTTTATTGCAAACAAGG - Intronic
908279191 1:62512724-62512746 TTTTTTTTTTTTTTTAAACATGG - Intronic
908406809 1:63822432-63822454 ATTCTTTTTATTATTTAAAAAGG + Intronic
909009724 1:70320794-70320816 TTTCTTTTTTTTTTTAGACAGGG + Intronic
909078510 1:71081473-71081495 ATTCTGTTATTTCATACACATGG + Intergenic
909306347 1:74083826-74083848 ATTATCTTTTTCATTAAAAAAGG + Intronic
909448448 1:75773128-75773150 TTTTTTTTTTTTTTTAAACAGGG - Intronic
909642221 1:77881895-77881917 TTTCTTTTTTTTTTTAAAGATGG - Intergenic
909844491 1:80374682-80374704 ATTTTTTTTTTTTTGAAACAGGG - Intergenic
910017807 1:82548841-82548863 ATTCTTTATTTTATAAATCATGG - Intergenic
910052040 1:82986212-82986234 ATTCTGATTCTAATTAAAAAGGG + Intergenic
910177002 1:84441639-84441661 TTTTTTTTTTTTTTTAAACAGGG + Intergenic
910307652 1:85784733-85784755 ATTTTATTTTTTATTAGAGATGG + Intronic
910433947 1:87186315-87186337 ATTCGTATTTTTATTAAGCAGGG - Intergenic
910672746 1:89789447-89789469 ATTTTGTTCTTTATGAGACAGGG - Intronic
910688111 1:89939145-89939167 ACTCTGGCTTTTATTCAACAAGG - Intergenic
910755989 1:90691426-90691448 TTTTTTTTTTTTACTAAACAGGG - Intergenic
910873083 1:91852817-91852839 ATTCTGCTTTTTGATACACAAGG - Intronic
911046176 1:93630625-93630647 ATTTTATTTTTTTTGAAACAAGG - Intronic
911084316 1:93963786-93963808 ATTTTTTTTTTTTTTAAATAAGG + Intergenic
911133696 1:94417759-94417781 ATTCTCAATTTTATTAAAAACGG + Intergenic
911728344 1:101266082-101266104 TTTTTTTTTTTTTTTAAACAGGG + Intergenic
911930407 1:103895647-103895669 TTTCTGTCTTTTATCAAAAATGG + Intergenic
911956298 1:104239824-104239846 ATTTTGTTTTCTATTAGAAATGG + Intergenic
912370155 1:109167613-109167635 TTTCTTTTTTTTAAGAAACAAGG + Intronic
912832811 1:112968799-112968821 TTTCTATTTTTTAGTAAAGACGG - Intergenic
914259849 1:145989723-145989745 TTTTTTTTTTTTTTTAAACAGGG - Intergenic
914359235 1:146916777-146916799 TTTTTTTTTTTTTTTAAACAGGG - Intergenic
914494514 1:148183099-148183121 TTTTTTTTTTTTTTTAAACAGGG + Intergenic
914700393 1:150127321-150127343 ATTTTTTTTTTTTTGAAACAGGG + Intronic
914755765 1:150560898-150560920 AATTTATTTTTTATTAAAGATGG + Exonic
914772311 1:150699528-150699550 ATTTTTTTTTTTTTTAAAGACGG + Intronic
914864117 1:151411569-151411591 GTTTTTTTTTTTTTTAAACATGG - Intronic
915110280 1:153560136-153560158 ATTCTTTTTTTTTTGAGACAGGG - Intergenic
915239641 1:154511037-154511059 ATTTTTTTTTTTTTGAAACAGGG - Intronic
915390131 1:155535415-155535437 TTTGTGATCTTTATTAAACATGG + Intronic
915415712 1:155741119-155741141 ATTTTTTTTTTTAATAAAGATGG + Intergenic
915417593 1:155753874-155753896 ATTTTTTTTTTTTTTAAACACGG + Intronic
915562920 1:156697875-156697897 ATTTTGTTGTTTTTTAAACAGGG + Intergenic
915676930 1:157540518-157540540 GTTTTTTTTTTTTTTAAACATGG - Intronic
915975522 1:160384670-160384692 ATTTTATTTTTTATTATACTAGG + Intergenic
916041905 1:160968896-160968918 ATTATGTATTTTTTTAAACAGGG + Intergenic
916076530 1:161203135-161203157 ATTTTGTATTTTTTTAAAGACGG - Intronic
916089246 1:161294301-161294323 ATTTTTTTTTTTCTGAAACAGGG + Intergenic
916232935 1:162558227-162558249 TTTATGTTTTTTAATAAAGATGG + Intergenic
916253711 1:162764818-162764840 TTTTTTTTTTTTTTTAAACAGGG - Intronic
916552292 1:165860433-165860455 ATTCTTTTTTTTTTGAGACAGGG + Intronic
916710628 1:167403621-167403643 ATCATGTTATTTATTAAAGACGG + Intronic
916925410 1:169514517-169514539 TTTTTGTTTTTTTTTAGACAGGG + Intronic
917170953 1:172173491-172173513 TTTTTTTTTTTTTTTAAACAAGG + Intronic
917392033 1:174547691-174547713 ATTCTGTGTTCTTTTAGACATGG + Intronic
917494994 1:175532381-175532403 ATTCTGCTTCTAAATAAACAAGG + Intronic
917586499 1:176432635-176432657 ATTTTTTTTTTTAATAAAGAGGG + Intergenic
917828343 1:178848302-178848324 TTTTTGTTTTTTTTTAGACAGGG - Intronic
918103070 1:181393462-181393484 TTTCTTTTTTTTCTGAAACAGGG + Intergenic
918246392 1:182663533-182663555 GTTTTGTTTTTTAAGAAACAGGG + Intronic
918550083 1:185733007-185733029 ATTCCGTTGTTTATTTAAAAAGG - Intergenic
918550542 1:185737159-185737181 ATTTTTTTTTTTTTGAAACAGGG + Intronic
918667097 1:187164732-187164754 ATTTTTTTTTTTTTTAAAGAAGG - Intergenic
918726575 1:187933139-187933161 ATTCTTTTTTTTTTGAGACAGGG - Intergenic
918803459 1:189004913-189004935 ATTCATTTATTTATTAAATATGG + Intergenic
918837078 1:189480201-189480223 ATTTTGTTTTATATTAATTATGG - Intergenic
918899441 1:190394308-190394330 ATTCCCTTTTTTAATAAAAATGG + Intronic
919559585 1:199100265-199100287 ATTCTGTTCATTGTTAAGCAGGG + Intergenic
919597826 1:199586448-199586470 ATTCTGCTTTTTATTAACTCTGG - Intergenic
919639454 1:200034800-200034822 TTTTTTTTTTTTTTTAAACAAGG + Intronic
919987190 1:202683733-202683755 TTTTTTTTTTTTTTTAAACAGGG - Intronic
919999449 1:202786014-202786036 TTTCTGTTTTTTAAGAGACAAGG + Intronic
920261326 1:204690015-204690037 ACTCTGTTTTTTTTTTAAGATGG + Intergenic
920672188 1:208012647-208012669 GTTTTTTTTTTTCTTAAACAGGG - Intergenic
920953957 1:210600266-210600288 ATTCTTTCTTTTATTCAAAAAGG - Intronic
921098511 1:211908310-211908332 TTTTTGTATTTTATTAGACATGG - Intergenic
921122161 1:212146690-212146712 GTTCTATTTTTTTTTTAACATGG + Intergenic
921234001 1:213105837-213105859 AGTCTGTTTTTTATGGAAAAAGG + Intronic
921655718 1:217734609-217734631 ATTTTATTTTTTCTTAAAGATGG + Intronic
921724640 1:218510075-218510097 CTTTTTTTTTTTTTTAAACAGGG + Intergenic
921777156 1:219114364-219114386 AGTCTGTTTTTTCTGAAACTAGG - Intergenic
922017419 1:221664778-221664800 ATTTTTTTTTTTATGAGACATGG + Intergenic
922165595 1:223113210-223113232 TTTCTGTTTTTTTTGAGACAGGG + Intronic
922340869 1:224654072-224654094 TTTTTTTTTTTTTTTAAACAGGG - Intronic
922388130 1:225108787-225108809 ATTCTCTATTTTATTAGACTGGG - Intronic
922457743 1:225790193-225790215 TTTCTGTCTTTAATTAACCAAGG + Exonic
922508175 1:226139384-226139406 ATTTTTTTTTTTATTTACCAAGG - Intergenic
922530201 1:226339460-226339482 ATTCTGTTATTTACAACACAAGG - Intergenic
922879262 1:228968150-228968172 TATGTGTATTTTATTAAACATGG - Intergenic
922977235 1:229795306-229795328 ATTTTTTTTTTTTTTATACAAGG - Intergenic
923123284 1:231013971-231013993 ATTTTTTTTTTTTTTAAAGATGG - Intergenic
923164515 1:231346933-231346955 ATTCTTTTTTTTTTGAGACAGGG - Intronic
923320907 1:232831999-232832021 TTTTTTTTTTTTTTTAAACAAGG + Intergenic
923449133 1:234099995-234100017 ATACTACTTTATATTAAACATGG + Intronic
923478784 1:234363183-234363205 ATTTTGTATTTTAGTAGACACGG - Intergenic
923572067 1:235125385-235125407 TTTCTATTTTTTAGTAAAGACGG + Intronic
923649142 1:235856622-235856644 GTTCTGTTTTTTAAAAAATAAGG + Intronic
923697526 1:236268431-236268453 TTTTTGTTTTTTTTTAGACAGGG - Intronic
923803194 1:237230512-237230534 ATTCTGTTTTTCAAGAAACTAGG + Intronic
923821201 1:237444331-237444353 ATTCTTTTCTTTATTAATCAGGG + Intronic
923970869 1:239201950-239201972 ATTTTGTTTTTTAGTAGAGACGG + Intergenic
924186456 1:241496599-241496621 ATCCTGTTATTTATTACACGAGG + Intergenic
924235408 1:241995910-241995932 ATTTTTTTTTTTTTGAAACAGGG - Exonic
924243910 1:242063210-242063232 ATTTTTTTTTTTTTTAAAAAAGG - Intergenic
924607757 1:245549947-245549969 ATTTTGTTTTTTAGTAGAGAGGG + Intronic
924842647 1:247729573-247729595 TTTCTGTTTTCTTTTGAACATGG + Intergenic
1062800604 10:376560-376582 TTTTTTTTTTTTTTTAAACAGGG + Intronic
1062871662 10:909779-909801 ATTCTTTTTTTTTTTAGAGATGG - Intronic
1062963413 10:1590299-1590321 ATTCAGGTTTTAATTAAGCATGG + Intronic
1063307114 10:4913773-4913795 TTGTTGTTGTTTATTAAACAAGG - Intergenic
1063329496 10:5142911-5142933 ATACTGTATTTTTTTAAAAAAGG - Intergenic
1063332121 10:5170353-5170375 AATCTGTCTTTTAATAAAAATGG - Intergenic
1063419872 10:5903497-5903519 ATTTTGTTTTTTAGTAGAGACGG + Intronic
1063444235 10:6099019-6099041 TTTGTGTTTTTTTTAAAACAAGG + Intronic
1063841418 10:10076192-10076214 ATGCTGTTTTTTACCAAACTAGG + Intergenic
1063917650 10:10900063-10900085 ATTCAGTTTCTTATTAGAAATGG - Intergenic
1063985421 10:11496605-11496627 ATTCTTATTTATATTAAACATGG - Intronic
1063996211 10:11622434-11622456 ATTTTGTTTTTTTTGAGACAGGG - Intergenic
1064090428 10:12378542-12378564 ATTTTTTTTTTTTTTGAACAAGG + Intronic
1064125515 10:12656485-12656507 TTTCTCTTTTTTTTGAAACAGGG - Intronic
1064307228 10:14178241-14178263 TTTCTGTTCTTTATTAGTCAGGG + Intronic
1064352957 10:14593505-14593527 ATTTTTATTTTTATTAGACATGG - Intronic
1064473577 10:15662340-15662362 TTTTTTTTTTTTTTTAAACAGGG + Intronic
1064757397 10:18583652-18583674 ATTCTCTATTTGATGAAACATGG - Intronic
1064796714 10:19020341-19020363 ATTCTGAGTTTTATAAAAGATGG + Intergenic
1064824201 10:19376721-19376743 ATTTTGTATTTTATTAGAGACGG + Intronic
1065415622 10:25482188-25482210 ATTCTTTTTTTTAAGAGACAGGG + Intronic
1065505098 10:26422433-26422455 AATCTTTTTTTAATTAGACAGGG + Intergenic
1065575944 10:27118292-27118314 ATTTTGTTTCTTTTTAAACAGGG + Intronic
1065749085 10:28869082-28869104 ATTTTTTTTTTTTTTAAAGATGG + Intronic
1066053450 10:31659103-31659125 AATCTATTTTTTTTTAAAAAAGG + Intergenic
1066120662 10:32283321-32283343 TTTCTTTTTTTTTTGAAACAGGG + Intronic
1066130995 10:32393886-32393908 ATTTTTTTTTTTTTGAAACAGGG - Intergenic
1066299918 10:34087509-34087531 ATTCTTTTTTTTTTTTAAGACGG + Intergenic
1066593798 10:37025879-37025901 TTTCTGGTTTTTATAGAACATGG - Intergenic
1067016995 10:42765064-42765086 ATTCTTTTTTTTTTTGTACATGG - Intergenic
1067108685 10:43383162-43383184 TTTTTGTTTTTTTTTAAAGACGG - Intergenic
1067129341 10:43547398-43547420 ATTTTTTTTTTTAGTAGACATGG - Intergenic
1067587700 10:47486101-47486123 ATTTTTTTTTTTTTTAAAGACGG - Intergenic
1067799330 10:49348189-49348211 ATTCCGTCCTTTATTAAACTTGG - Intergenic
1068205759 10:53850223-53850245 ATTCTGTTTTTAGTTAAATATGG - Intronic
1068277517 10:54821405-54821427 AATTTTTTTTTTATTAAAAAGGG - Intronic
1068479036 10:57565280-57565302 ATTCTGTCATTTGTGAAACATGG - Intergenic
1068572605 10:58646931-58646953 TTTCTGTTTTTAAGTAAAAATGG + Intronic
1068690815 10:59911958-59911980 ATTGTGGGTCTTATTAAACAAGG + Intergenic
1069038981 10:63674620-63674642 AATTTTTTTTTTTTTAAACAGGG - Intergenic
1069103386 10:64352376-64352398 TTTATGTTTTTTAAAAAACATGG + Intergenic
1069361355 10:67646187-67646209 TTTTTTTTTTTTTTTAAACAGGG + Intronic
1069444550 10:68460901-68460923 TTTTTTTTTTTTTTTAAACAGGG - Intronic
1069457622 10:68565457-68565479 ATATTTTTTTTTTTTAAACAGGG - Intronic
1069482951 10:68800110-68800132 TTTTTTTTTTTTTTTAAACACGG - Intergenic
1070012054 10:72485248-72485270 GTTTTGTTTTGTTTTAAACAGGG + Intronic
1070184451 10:74047288-74047310 ATTTTGTTTTGTTTTACACAGGG - Intronic
1070996868 10:80792330-80792352 ATTCTTTTTTTTTTGAGACAGGG + Intergenic
1071051465 10:81454390-81454412 ATTCTGTTGTTTATTTAGGATGG + Intergenic
1071070528 10:81687073-81687095 TTTTTGTTTTTAATGAAACATGG - Intergenic
1071310413 10:84338108-84338130 ATTCTGTATTTTAGTAGAGATGG - Intronic
1071408458 10:85362240-85362262 ATTTTGTTTTGTCTTAAAGAAGG - Intergenic
1071457119 10:85859485-85859507 TTTCTCTTTTTTGTAAAACATGG - Intronic
1071479360 10:86053230-86053252 CTTTTGTTTTTTATTACACAAGG - Intronic
1071673297 10:87631707-87631729 TTTTTGTTTTTTAATACACATGG - Intergenic
1072059274 10:91793542-91793564 GTTTTGTTTTTTTTGAAACAGGG - Intergenic
1072060561 10:91806320-91806342 TTTCTGTCTTTAATTAACCAAGG - Intronic
1072130362 10:92488272-92488294 TTTCTGTATTTTATTAGAGATGG + Intronic
1072868593 10:99091530-99091552 ATTCTCTGTTTTCTTAAAAATGG + Intronic
1073311365 10:102545113-102545135 TTTCTTTTTTTTTTTAGACAAGG + Intronic
1073767855 10:106703170-106703192 ATTTTTTTTTTTTTTAAATAAGG - Intronic
1074166899 10:110888047-110888069 GTTCTTTTGTTTTTTAAACATGG + Intronic
1074343375 10:112656393-112656415 TTTTTTTTTTTTTTTAAACAGGG + Intronic
1074398165 10:113117585-113117607 ATTCTTTTTTTCCTTAAATAGGG - Intronic
1074518459 10:114194763-114194785 TTTTTTTTTTTTATTAGACAAGG + Intronic
1074663825 10:115695055-115695077 ATACTGTTTTTCATAAAATAAGG + Intronic
1074669067 10:115767156-115767178 ACTCATTTATTTATTAAACATGG + Intronic
1074920696 10:118007159-118007181 TTTTTTTTTTTTTTTAAACATGG - Exonic
1074925058 10:118060125-118060147 TTTCTGTTTTTTCTTTAAGAGGG - Intergenic
1075030254 10:119019657-119019679 TTTCTTTTTTTTTTTAGACAGGG - Intergenic
1075203799 10:120428903-120428925 GGTCTGCTTTTTATTAAATAAGG - Intergenic
1075376262 10:121980045-121980067 ATTTTTTTTTTTTTTAAACAAGG - Intergenic
1075754152 10:124797781-124797803 TTTTTTTTTTTTTTTAAACAGGG + Intergenic
1076003014 10:126927443-126927465 ATTCTTTTTTTTTTGAGACAGGG + Intronic
1076143880 10:128101217-128101239 ATTCTGTGTCTTTTAAAACAGGG + Intronic
1076637636 10:131892551-131892573 AGTCTGGATGTTATTAAACACGG - Intergenic
1077607864 11:3624440-3624462 ATCCTATTGTTTACTAAACATGG + Intergenic
1078363729 11:10690364-10690386 ATTTTTTTTTTTTTTAGACAGGG - Intronic
1078378645 11:10819136-10819158 TTTTTGTTTTTTTTGAAACAAGG - Intronic
1078477824 11:11647694-11647716 ATTCTGTTTTTTATTATTCTTGG - Intergenic
1078561357 11:12376106-12376128 ATTTTTTTTTTTTTTAAAAAAGG + Intergenic
1078576378 11:12506175-12506197 AGTCTGTTTTTTTTTAATCATGG + Intronic
1078636598 11:13056309-13056331 ATTTTTTTTTTTTTTAGACAGGG + Intergenic
1079057310 11:17217383-17217405 ATTCTTTTTTTTAAGAGACATGG - Intronic
1079662271 11:23053670-23053692 ATTCTCTTTTGTATTAATAATGG + Intergenic
1079977580 11:27110921-27110943 ATTTGGTTTATTTTTAAACATGG + Intronic
1080221215 11:29906935-29906957 ATTCTGTTTTTTAAGAAAGTAGG - Intergenic
1080327063 11:31087891-31087913 GTTCTGTTAATTATGAAACAGGG + Intronic
1080329675 11:31121347-31121369 TTTCCATTTTTTTTTAAACAAGG + Intronic
1080342350 11:31280632-31280654 TTTCTGTTTTGTAATAAATAAGG + Intronic
1080388937 11:31826463-31826485 ATTATGCTTTTAATTAAAGATGG + Intronic
1081020350 11:37939754-37939776 ATTTTGTTTTTTATAAAACAAGG - Intergenic
1081042604 11:38230312-38230334 TTTTTTTTTTTTTTTAAACAAGG - Intergenic
1081389506 11:42513144-42513166 AGTCTGTTTTTTCTTAAATTAGG + Intergenic
1081623542 11:44633302-44633324 TTTGTGTTTTTTAGTAAAGATGG + Intergenic
1082035915 11:47645236-47645258 ATTTTGTTTTTTAGTAGAGATGG - Intergenic
1082060658 11:47857142-47857164 ATTTTTTTTTTTTTTAAACAGGG - Intergenic
1082106349 11:48225778-48225800 ATTCTGTTCTTTACTATTCAAGG + Intergenic
1082209597 11:49482552-49482574 CTGCTGTATTTTACTAAACAGGG - Intergenic
1082257588 11:50049655-50049677 ATTGTCATTTTTATTAGACATGG + Intergenic
1082566124 11:54680496-54680518 TTTCTTTTTTTTTTTAAACTAGG + Intergenic
1082669565 11:56017639-56017661 TTTTTGTTTTTTAGTAGACATGG - Intergenic
1083156510 11:60826679-60826701 ATTATTTTTTTTAAGAAACAGGG - Intergenic
1083239190 11:61373842-61373864 ATTTTTTTTTTTTTTAAAGATGG + Intergenic
1083396979 11:62399045-62399067 ATTTTGTATTTTAGTAGACACGG - Intergenic
1083693640 11:64427752-64427774 TTTCTTTTTTTTTTTAGACAGGG + Intergenic
1084046484 11:66571328-66571350 TTTTTGTTTTTTTTGAAACAGGG - Intergenic
1084129791 11:67124623-67124645 TTTTTTTTTTTTTTTAAACAAGG + Intronic
1084277162 11:68059063-68059085 ATTCTGTATTTTAGTAGAGACGG + Intronic
1084468581 11:69341979-69342001 TTTTTGTTTTTTATTAGAGACGG + Intronic
1084639544 11:70416601-70416623 TTTCTATTTTTTAGTAAAGATGG + Intronic
1084986408 11:72876975-72876997 ATTTTTTTTTTTTTTAGACAGGG + Intronic
1085165467 11:74396259-74396281 TTTTTTTTTTTTTTTAAACAGGG - Intronic
1085175432 11:74482561-74482583 TTTCTGTTTTGTAATAAATAAGG - Intergenic
1085478056 11:76799984-76800006 TTTTTTTTTTTTTTTAAACAGGG - Intergenic
1085577893 11:77623583-77623605 TTTTTTTTTTTTTTTAAACAGGG - Intronic
1085673385 11:78490753-78490775 ATTCTTTTTTTTTTGAAACAGGG - Intronic
1085891566 11:80585715-80585737 ATTTTGTATTTTATTAGAGATGG - Intergenic
1086006026 11:82037105-82037127 ATTTTTTTCTTTATTAAACCTGG + Intergenic
1086123862 11:83329265-83329287 TTTCTGTTTTGTAATAAATAAGG - Intergenic
1086304506 11:85465147-85465169 ATTTTTTTTTTTTTGAAACAGGG + Intronic
1086315111 11:85583170-85583192 GTTTTGTTTGTTTTTAAACAGGG + Intronic
1086352510 11:85956627-85956649 GTTCCTTTTTTTTTTAAACAGGG + Intergenic
1086392104 11:86375419-86375441 TTTCTGGTTTTGATTAAACCAGG + Intronic
1086933002 11:92713766-92713788 ATTATGTTTTTGATTCAACTGGG - Intronic
1086998021 11:93380911-93380933 ATTTTGTTTTTCATAAAACATGG - Intronic
1087098480 11:94342662-94342684 ACTTTTTTTTTTTTTAAACAGGG + Intergenic
1087193133 11:95277198-95277220 TTTCTTTTTTTTTTTTAACATGG - Intergenic
1087249483 11:95881125-95881147 AACCTTTTTTTTTTTAAACATGG + Intronic
1087656787 11:100933791-100933813 AGTCTTTTTTTTTTTAAAGATGG + Intronic
1087997809 11:104832597-104832619 ATACTGTTTTTTATTTACCATGG + Intergenic
1088057930 11:105608594-105608616 ATTCTGTTTTCTCTTGAAAAAGG - Intergenic
1088274219 11:108067540-108067562 ATTTTTTTTTTTTTTAAACCTGG + Intronic
1088317504 11:108522190-108522212 ATTTTTTTTTTTTTTAAAAAAGG + Intronic
1088345687 11:108822297-108822319 TTTCTGTTTTGTAATAAATAAGG + Intronic
1088439900 11:109858553-109858575 ATTAGATTTTTTATTAAATAAGG - Intergenic
1088473992 11:110216377-110216399 ATTTTTTTTTTTTTGAAACAGGG + Intronic
1088591839 11:111410180-111410202 ACTCTTTTTTTTTTTATACAGGG + Intronic
1088619294 11:111665273-111665295 ATTTTTTTTTTTTGTAAACATGG - Intronic
1088697300 11:112379044-112379066 ATTTTGTTTTTTAGTAGAGATGG + Intergenic
1088938669 11:114431453-114431475 TGTCTTTTTTTTATTATACATGG + Intronic
1088947087 11:114525284-114525306 ATTATATTTTTTATTAGATAGGG + Intronic
1088948808 11:114543512-114543534 ATTTTTTTTTTTTTTAAACAGGG - Intronic
1088977631 11:114829909-114829931 ATTCTATTATTTTTCAAACATGG + Intergenic
1089025633 11:115266775-115266797 ATTCTGTATCTTAATAAAAAAGG + Intronic
1089237627 11:117045647-117045669 ATTCTCTTTTTAAATAAAAAGGG + Intronic
1089506637 11:118967393-118967415 ATCCTGTTCCTTATTAAACTTGG - Intergenic
1089720598 11:120416615-120416637 GTTTTGTTTTTTAGCAAACAAGG - Intronic
1089971790 11:122699588-122699610 TTTCTTTTTTTTTTGAAACAAGG + Intronic
1090109805 11:123894871-123894893 TTTCTTTTTTTTAAGAAACAAGG - Intergenic
1090183786 11:124722780-124722802 GTTGGGTTTTTTTTTAAACATGG - Intergenic
1090343394 11:126046021-126046043 ATTCTGTATTTTGCTAAAAAGGG - Intronic
1090384155 11:126346916-126346938 TTTCTGTTTTTTAGTAGAGATGG - Intergenic
1090519504 11:127463333-127463355 ATTCTATTTTTTATTTATGATGG + Intergenic
1090559504 11:127915904-127915926 ATTCTGTCTTTCATAAATCATGG + Intergenic
1090584557 11:128196912-128196934 ATTCTGTTTTTCATTAGGCTGGG + Intergenic
1090754421 11:129776939-129776961 ATTCTTTTTTTTTTTAAATGTGG - Intergenic
1091425180 12:381811-381833 ACTCTGTTTTTTTGGAAACAGGG + Intronic
1091758061 12:3068411-3068433 GTCCTTTTTTTTTTTAAACACGG + Intergenic
1092275699 12:7059522-7059544 TTTCTTTTTTTTTTTAAACCTGG - Intronic
1092396947 12:8134981-8135003 TTTTTGTTTTTTTTTAATCATGG + Intronic
1093106132 12:15089800-15089822 ATTGTGTTTTTTGGTAAAGATGG + Intergenic
1093133882 12:15425503-15425525 ATTTTATATCTTATTAAACAAGG + Intronic
1093185215 12:16012479-16012501 ATTCTGTTTTTTTCTAAGGAGGG + Intronic
1093286679 12:17272310-17272332 ATTCTTTTTTTTATTTAACTGGG + Intergenic
1093534618 12:20208957-20208979 TTTTTTTTTTTTTTTAAACAGGG - Intergenic
1093781671 12:23144479-23144501 ATTCTTTTTGTTATTACACGTGG + Intergenic
1093881579 12:24410002-24410024 CTTTTTTTTTTTTTTAAACAGGG + Intergenic
1093969674 12:25363495-25363517 ATTTTATTTTTTAATAAAGATGG - Intergenic
1094027929 12:25978684-25978706 ATTTTTTTTTTTTTTAACCAGGG + Intronic
1094035511 12:26066129-26066151 ATTCTGTTTTTAGTCACACATGG + Intronic
1094082574 12:26553610-26553632 TTTCTGTTTTTTAAGAGACAGGG - Intronic
1094119743 12:26958352-26958374 TTTCTGTTTTTTAAGAGACAGGG - Intronic
1094447843 12:30551696-30551718 ATTCAGCTTTTTATTATTCAGGG + Intergenic
1094447959 12:30552877-30552899 CTTCAGTTTTTTATTATTCAGGG + Intergenic
1094799186 12:34010909-34010931 AATCTTTCTTTTATTAAACTAGG + Intergenic
1095043053 12:37465688-37465710 AATCTATTTTAAATTAAACAAGG - Intergenic
1095203474 12:39412352-39412374 ATTCAGTTTGTTATTCATCATGG - Intronic
1095205602 12:39436448-39436470 ATTTTTTTTTTTTTTAGACAGGG + Intronic
1095512977 12:42973982-42974004 TTTTTTTTTTTTTTTAAACAGGG - Intergenic
1095815242 12:46414627-46414649 ATTTTATTTATTTTTAAACACGG + Intergenic
1095884369 12:47173586-47173608 TTTTTTTTTTTTCTTAAACATGG + Intronic
1096469449 12:51866972-51866994 TTTTTTTTTTTTTTTAAACAGGG - Intergenic
1096656046 12:53092921-53092943 ATTCTTTTTTTTTTGAAACAGGG - Intergenic
1096846584 12:54410553-54410575 TTTTTTTTTTTTTTTAAACAGGG + Intronic
1096998003 12:55851548-55851570 ATTTTTTTTTTTTTTAAAGATGG - Intergenic
1097163556 12:57068356-57068378 TTTTTTTTTTTTTTTAAACAGGG + Intronic
1097532033 12:60813604-60813626 ATTCTGTTTTTACTAAGACAAGG - Intergenic
1097661260 12:62434218-62434240 TTTGTGTTTTTTAGTAGACACGG + Intergenic
1097858950 12:64498947-64498969 ATTTTTTTTTTTTTGAAACAGGG - Intronic
1097888821 12:64757416-64757438 TTTCTTTTTTTTAATAAAAAAGG + Intronic
1097889981 12:64768340-64768362 ATTGTTTTTTCTTTTAAACAGGG + Intergenic
1097932024 12:65198246-65198268 ATACTATAATTTATTAAACATGG - Intronic
1098058784 12:66538204-66538226 TTTTTTTTTTTTTTTAAACAGGG + Intronic
1098162975 12:67665055-67665077 ATTCTATATTTTCTTAAATATGG - Exonic
1098278384 12:68836959-68836981 TTTTTTTTTTTTTTTAAACAGGG + Intronic
1098309455 12:69133907-69133929 GTTTTGTTTTTTGTTAAATATGG + Intergenic
1098695528 12:73549183-73549205 TTTCTTTTTTTAATTAAACTAGG - Intergenic
1098799092 12:74930742-74930764 TTTTTTTTTTTTTTTAAACAGGG + Intergenic
1098875035 12:75858261-75858283 TTTTTTTTTTTTTTTAAACAGGG - Intergenic
1098893750 12:76034214-76034236 TTTTTTTTTTTTTTTAAACAGGG - Intergenic
1099112103 12:78574451-78574473 AATCTGTTTTTTGTTAAATATGG + Intergenic
1099201883 12:79688220-79688242 ACTTTTTTTTTTTTTAAACAAGG - Intronic
1099226486 12:79975907-79975929 ATTATGTTCTTTCTTAAAAAAGG - Intergenic
1099287660 12:80734818-80734840 ATTCTCTTTTATATTACAAAAGG + Intergenic
1099333827 12:81328820-81328842 TTTTTTTTTTTTTTTAAACAGGG + Intronic
1099371083 12:81830501-81830523 ATTCTGTTTTTTTTTAAGTGAGG - Intergenic
1099748436 12:86737751-86737773 AGTCTGTTTTTTTTTTAACTGGG - Intronic
1099901682 12:88718526-88718548 ATTCTTTTTTTTTTGAAATAGGG + Intergenic
1100215021 12:92438714-92438736 TTTCTGATTTTTGTTAAATAAGG - Intergenic
1100410436 12:94312068-94312090 ATTCTTTTTTTTTTTAAACATGG - Intronic
1100643859 12:96508662-96508684 TTTCTCTTTTTTAATACACATGG + Intronic
1100694143 12:97073210-97073232 ATTCTATTTTTTTTTAGAGATGG + Intergenic
1100781739 12:98034048-98034070 ATTCTATTTTTTCTTTAAAATGG - Intergenic
1101042111 12:100766784-100766806 AAACTGTTTATTATTAAAAATGG + Intronic
1101127172 12:101648175-101648197 ATTTTTTTGTCTATTAAACATGG - Intronic
1101255193 12:102970185-102970207 AATCTGTGTGTTTTTAAACAAGG + Intergenic
1101261869 12:103041069-103041091 ATTCTTTTTTTTTTTTAAGAAGG + Intergenic
1101634378 12:106525947-106525969 TTTTTTTTTTTTTTTAAACAGGG + Intronic
1101636256 12:106544731-106544753 ATTCTATTTTTTAGTAGAGACGG - Intronic
1101720760 12:107348716-107348738 TTTCTCTTTTTTATGAGACAGGG - Intronic
1101851807 12:108409347-108409369 ATTTTTTTTTTTTTTAGACAGGG - Intergenic
1101935742 12:109054895-109054917 ATGCTGATTATTATAAAACAGGG + Intronic
1102058957 12:109917828-109917850 ACTCTGATTTTTAATAACCATGG - Exonic
1102211821 12:111132736-111132758 TTTCTATTTTTTATTAGAGATGG + Intronic
1102283243 12:111634882-111634904 TTTTTTTTTTTTAATAAACAAGG - Intergenic
1102334107 12:112062720-112062742 ATTCTTTTTTTTTTTTAATACGG - Intronic
1102710667 12:114923657-114923679 ATTCTTTTTTATATTAAAAATGG + Intergenic
1102777843 12:115536152-115536174 TTTTTTTTTTTTTTTAAACAGGG - Intergenic
1102827619 12:115962729-115962751 ATTATGTGTTTTTTTAAAAATGG - Intronic
1103028257 12:117591704-117591726 ATTTTTTTTTTTTTTAAGCAGGG - Intronic
1103103748 12:118204541-118204563 ATGATGTTTTTTATTCAAAAAGG - Intronic
1103287544 12:119815230-119815252 CTTTTTTTTTTTTTTAAACAAGG - Intronic
1103453433 12:121046056-121046078 ATTTTTTCTTTTTTTAAACAGGG - Intergenic
1103540050 12:121659701-121659723 ATTTTGTGTTTTAGTAAAGATGG + Intronic
1103644263 12:122378407-122378429 GTGCTGTTTTGTTTTAAACAAGG + Intronic
1103801615 12:123541521-123541543 CTTTTTTTTTTTCTTAAACAGGG - Intergenic
1103804899 12:123564736-123564758 ATTTTGTATTTTATTAGAGATGG + Intergenic
1104131058 12:125894534-125894556 ATTCTGTGATTTATTCTACAGGG + Intergenic
1104134206 12:125922042-125922064 ATTTTGTTATTTAATAAAGATGG - Intergenic
1104408703 12:128540553-128540575 ATTCTCTGTTTTCTTAAACACGG + Intronic
1104571315 12:129928404-129928426 ATTTTGTATTTTATTAGAGATGG - Intergenic
1104703962 12:130928954-130928976 TTTTTTTTTTTTTTTAAACAGGG + Intergenic
1104731955 12:131111803-131111825 ATTCTGTGTTTGATGAGACAGGG + Intronic
1105015003 12:132781256-132781278 ATTCTTTTTTTTTTGAGACAGGG - Intronic
1105326807 13:19377790-19377812 ATTTTGTTTATTTTTAAAGATGG - Intergenic
1105351585 13:19620888-19620910 TTTTTTTTTTTTTTTAAACAGGG + Intergenic
1105749558 13:23409360-23409382 TTTTTTTTTTTTTTTAAACATGG + Intronic
1105779263 13:23692226-23692248 ATTTTGTTTTTTATTTAATCTGG - Intergenic
1105835978 13:24212286-24212308 TTTTTTTTTTTTCTTAAACAGGG - Intronic
1106010382 13:25815025-25815047 ATTTTTTTTTTTTTGAAACAAGG - Intronic
1106202434 13:27551270-27551292 ATTTTCTTTTTTTTTAAAGATGG - Intronic
1106417241 13:29556380-29556402 ATTTTCTTTTTTTTTAGACAGGG + Intronic
1106775486 13:33004418-33004440 ATGCTGTTTTTTATTAAGTTGGG + Intergenic
1106959725 13:34984278-34984300 ATCCTTTTGTTTATTAAATAGGG + Intronic
1107264189 13:38532012-38532034 TTTTTCTTTTTTATTAAAAATGG - Intergenic
1107318045 13:39155271-39155293 ATTCTGTCTTTCACTGAACACGG + Intergenic
1107450235 13:40501710-40501732 AATCTTTTTTTTTTTAAATATGG - Intergenic
1107489125 13:40863558-40863580 TTTCTGTTTTTTAATAAATAAGG + Intergenic
1107759291 13:43659481-43659503 ATTTTTTTTTTTTTTACACAGGG - Intronic
1107909777 13:45094833-45094855 TTTCTGTTCTTTATTATGCATGG + Intergenic
1107914938 13:45140043-45140065 TTTCTCTTTTTTTTGAAACAGGG + Intronic
1107917909 13:45171247-45171269 TTTCTGTTTTTTAGTAGAGATGG + Intronic
1108033307 13:46259625-46259647 ATATTGTTATTTATTAAAGAAGG + Intronic
1108433283 13:50376304-50376326 TTTCTTTTTTTTTTTAAATAAGG + Intronic
1108553145 13:51566539-51566561 ATTCAGTTATTTATTCAATAAGG + Intergenic
1108899752 13:55387222-55387244 TTTCTGTTTTTTTTTTAACAAGG - Intergenic
1109014113 13:56986617-56986639 TTTCTGTGTCTTATGAAACATGG + Intergenic
1109272503 13:60270087-60270109 AATCTGTTTTTAAATGAACATGG - Intergenic
1109287979 13:60434457-60434479 TTTTTTTTTTTTTTTAAACAGGG - Intronic
1109349196 13:61155393-61155415 ATTTTTTTTTTTTTTAAAGATGG + Intergenic
1109371952 13:61434071-61434093 ATTCTGTTCTTTAAAAAAGATGG - Intergenic
1109414286 13:62015823-62015845 ATTATGTTTTATATTAGAGAAGG - Intergenic
1109425681 13:62164130-62164152 TTTCTATTTTTTATTAGAGACGG + Intergenic
1109495664 13:63168505-63168527 CTTCTCTTTTTGTTTAAACAAGG - Intergenic
1109509129 13:63346314-63346336 ATTTTTTTTTTTTTTAAACAAGG - Intergenic
1109671582 13:65615125-65615147 ACGCTATTTTTTATTAAAAACGG + Intergenic
1109820401 13:67645096-67645118 GTTCTGTTGTATATTAAATAGGG - Intergenic
1109826984 13:67734641-67734663 ATCCTGTGTTTAAATAAACAAGG - Intergenic
1109888602 13:68576824-68576846 ATGTTGATTTCTATTAAACATGG + Intergenic
1109916832 13:69000005-69000027 AGTCTGTTTTTTCTGAAACTAGG - Intergenic
1109990342 13:70046682-70046704 GTTCTGTTTTTTAATAGAGACGG + Intronic
1110598603 13:77345960-77345982 TTTTTTTTTTTTTTTAAACAGGG + Intergenic
1110918296 13:81050922-81050944 TTTTTTTTTTTTAATAAACAAGG - Intergenic
1110949583 13:81468855-81468877 TTTTTGTTTTTTTTTAAAGACGG + Intergenic
1111379274 13:87425295-87425317 ATTTTGTATTTTTTTAAAAAAGG - Intergenic
1111436717 13:88220491-88220513 GTTCTGATTTTTATTCAATAGGG - Intergenic
1111440476 13:88276648-88276670 ACTCTGTTGTCTATTAAACAAGG + Intergenic
1111523698 13:89438895-89438917 ATTATTTTTTTTTTTAAAAAAGG + Intergenic
1111532444 13:89556520-89556542 ATTCTGGGCATTATTAAACAAGG + Intergenic
1111569466 13:90063548-90063570 TAGCTGTTTTTTATTAAACATGG + Intergenic
1111620749 13:90722244-90722266 ATGTTTTTTTTTCTTAAACATGG - Intergenic
1111749932 13:92316174-92316196 ATTCTGATTTTTATTTTTCATGG - Intronic
1111781638 13:92734654-92734676 ATTGTGATGTTTATTAAATATGG + Intronic
1112085615 13:96028971-96028993 ATTTTTTTTTTTATTAGAGACGG - Intronic
1112337415 13:98526689-98526711 ATTCTGTTTTTCAAGAAACTTGG + Intronic
1112350518 13:98629648-98629670 TTTCTGTTTTGTAATAAACAAGG + Intergenic
1112359896 13:98707884-98707906 TTTTTTTTTTTTTTTAAACAGGG - Intronic
1112514476 13:100040681-100040703 ATTTTTTTTTTTTTTTAACATGG + Intergenic
1112550217 13:100412666-100412688 GTTTTGTTTTTTTTTAAACCAGG + Intronic
1112551096 13:100421417-100421439 ATTCTGTATTTTCTTGAAAATGG + Intronic
1112762294 13:102705007-102705029 ATTCTTTTTTTTAAAAAAAAAGG - Intergenic
1113059956 13:106312142-106312164 ATAATTTTTTTTTTTAAACATGG - Intergenic
1113136763 13:107099296-107099318 TTGCTGTTTTTTTTTAAATATGG + Intergenic
1113138813 13:107123855-107123877 ATTCAGTTTTTTGTAAATCAGGG - Intergenic
1113308337 13:109103271-109103293 ATTCTGTTTTTAATTAATACAGG + Intronic
1113602932 13:111583926-111583948 ATTCTGTTTTTTATAGAATGGGG + Intergenic
1113626545 13:111852222-111852244 TTTCTTTTTTTTTTGAAACAGGG - Intergenic
1114145922 14:19978358-19978380 ATTATGTTTTTCACTAAAGACGG + Intergenic
1114599035 14:23939504-23939526 ATTTTGAATTTAATTAAACAAGG - Intergenic
1114667009 14:24383960-24383982 TTTTTCTTTTTTTTTAAACAGGG - Intergenic
1114905934 14:27126523-27126545 ATTCTGTTCTTTCTCAAAAATGG + Intergenic
1115207977 14:30933270-30933292 TTTTTTTTTTTTATGAAACAGGG - Intronic
1115233411 14:31185718-31185740 CTTCTTTTTTTTTTTAAACAGGG - Intronic
1115237797 14:31225193-31225215 TTTTTTTTTTTTTTTAAACAGGG + Intergenic
1115280329 14:31654579-31654601 TTTCTATTTTTTAGTAGACATGG + Intronic
1115296804 14:31837322-31837344 TTTTTGTTTTTTTTGAAACAGGG - Intronic
1115466754 14:33723447-33723469 ATCCTGTATTTTATTCAGCAAGG + Intronic
1115496405 14:34009006-34009028 TTTTTTTTTTTAATTAAACAGGG + Intronic
1115498502 14:34029170-34029192 TTTTTTTTTTTTTTTAAACAGGG - Intronic
1115525825 14:34279726-34279748 ATTCTTTTTTTTTTTTAAGATGG - Intronic
1115608728 14:35031844-35031866 ATTTTTATTTTTATTAGACACGG - Intergenic
1115695420 14:35892797-35892819 TTTCTGTTTTGTAGTAAATAAGG + Intronic
1116278146 14:42863917-42863939 ATTTTATTTTTAATTAAAGAAGG - Intergenic
1116352874 14:43887781-43887803 AGTCTCTTTTTTGTTAAATAAGG + Intergenic
1116458229 14:45143174-45143196 TTTTTTTTTTTTTTTAAACAGGG + Intronic
1116520300 14:45838619-45838641 AATTTGTTTTTTATTAAATATGG + Intergenic
1116844831 14:49855437-49855459 TTTTTTTTTTTTATTAGACAGGG - Intergenic
1116913715 14:50499649-50499671 CTTTTTTTTTTTTTTAAACAGGG - Intronic
1116995308 14:51317741-51317763 GTTTTGTTTTGTATAAAACAGGG - Intergenic
1117393179 14:55282165-55282187 TTTCTGTATTTTAGTAGACAGGG + Intronic
1117631510 14:57697692-57697714 TTTTTTTTTTTTTTTAAACAGGG - Intronic
1117740114 14:58809307-58809329 ACTCTGTTTTTTTCTGAACAAGG - Intergenic
1117806652 14:59499392-59499414 ATACTGTTTATTATTAAGTAGGG + Intronic
1118344938 14:64931525-64931547 TTTCTTTTTTTTTTTAGACACGG - Intronic
1118408842 14:65455077-65455099 ATTCCTTTTTTTAAAAAACAGGG - Intronic
1118740466 14:68736030-68736052 GTTTTGTTTTGTTTTAAACAAGG + Intergenic
1119024910 14:71144837-71144859 TTTCTTTTATTTTTTAAACAGGG - Intergenic
1119026885 14:71160101-71160123 ATTCCTTTTTTTTTTTAACAGGG + Intergenic
1119066746 14:71535778-71535800 ATTTTTTTTTTTAGTAGACAAGG + Intronic
1119067220 14:71541110-71541132 CTTCTTTTTTTTTTTAAAGATGG - Intronic
1119250616 14:73150385-73150407 ATACTCAATTTTATTAAACATGG - Intronic
1119279112 14:73388792-73388814 ATTGTATTTTTTATTAGAGACGG - Intronic
1119395311 14:74322016-74322038 ATTCTGTTTTTTAGTAGAGACGG + Intronic
1119416053 14:74470171-74470193 ATTTTTTTTTTTTTTAAAAAGGG - Intergenic
1119462069 14:74814354-74814376 ATTCTTCTTTTTTTTAAAGACGG - Intronic
1119516700 14:75254108-75254130 TTTCTTTTTTTTAACAAACAAGG + Intronic
1119516909 14:75255357-75255379 TTTCTTTTTTTTTTTAAAGAAGG - Intronic
1119532043 14:75369072-75369094 ATTCTTTTTTTTTTTAAATCAGG + Intergenic
1120432096 14:84432201-84432223 ATTCTCTTGATTATTAAACAAGG + Intergenic
1120469205 14:84901665-84901687 ATTATGTTTTTTTTTAAACTGGG + Intergenic
1120555592 14:85926623-85926645 ATTCATTTTTTTAATCAACATGG + Intergenic
1120615755 14:86701833-86701855 ATTTTAATTTTTATTAAAAAGGG - Intergenic
1120882564 14:89425534-89425556 ATTTTTTTTTTTAATAGACACGG + Intronic
1120913823 14:89692023-89692045 ATTTTGTTTTTTAGTAGAGACGG + Intergenic
1120993911 14:90400767-90400789 ATTTTATTTGTTATGAAACAAGG + Intronic
1121094727 14:91208740-91208762 ATTCTATTTTTTTTGAGACAGGG - Intronic
1121234946 14:92385489-92385511 ATTTTTTTTTTTTTTAAAGACGG - Intronic
1121271718 14:92642108-92642130 TTTCTTTTTTTTTTGAAACAGGG + Intronic
1121285277 14:92730420-92730442 ATTATCATTTTTTTTAAACAAGG + Intronic
1121297141 14:92837568-92837590 TTTTTGTTTTTTTTGAAACAGGG + Intronic
1121491215 14:94362319-94362341 ATTCTCTTTATTCTGAAACAAGG - Intergenic
1121753747 14:96383387-96383409 TTTTTTTTTTTTTTTAAACAGGG - Intronic
1121826062 14:97010521-97010543 ATTCTGATTTTTTTTTATCAAGG + Intergenic
1122455230 14:101845131-101845153 TTTTTTTTTTTTTTTAAACAGGG - Intronic
1122539709 14:102491220-102491242 ATTTTGTTTATTATTACAGAGGG + Intronic
1122574777 14:102734997-102735019 ATTTTTTTTTTTTTGAAACAGGG + Intergenic
1122760554 14:104021906-104021928 ATTCTGCATTATATTATACAAGG + Intronic
1123026173 14:105425284-105425306 ATTATGTTTTTTTTGAGACAGGG + Intronic
1202941596 14_KI270725v1_random:153291-153313 AATCTATTTTAAATTAAACAAGG - Intergenic
1123806517 15:23879605-23879627 ATTCTGTTGTTTATAAGTCACGG + Intergenic
1124124239 15:26924135-26924157 ATTCTGTATATTATAATACAAGG + Intronic
1124461841 15:29899261-29899283 CTTCTGTTTTTAATTATATATGG + Intronic
1125019512 15:34970544-34970566 ATTTTGTTTTTTAGTAGAGATGG - Intergenic
1125146108 15:36470980-36471002 AGGCTGGTTTTTATTGAACATGG - Intergenic
1125243263 15:37601554-37601576 ATTCAGTCTTTTAAGAAACAAGG - Intergenic
1125275993 15:37993227-37993249 TTTCTGTTTTTTTTTAAATGGGG + Intergenic
1125652199 15:41326594-41326616 ATTTTGTCTTTTACTAGACACGG + Intronic
1125806996 15:42502196-42502218 TTTCTGTTTTTTAGTAGAGACGG + Intronic
1125835478 15:42746969-42746991 TTTTTTTTTTTTTTTAAACAGGG + Intronic
1125840256 15:42793831-42793853 ATTTTTTTTTTTTTTAAACATGG - Intronic
1126140003 15:45429962-45429984 ATTCTATTTTATTTAAAACAGGG + Intergenic
1126291882 15:47090101-47090123 AATCTATTTTAAATTAAACAAGG + Intergenic
1126403609 15:48300317-48300339 CTTTTTTTTTTTTTTAAACAGGG - Intronic
1126450268 15:48800486-48800508 ATTTTGTGTTTTATTGCACAAGG - Intronic
1126636906 15:50788765-50788787 ATTCTTTTTTTTTTAAGACAAGG + Intergenic
1126657905 15:51000147-51000169 TTTTTTTTTTTTTTTAAACAGGG + Intronic
1127131766 15:55872910-55872932 TTTTTTTTTTTTTTTAAACAGGG - Intronic
1127585320 15:60372698-60372720 TTTTTTTTTTTTTTTAAACAGGG + Intronic
1127603118 15:60558371-60558393 TTCCTGTTTTGTAATAAACAAGG - Intronic
1127769222 15:62217292-62217314 AATCTGTTTTTTTTTAAACAGGG + Intergenic
1127870273 15:63067099-63067121 CTCCTGTTTTTTTTTTAACATGG + Intronic
1127937709 15:63658731-63658753 ATTCTGTTTTGTTCTCAACAAGG + Intronic
1127967341 15:63932158-63932180 TTTTTTTTTTTTTTTAAACAGGG - Intronic
1128026737 15:64443849-64443871 GTTTTGTTTTTTTTTAAAGATGG - Intronic
1128155246 15:65387937-65387959 ATTGTATTTTTTAGTAAAGACGG - Intronic
1128427080 15:67552922-67552944 ATTCTGGTTGTTCTTAAGCATGG + Intronic
1128851117 15:70957478-70957500 ATTCACTTTTTTTTTAATCAAGG + Intronic
1129339983 15:74879369-74879391 TTTCTGTTTTTTTTGAGACAGGG + Intergenic
1129358668 15:75010771-75010793 ATTTTTTTTTTTCTTAGACAGGG - Intronic
1129386282 15:75197920-75197942 TTTTTGTTTTTTAGTAGACATGG + Intronic
1129582342 15:76825668-76825690 ATTCTGTTTTTTATTATTCTGGG - Intronic
1130075123 15:80682046-80682068 ATTCTGTTCTTTATTCCACATGG - Intronic
1130528818 15:84730107-84730129 ATTTTTTTTTTTTTTAGACAGGG + Intergenic
1130528895 15:84730694-84730716 ATTTTTTTTTTTTTTAAAGATGG + Intergenic
1130816242 15:87436997-87437019 TTTTTTTTTTTTTTTAAACAGGG - Intergenic
1131395219 15:92080317-92080339 TTTTTGTGTTTTTTTAAACAGGG + Intronic
1131462813 15:92631497-92631519 ATTCTTTTTTTTTTTTAAGATGG + Intronic
1131474150 15:92722018-92722040 TTTTTGTTTTTTTGTAAACAGGG + Intronic
1132043252 15:98542902-98542924 TTTTTTTTTTTTTTTAAACAGGG - Intergenic
1132056603 15:98655634-98655656 ATTTTTTTTTTTAATAAACATGG - Intronic
1132831746 16:1931903-1931925 ATTCTGTATTTTAGTAGAGATGG + Intergenic
1132994150 16:2814305-2814327 TTTTTTTTTTTTTTTAAACACGG + Intergenic
1133140735 16:3741901-3741923 TTTCTGTTTTTTAGTAGAGATGG - Intronic
1133224484 16:4334242-4334264 TTTTTTTTTTTTTTTAAACAGGG + Intronic
1133941120 16:10309953-10309975 TTTCTTTTTTTTTTGAAACAGGG + Intergenic
1134038964 16:11053372-11053394 ATTTTTTTTTTTTTTAGACAGGG + Intronic
1134046033 16:11101807-11101829 TTTCTTTTTTTTTTGAAACAGGG + Intronic
1134170119 16:11961771-11961793 TTTTTTTTTTTTTTTAAACAGGG - Intronic
1134740955 16:16544165-16544187 ATTCTTTTTTTTTTTTGACACGG - Intergenic
1135274034 16:21095769-21095791 ATACTGTTTTTTTTGAGACAGGG + Intronic
1135337749 16:21617720-21617742 ATTTTTTTTTTTTTTAGACAAGG - Intronic
1135739533 16:24961702-24961724 TTTCTGTTTTTTAGTAGAGATGG + Intronic
1136847372 16:33587514-33587536 TTTTTTTTTTTTTTTAAACAGGG - Intergenic
1137242860 16:46673139-46673161 ATTTTATTTTTTATTAGAGACGG + Intronic
1137466794 16:48717155-48717177 GTTCTGGTTTTTATGACACATGG + Intergenic
1137922306 16:52502530-52502552 TTACTGCTTTTTATTAAAAATGG - Intronic
1138056446 16:53838923-53838945 ATTATGTATGTTATTAAATATGG + Intronic
1138134128 16:54507135-54507157 ATTCTGTCTTTTTTTTAAAAAGG + Intergenic
1138283162 16:55787370-55787392 AATCTGTTCTTTCTTAAACTTGG + Intergenic
1138340102 16:56283522-56283544 ACTATGTTTTTTAATAATCATGG + Intronic
1138655178 16:58487348-58487370 TTTGTGTTTTTTAGTAAAGACGG - Intronic
1138819812 16:60245632-60245654 ATTTTTTTTTTTTTGAAACAAGG + Intergenic
1138869306 16:60862102-60862124 ATTCTATTTGTTTTTAAACATGG - Intergenic
1138922671 16:61551415-61551437 ATTATGTTTTTTTTAAAAAAGGG + Intergenic
1138957649 16:61990817-61990839 TTTCTTTCTTTTATTAAAGACGG - Intronic
1139002529 16:62530588-62530610 AATGTATTTTCTATTAAACAGGG - Intergenic
1139062455 16:63269878-63269900 ATTCTATATTTTATTCAACAGGG - Intergenic
1139627193 16:68199530-68199552 TTTTTTTTTTTTTTTAAACAGGG - Intronic
1139839830 16:69869391-69869413 TTTTTTTTTTTTGTTAAACAAGG + Intronic
1140074031 16:71679908-71679930 TTTCTGTTTTTTAGTAGAGATGG - Intronic
1140111345 16:72008149-72008171 ATTTTATTTTTTAGTAGACACGG + Intergenic
1140486541 16:75298144-75298166 ATTCTGTGTTTGTTTAAACTTGG + Intronic
1140604455 16:76517877-76517899 AGCCTGTTTTTTTTTAAAAAAGG + Intronic
1141207321 16:81942918-81942940 ATTTTTTTTTTTTTTATACAAGG + Intronic
1141299441 16:82800062-82800084 TTCCTGTCTTTTAATAAACATGG - Intronic
1141387554 16:83636091-83636113 ATTTTTTTTTTTTTTAATCAAGG - Intronic
1141543872 16:84749567-84749589 ATTTTTTTTTTTTTTAAAGATGG - Intronic
1203109080 16_KI270728v1_random:1436169-1436191 TTTTTTTTTTTTTTTAAACAGGG - Intergenic
1142545070 17:695554-695576 TTTCTTTTTTTTTTTAAACAGGG + Intronic
1142583496 17:956221-956243 ATTCTTTCTTTCAATAAACACGG + Intronic
1142658442 17:1410522-1410544 TTTCTTTTTTTTTTTAAAGATGG + Intergenic
1142663067 17:1444656-1444678 ATTTTTTTTTTTAGTAAAGACGG - Intronic
1142710338 17:1719690-1719712 ATTTTTTTTTTTTTTAAAGAGGG - Intronic
1142822460 17:2481199-2481221 TTTCTTTTTTTTCTGAAACATGG - Intronic
1142909799 17:3079429-3079451 AACCTGTTTTTTATTTTACAGGG - Intergenic
1142924703 17:3224380-3224402 AACCTGTTTTTTATTTTACAGGG + Intergenic
1143199403 17:5101639-5101661 TTTCTATTTTTTTTTTAACAGGG + Intergenic
1143261275 17:5600125-5600147 TTAGTGATTTTTATTAAACATGG + Intronic
1143298154 17:5886767-5886789 ATTTTGTATTTTAGTAAAGATGG + Intronic
1143392653 17:6569035-6569057 ATTTTATTTTTTAGTAAAGATGG - Intergenic
1143425092 17:6829518-6829540 TTTTTTTTTTTTATGAAACAGGG + Intronic
1143624106 17:8098855-8098877 TTTCTTTTTTTGTTTAAACAGGG + Intronic
1144031313 17:11325689-11325711 TTTTTTTTTTTTTTTAAACATGG - Intronic
1144392555 17:14808731-14808753 ATTCAGTTTTTTAATAGATATGG - Intergenic
1144517060 17:15925963-15925985 AATCTGTTTTTTTTTTAAGACGG - Intergenic
1144541736 17:16149066-16149088 ATTCTTTCTTTTATTAGAAACGG - Intronic
1145349591 17:22069215-22069237 ATTTTGTTTTTTTTAAGACACGG + Intergenic
1145765191 17:27454202-27454224 ATTTTTTTTTTTTTGAAACAGGG - Intergenic
1145849697 17:28080894-28080916 ATTGTGTTTTTTTTGAGACAGGG + Intronic
1146090021 17:29867804-29867826 GTTCTCTTATTTATTAAAGAAGG - Intronic
1146148339 17:30442729-30442751 ATGCTGGTCTTTTTTAAACACGG - Intronic
1146197795 17:30827897-30827919 TTTTTGTATTTTATTAGACATGG + Intergenic
1146345004 17:32054153-32054175 ATTTTTTTTTTTTTTAAGCAAGG + Intergenic
1146382002 17:32337454-32337476 ATTTTTTTTTTTTTTAGACAGGG - Intronic
1146475604 17:33160200-33160222 TTTCTTTTTTTTTTTTAACAGGG - Intronic
1146548260 17:33757641-33757663 CTCCTGTTTTCTATAAAACATGG - Intronic
1146959055 17:36956804-36956826 ATTTTTATTTTTATTAAAGATGG - Intronic
1147336972 17:39732173-39732195 ATTTTTTTTTTTTTTAAACCAGG + Intergenic
1147381211 17:40057298-40057320 ATTTTGTTTTTTAGTAGAGATGG - Intronic
1147403970 17:40197572-40197594 TTTTTTTTTTTTTTTAAACAGGG - Intergenic
1147432194 17:40378904-40378926 ATTTTTTTTTTTATTAGAGATGG + Intergenic
1147496121 17:40917373-40917395 TTTTTTTTTTTTTTTAAACAGGG - Intergenic
1148060701 17:44834295-44834317 GTTTTGTTTTTTTTTAAACGCGG - Intergenic
1148168015 17:45497219-45497241 ATTTTGTTTTTTTTGAGACAGGG - Intergenic
1148280802 17:46345738-46345760 ATTTTGTTTTTTTTGAGACAGGG + Intronic
1148303030 17:46563673-46563695 ATTTTGTTTTTTTTGAGACAGGG + Intronic
1148561953 17:48611396-48611418 GGTCTGTTCTTTATTAAACCAGG + Intronic
1149742293 17:59058212-59058234 ATTATGTTTTTTGTGCAACATGG + Intronic
1149790694 17:59474471-59474493 ATTTTTTTTTTTTTGAAACAGGG + Intergenic
1149808051 17:59637907-59637929 ATTCTTTTTTTTCTCATACAGGG - Intronic
1149875869 17:60232482-60232504 TTTTTTTTTTTTTTTAAACAAGG + Intronic
1149919189 17:60640297-60640319 CTTTTGTTTTTTCTGAAACAGGG - Intronic
1150026807 17:61684519-61684541 ATTCTTTTATTTAATAAATAAGG + Intronic
1150035383 17:61790644-61790666 CTTTTCTTTTTTTTTAAACAGGG + Intronic
1150078756 17:62217428-62217450 TTTCTTTTTTTTTTTTAACATGG + Intergenic
1150254302 17:63731869-63731891 CTTTTGTTTTTTATGAGACAGGG + Intronic
1150422192 17:65047658-65047680 ATTCTTTTTTTTTTTTAAGAGGG + Intronic
1150512529 17:65771842-65771864 ATTATTTTTTTTCTTAGACATGG - Intronic
1150517062 17:65824926-65824948 ATTCTGTTTTTAATTTTTCAGGG - Intronic
1150901519 17:69282991-69283013 TTTTTTTTTTTTTTTAAACAGGG + Intronic
1150942130 17:69704263-69704285 GTTGTTTTTTTTTTTAAACAGGG + Intergenic
1151013365 17:70526928-70526950 ATGGTGTCTGTTATTAAACAGGG + Intergenic
1151151577 17:72092431-72092453 TTTTTTTTTTTTTTTAAACAGGG - Intergenic
1151302877 17:73241328-73241350 TTTCTGTTTTTTAGTAGAGACGG + Intronic
1151307481 17:73272586-73272608 ATTCTGTACTTTCTAAAACAGGG + Intergenic
1151706158 17:75769057-75769079 TTTCTATTTTTTAGTAAAGATGG - Intergenic
1151940841 17:77290872-77290894 ATTATTATTATTATTAAACAGGG + Intronic
1151969123 17:77448786-77448808 TTTCTTTTTTTTTTTAAATATGG + Intronic
1152731202 17:81971577-81971599 ATTTTGTTTTTTACTAAATTTGG - Intergenic
1153356902 18:4147333-4147355 ATTGTGCTCTTTAATAAACAGGG - Intronic
1153488219 18:5623652-5623674 ATTCTTTTTTTTTTTTAAGACGG + Intronic
1153650981 18:7240064-7240086 ATTCTTTTTTTTTTTTAAGACGG - Intergenic
1153933102 18:9896186-9896208 ATTTTTTTTTTTTTTAAACACGG - Intergenic
1154156840 18:11950523-11950545 ATTTTTTTTTTTTTTAAACAAGG - Intergenic
1154366054 18:13710188-13710210 TTTCTTTTTTTTTTGAAACAAGG + Intronic
1154463054 18:14615962-14615984 ATTATGTTTTTCACTAAAGAGGG + Intergenic
1155025868 18:21940566-21940588 ATTTTGTTTTTTAATATATAGGG + Intergenic
1155766572 18:29641853-29641875 ATTTTATTTTTTATTTAAGATGG - Intergenic
1155822854 18:30400013-30400035 ATTTTTTTTTTTATGAGACAGGG + Intergenic
1155855830 18:30833398-30833420 AATCTCTTTTCTATTACACATGG + Intergenic
1155974061 18:32109158-32109180 TTTTTTTTTTTTTTTAAACAAGG + Intronic
1156122920 18:33866388-33866410 TTTCTGTCTTTTTTTAAACAAGG - Intronic
1156414349 18:36872068-36872090 ACTATGTTTTTTGTTACACAGGG - Intronic
1156756284 18:40530674-40530696 ATTATCATTTTTATTATACATGG - Intergenic
1156780884 18:40849259-40849281 ATTTTTTTTTTTTTTAAAGAAGG + Intergenic
1156861176 18:41837992-41838014 ATTTTCTTTTTTGTTGAACAGGG + Intergenic
1157134959 18:45045109-45045131 ATTTTTTTTTTTAGTAAAGACGG - Intronic
1157210423 18:45737326-45737348 ATTCTGTATTTTTTAAAACCTGG + Intronic
1157634135 18:49132593-49132615 ATTTTGTTCTTCCTTAAACAGGG + Intronic
1157659987 18:49432782-49432804 ATTCTGTTATTTGGTAAAGATGG + Intronic
1157719204 18:49910561-49910583 CTTTTTTTTTTTTTTAAACAGGG - Intronic
1157840214 18:50950481-50950503 TTTTTTTTTTTTTTTAAACAGGG + Exonic
1157864092 18:51166123-51166145 TTTGTGTTTTTTAATAAAGATGG + Intergenic
1158008496 18:52701224-52701246 TTTTTCTTTTTTATTGAACAAGG + Intronic
1158348118 18:56536273-56536295 TTTCTGTTTTTTAGTAGAGATGG - Intergenic
1158583837 18:58710899-58710921 AATTTGTTTTTTCTGAAACAAGG + Exonic
1158685845 18:59613726-59613748 ATTTTTTTTTTTAATAAAGATGG - Intronic
1158942724 18:62420676-62420698 ATTTTTTTTTTTTTTAAAGAGGG - Intergenic
1159107695 18:64022584-64022606 ATTCTGATTTTTTTAAAATATGG - Intergenic
1159252642 18:65900072-65900094 AATCTCTTTTGTATTAAACTGGG - Intergenic
1159919987 18:74219530-74219552 ATTCTGTTTTTAATTTATTAAGG + Intergenic
1159950879 18:74482095-74482117 ATTATTATTTTTTTTAAACAGGG - Intergenic
1160241745 18:77129857-77129879 TTTTTGTTTTTTAGTAAAGATGG - Intronic
1160301893 18:77689445-77689467 ATTTTTTTTTTTTTTAACCAGGG + Intergenic
1161471835 19:4461291-4461313 TTTCTTTTTTTTTTTAGACAGGG + Intergenic
1161630116 19:5349983-5350005 ATTTTTTTTTTTTGTAAACATGG + Intergenic
1161901727 19:7124189-7124211 ATACTTTTTTTTATTAGAGACGG - Intronic
1161937335 19:7380169-7380191 TTTTTTTTTTTTTTTAAACAGGG - Intronic
1161941618 19:7408268-7408290 TTTCTCTTTTTTTTGAAACAGGG - Intronic
1161941809 19:7409605-7409627 TTTGTATTTTTTAGTAAACACGG + Intronic
1162291234 19:9782270-9782292 TTTCTCTTTTTTATTAGACAGGG + Intronic
1162504908 19:11077865-11077887 ATTCTTTTTTTTTTTTGACACGG + Intergenic
1162530719 19:11234947-11234969 ATTTTTTTTTTTTTGAAACAGGG + Intronic
1162569679 19:11464167-11464189 ATTTTTTTTTTTTTTAGACAGGG + Intronic
1162693824 19:12456001-12456023 ATTTTTTTTTTTTTTAGACAGGG + Intronic
1162934863 19:13976987-13977009 TTTCTGTTTTTTTTGAGACAGGG - Intronic
1162942962 19:14024813-14024835 ATTTTTTTTTTTTTTAGACAAGG + Intergenic
1163040134 19:14596031-14596053 CTTCTTTTTCTTTTTAAACATGG - Intronic
1163045602 19:14639408-14639430 ATTCTTTTTTTTTTGAGACATGG + Intronic
1163173189 19:15547193-15547215 TTTGTGTTTTTTAGTAAAGATGG + Intronic
1163280029 19:16310346-16310368 ATTTTTTTTTTTTTTAAATAGGG + Intergenic
1163370548 19:16898916-16898938 TTTTTGTTTTTTTTTAGACAAGG + Intronic
1163399852 19:17085651-17085673 TTTTTTTTTTTTATTAAAGACGG - Intronic
1163452640 19:17387545-17387567 TTTGTGTTTTTTAGTAAAGACGG - Intergenic
1163644697 19:18482322-18482344 TTTTTTTTTTTTTTTAAACAGGG + Intronic
1163687717 19:18721499-18721521 TTTTTTTTTTTTTTTAAACAAGG + Intronic
1163839424 19:19597039-19597061 TTTGTATTTTTTATTAAAGATGG - Intronic
1163985502 19:20943665-20943687 TTTCTATTTATTATTAAAAATGG + Intronic
1164276167 19:23720544-23720566 ATTGTATTTTTTAGTAAAGATGG + Intergenic
1164276904 19:23727243-23727265 TTTCTTTTTTTTAGTAAAAATGG - Intergenic
1164285780 19:23815720-23815742 TTTCTATTTATTATTAAAAATGG + Intronic
1164751194 19:30656030-30656052 GTTTTTTTTTTTATGAAACACGG - Intronic
1164826432 19:31287939-31287961 TTTCTGTTTTTTTTGAGACAGGG + Intronic
1164871122 19:31644358-31644380 ATTTTTTTTTTTAATAAACAAGG + Intergenic
1165109148 19:33491277-33491299 ATTGTGTTTTTTGTTAGAGACGG - Intronic
1165183763 19:33998365-33998387 CTTCTGTTTTCTATGAAGCAAGG - Intergenic
1165184551 19:34006411-34006433 TTTGTTTTTTTTAATAAACAAGG - Intergenic
1165412612 19:35671214-35671236 TTTTTGTTTTTTAGTAAAGACGG - Intronic
1165441794 19:35832581-35832603 ATTTTGTTTTTTAATTAAGACGG + Intronic
1165484488 19:36087199-36087221 ATTCTTTTTTTTTTGAGACAGGG - Intronic
1165654005 19:37517155-37517177 AATCTGTTTTTAAATAAAAAAGG + Intronic
1165713370 19:38027687-38027709 TTTTTTTTTTTTTTTAAACAGGG + Intronic
1166082113 19:40450553-40450575 TTTCTTTTTTTTTTTAGACAGGG + Intronic
1166726880 19:45033849-45033871 ATTTTTTTTTTTTTTAAAGATGG - Intronic
1166839627 19:45688903-45688925 TTTTTGTATTTTAGTAAACAGGG + Intronic
1167871502 19:52374463-52374485 ATTTTTTTTTTTTTTAAACAGGG + Intronic
1167993083 19:53377344-53377366 ATTTTGTATTTTAATAGACATGG + Intronic
1168218916 19:54946497-54946519 CTTTTTTTTTTTTTTAAACAGGG + Intronic
1168318845 19:55496755-55496777 TTTTTTTTTTTTTTTAAACAGGG + Intronic
1168646868 19:58064881-58064903 ACTTTGTTTTTTTTGAAACATGG - Intronic
1202673205 1_KI270710v1_random:14237-14259 ATTTTCTTATTTATTAAACCTGG - Intergenic
925417651 2:3682443-3682465 ATTCTGTTTTTTATTAAACATGG + Intronic
925529398 2:4842740-4842762 CTTCTGTTATGTATTGAACAAGG - Intergenic
925876260 2:8313434-8313456 TTTTTGTTTTTTTTTTAACAGGG + Intergenic
926334016 2:11849780-11849802 AATCTGTGTTTTACTAAACCGGG + Intergenic
926343416 2:11923604-11923626 TTTCTGTTTTTTAGTAGAGACGG - Intergenic
926362607 2:12104422-12104444 TTTTTTTTTTTTTTTAAACATGG + Intergenic
926898993 2:17728753-17728775 ATTTTTTTTTTTTTGAAACAGGG + Intronic
926990547 2:18675704-18675726 AATTTGTTTTTTATTCAACTGGG + Intergenic
927463462 2:23319996-23320018 ATTCTATTTTTTTTTAAAGGGGG + Intergenic
927764246 2:25790414-25790436 TTTATGTTTTTTTTTAACCAAGG - Intronic
927792869 2:26024094-26024116 CTTCTGTTTATTAATAAACTGGG - Intergenic
927823364 2:26288700-26288722 TTTCTGTTTTTTTTGAAACAGGG - Intronic
927947109 2:27141919-27141941 ATTTTTTTTTTTATTAGAGATGG - Intergenic
928122969 2:28597089-28597111 TTTCTGTTTTTTAGTAGAGATGG - Intronic
928161687 2:28932471-28932493 ATTCTTTTCTTTTTTAAAAAAGG - Intronic
928349792 2:30539259-30539281 TTTTTTTTTTTTTTTAAACAGGG + Intronic
928504994 2:31941911-31941933 ATTCTGATATTGATTAAAAACGG + Intronic
928512554 2:32014789-32014811 CTTCTTTTTTTTTTTAAAGATGG - Intronic
928741608 2:34360940-34360962 ATTTTGTTTTTTATTGACCTTGG - Intergenic
928875159 2:36029633-36029655 TTTGAGTTTTTTATAAAACATGG - Intergenic
929153123 2:38766181-38766203 ATTCTGCTTCTTACTAAAAAAGG - Intronic
929366759 2:41167656-41167678 ATTGTTTTTTTTTTTAAACCAGG + Intergenic
929490987 2:42395945-42395967 ATTCTTTTTTTTTTGAAACAAGG - Intronic
929700790 2:44161088-44161110 CTTTTTTTTTTTTTTAAACAGGG - Intergenic
929747442 2:44673420-44673442 TTTTTTTTTTTTTTTAAACAGGG - Intronic
929899675 2:45989641-45989663 CTTTTTTTTTTTTTTAAACAAGG - Intronic
930091005 2:47531464-47531486 CTTTTTTTTTTTTTTAAACAGGG - Intronic
930142670 2:47968677-47968699 ATTTTGTATTTTAGTAAAGATGG + Intergenic
930150010 2:48049688-48049710 ATTTTTTTTTTTTTTAAACTAGG + Intergenic
930219072 2:48727251-48727273 AATCTTTTTTTTTTTATACAGGG - Intronic
930318023 2:49821097-49821119 ATTCTGTTTTTCATTGGTCAAGG + Intergenic
930677636 2:54221525-54221547 TTTTTTTTTTTTTTTAAACACGG + Intronic
930796783 2:55401257-55401279 ATTTTGTTTTTTTGTAGACAAGG - Intronic
930902427 2:56523519-56523541 TCTCTGTATTTTATTTAACATGG + Intergenic
930935464 2:56945071-56945093 ATTTTGGTTTTTATTAAGCTGGG - Intergenic
931122154 2:59231796-59231818 ATTCTGTTCTTTCTTGACCATGG - Intergenic
931365427 2:61614977-61614999 ATCTTTTTTTTTTTTAAACAGGG + Intergenic
931563000 2:63583804-63583826 ATCCTATTTTATATGAAACATGG - Intronic
931623729 2:64236426-64236448 ATGCTTTTTTTTTTTAGACAGGG - Intergenic
931767759 2:65471829-65471851 AGTCTTTTTTTTTTTAGACAGGG - Intergenic
932118205 2:69073001-69073023 AGTCTGTATTGTGTTAAACAGGG + Exonic
932688287 2:73891947-73891969 GTTTTGTTTTTAATTAGACAGGG - Intergenic
932719284 2:74126079-74126101 TTTGTATTTTTTCTTAAACATGG + Intergenic
932808713 2:74805992-74806014 TTTTTTTTTTTCATTAAACAGGG + Intergenic
933037315 2:77416699-77416721 AAGCCTTTTTTTATTAAACATGG - Intronic
933111911 2:78412748-78412770 TTTCTGTTTTGTAATAAATAAGG + Intergenic
933434656 2:82232937-82232959 TTTCTATTATTTATTAAAAATGG - Intergenic
933448921 2:82420953-82420975 ATTTTTTTTTTTCTTAAAGATGG + Intergenic
933472194 2:82740139-82740161 ATATTGTTATATATTAAACAAGG - Intergenic
933621931 2:84553467-84553489 TTTCTTTTTTTTTTGAAACAGGG + Intronic
933825135 2:86152751-86152773 ATTCTTTTTTTTTTGAGACAAGG - Intronic
934621260 2:95809266-95809288 AATCTTTTTTTTTTTAAAGATGG - Intergenic
934893955 2:98096271-98096293 ATTTTTTTTTTTTTTAAAGATGG + Intronic
935056470 2:99571984-99572006 CTTCTATTTTTTTTTTAACATGG + Intronic
935376639 2:102406682-102406704 ATTTTGTTATTTGTTAATCATGG - Intergenic
935452692 2:103228413-103228435 ATTCATCTTTTTATTCAACAAGG + Intergenic
935535560 2:104289366-104289388 AATCTGTGTTTTCTTAAAAATGG - Intergenic
935985397 2:108667531-108667553 ATTTTTTTTTTTTTTAAAAAAGG - Intronic
936028210 2:109050258-109050280 TTACTTTTTTTTTTTAAACAGGG + Intergenic
936816155 2:116463693-116463715 TTTTTTTTTTTTTTTAAACAGGG + Intergenic
936858770 2:116991410-116991432 ATACTGATTTTTATTAGGCACGG + Intergenic
936883937 2:117286500-117286522 ATTCTTTTTTTTAGTAGAGACGG - Intergenic
937155900 2:119718669-119718691 AATTTGTTTTTCATAAAACAGGG - Intergenic
937940256 2:127279751-127279773 ATTTTTTTTTTTTTAAAACAGGG - Intronic
938057841 2:128230479-128230501 ATTTTGTTTTTTTTTTAAGACGG + Intergenic
938851196 2:135261987-135262009 TTTTTGTATTTTATTAAAGACGG - Intronic
938885304 2:135640820-135640842 ATTCCATTTTCTATTATACAGGG - Intronic
938902752 2:135811909-135811931 ATTTTTTTTTTTTTTAGACATGG - Intronic
938920335 2:135988840-135988862 TTTTTGTTTTTTAGTAGACATGG + Intergenic
939373446 2:141332617-141332639 ATTCTTTTTTTTCTTGAAAATGG + Intronic
939402493 2:141712371-141712393 TTTTTGTTTTTTTTTAGACAGGG - Intronic
939409302 2:141803411-141803433 AGTCTTTTTATTATTAAAGAAGG + Intronic
939475768 2:142684974-142684996 TTTCTTTTTTTTTTGAAACAGGG + Intergenic
939488173 2:142843210-142843232 ACCCTGTTATTTATTTAACAGGG - Intergenic
939490154 2:142867346-142867368 ATTCTCTTTGTTATTAAAGCAGG - Intergenic
939907119 2:147930796-147930818 ATTCATTTTTTTATTTAACTTGG - Exonic
940325305 2:152419154-152419176 TTTTTGTTTTTTATTATATATGG + Intronic
940338407 2:152553314-152553336 ATTTTGTCATTTATTAAGCACGG + Intronic
940463021 2:153991670-153991692 ACACTGTATTTTGTTAAACAGGG + Intronic
940551021 2:155156959-155156981 ATTCTTTCTCTTATTAAAAATGG - Intergenic
940589420 2:155702213-155702235 ATTATAATTTTTATAAAACAAGG - Intergenic
940668334 2:156636261-156636283 ATTTTTTTTTTTTTTAAAGACGG - Intergenic
940860741 2:158768398-158768420 ATTTTTTTTTTTTTTAGACAGGG + Intergenic
940940920 2:159559234-159559256 CTTCTTTTTTTTTTTTAACAGGG - Intronic
941091512 2:161182116-161182138 ATTTTTTTTTTTAATAAAAATGG - Intronic
941132885 2:161675977-161675999 ATTCTGTTTTTTAGTCAGCGGGG + Intronic
941263291 2:163324466-163324488 ATTTTTTCTTTTATGAAACATGG - Intergenic
941298405 2:163770014-163770036 TTTCGGTTTCTTATAAAACAAGG + Intergenic
941431553 2:165420166-165420188 AATCACTTTTTTTTTAAACATGG + Intergenic
941475637 2:165948722-165948744 TTTCTGTTTTTTTTTAGAGATGG + Intronic
941574510 2:167214046-167214068 ATTTTGTATTTTAGTAGACATGG - Intronic
941589625 2:167403495-167403517 AGTCTTTTTTTTTTTAAACATGG - Intergenic
941594900 2:167464159-167464181 ATTTTTTTTTTTTTTAAAAAAGG + Intergenic
941926890 2:170904671-170904693 ATTCTTTTTTTTTTTTGACAGGG - Intergenic
942007485 2:171719671-171719693 ATTCTTTTTTTAAATAAAAATGG + Intronic
942259570 2:174144923-174144945 TTTTTTTTTTTTTTTAAACAGGG - Intronic
942573138 2:177333827-177333849 TTTCTTTTTTTTTTTAAATAAGG - Intronic
942603989 2:177671345-177671367 ATTGAATTTTTTATTAAAGAAGG + Intronic
942677949 2:178448583-178448605 ATTCTTTTTTTTTTGAGACAGGG - Intronic
943033384 2:182712420-182712442 TTTATGTTTTTTAACAAACAAGG - Intergenic
943039243 2:182784315-182784337 GTTTTGTTTTTTTTTAGACAGGG - Exonic
943389586 2:187247653-187247675 AATACATTTTTTATTAAACAAGG + Intergenic
943695012 2:190917916-190917938 ATTTTGTTTTTTAATAGAGATGG - Intronic
943879279 2:193118298-193118320 TTTCTCTTTTTTTTTAAATATGG + Intergenic
944115488 2:196181429-196181451 TTTTTTTTTTTTTTTAAACAGGG - Intergenic
944617801 2:201480735-201480757 AATTTGCTTTTTTTTAAACAAGG + Exonic
944632965 2:201645657-201645679 ATTTTTTTTTTTTTTAGACAGGG + Intronic
944718583 2:202400105-202400127 ATTCTTTTTTTTTTAAGACAGGG - Intronic
944987996 2:205201123-205201145 CAACTGTTTTTTACTAAACATGG - Intronic
945165887 2:206944433-206944455 ATTTGATTTTTTAATAAACAAGG - Intronic
945239771 2:207665802-207665824 ATTCTTTTTTTTTTGAAACAGGG + Intergenic
945492258 2:210470418-210470440 ATTCTATTTTTTTTTAAACAAGG - Intronic
945494784 2:210496970-210496992 GGTCTGTTTTTTATCAAATAGGG + Intronic
945502946 2:210600484-210600506 ATTCAGTTGTCTATTAAAAAAGG + Intronic
946319783 2:218945806-218945828 ATTTTGTATTTTAGTAAAGACGG + Intergenic
946400106 2:219464114-219464136 TTTTTTTTTTTTTTTAAACAGGG - Intronic
947083914 2:226429438-226429460 CATCTTTGTTTTATTAAACATGG + Intergenic
947192830 2:227526712-227526734 TTTGTGTTTTTTAGTAAAGATGG + Intronic
947381707 2:229551626-229551648 TTTATGTTTTTTTTTAAACGGGG - Intronic
948215760 2:236229195-236229217 TTTCTGTATTTTACTTAACATGG - Intronic
948972457 2:241439789-241439811 TTTTTGTATTTTATTAAACCTGG - Intronic
1168844293 20:932952-932974 TTTCTCTTTTTTTTTAGACAGGG - Intergenic
1168873198 20:1148427-1148449 AAACTGTTTTTTACAAAACATGG - Intronic
1169053810 20:2603217-2603239 ATTTTTTTTTTTTTTAAACTGGG - Intronic
1169238529 20:3953632-3953654 TTTCTGTATTTTAGTAAAGATGG + Intronic
1169358701 20:4929257-4929279 TTTCTTTTTTTTTTTACACAGGG - Intronic
1169377255 20:5076100-5076122 ATTTTTTTTTTTTTTAGACAGGG - Intronic
1169974325 20:11306446-11306468 ATTCTTTTTTTTTTTTAAGATGG + Intergenic
1170022337 20:11850315-11850337 ATTCTGTTTTATAGTCACCAAGG - Intergenic
1170148823 20:13206401-13206423 ATTACGCTTTTTATTACACAGGG + Intergenic
1170848648 20:19983597-19983619 ATTCTGATTTTTTTTTAAAAAGG - Intronic
1170862285 20:20118344-20118366 CTTTTTTTTTTTTTTAAACAGGG + Intronic
1170884969 20:20332621-20332643 ATTCTTTTTTAAATTAAAAAAGG + Intronic
1171043285 20:21786955-21786977 ATTATGTTTTTCATTCTACAGGG + Intergenic
1171126375 20:22605445-22605467 ATCCTGTTTCTTTTTTAACAGGG + Intergenic
1171260631 20:23728992-23729014 AGTCTGTTTTATTTTAAAAAAGG + Intergenic
1171465754 20:25326690-25326712 GATTTGTTTTTTAATAAACATGG + Intronic
1171537482 20:25908442-25908464 AATCTATTTTAAATTAAACAAGG - Intergenic
1171720487 20:28557618-28557640 TTTCTGTTCTTTATAAAGCAGGG - Intergenic
1171803583 20:29652207-29652229 AATCTATTTTAAATTAAACAAGG + Intergenic
1171840432 20:30203776-30203798 AATCTATTTTAAATTAAACAAGG - Intergenic
1172049022 20:32102114-32102136 TTTTTTTTTTTTTTTAAACAGGG - Intergenic
1172687597 20:36768153-36768175 ATTCTGTCTTTAACTAAAGAAGG - Intronic
1172854600 20:37992280-37992302 CTTCTTTTTTTTTTGAAACAGGG + Intronic
1172992851 20:39048996-39049018 ATTTTTTTTTTTTTTAGACAAGG - Intergenic
1173137165 20:40448443-40448465 TTTCTGTTTTTTAGTAGATACGG - Intergenic
1173269758 20:41522337-41522359 ATTTTGTTTTTTTTGAGACAGGG - Intronic
1173513122 20:43645856-43645878 TTTTTTTTTTTTTTTAAACAGGG - Intronic
1174190496 20:48737163-48737185 ATTACCTTTTTTATTGAACAGGG + Intronic
1174215273 20:48911688-48911710 TTTTTATTTTTTATTTAACAAGG - Intergenic
1174414252 20:50356716-50356738 ATGTTGTTTGTAATTAAACAAGG - Intergenic
1174521827 20:51137355-51137377 TTTTTTTTTTTTATAAAACACGG - Intergenic
1174800125 20:53556617-53556639 TTTTTTTTTTTTTTTAAACAGGG + Intergenic
1174879765 20:54266224-54266246 AATTTTTTTTTTTTTAAACAGGG - Intergenic
1175098158 20:56558504-56558526 ATTCTTTTTTTTTTTTAAGATGG + Intergenic
1175595371 20:60227131-60227153 ATTTTCTTTTTTTTGAAACAGGG + Intergenic
1175666659 20:60867170-60867192 ATTCTTTTTTTTTTGAGACAGGG + Intergenic
1176208266 20:63902979-63903001 ATCCTGTTTTTTTTACAACAGGG + Intronic
1176811472 21:13542409-13542431 ATTATGTTTTTCACTAAAGAGGG - Intergenic
1176920471 21:14681762-14681784 TTACTGTTTTTTGTTAAAGAGGG - Intergenic
1176957155 21:15118719-15118741 ATTCATTTTTTTTTTAGACAGGG - Intergenic
1177152423 21:17468532-17468554 GTTTTGTTTTGTATTAGACAGGG + Intergenic
1177201818 21:17965913-17965935 TTTTTTTTTTTTTTTAAACAGGG + Intronic
1177277017 21:18925243-18925265 ATTCTTTTCTTCATTATACATGG + Intergenic
1177506308 21:22022862-22022884 TTTTTGTTTTTTATTTAACAAGG - Intergenic
1178051103 21:28748416-28748438 ATACTGCTTTTAAATAAACATGG + Intergenic
1178164154 21:29952978-29953000 ATTCTGTTTTTGAGAAAACGTGG + Intergenic
1178607007 21:34047191-34047213 ATTTTTTTTTTTTTTAAAGACGG + Intergenic
1178834976 21:36089240-36089262 TTTCTTTTTTTTTTGAAACAGGG + Intergenic
1179092161 21:38276453-38276475 ATTCTATGTTTTATTTAAAATGG + Intronic
1179220125 21:39399279-39399301 TTACTGTTTTTTTTTAAAAATGG + Intronic
1179771165 21:43618252-43618274 ATTCTTTTTTTTTTTAAATGGGG - Intronic
1180640257 22:17292480-17292502 TTTTTTTTTTTTAATAAACAAGG + Intergenic
1180680865 22:17626132-17626154 TTTCTATTTTTTATTAGAGATGG - Intronic
1181186144 22:21105692-21105714 ATTGTGTATGTTATTATACATGG - Intergenic
1181384130 22:22531286-22531308 TTTCTGTTTTTTAGTAGAGATGG - Intergenic
1181713842 22:24709557-24709579 CTTTTGTTTTTTTTTAAAAAAGG + Intergenic
1181804908 22:25368867-25368889 ATTCACTTTTTTTGTAAACATGG - Intronic
1181819900 22:25467584-25467606 ATTCTTTTTTTCACTAAAGAAGG + Intergenic
1182138456 22:27930293-27930315 GTTCTTTTTTTTTTTAAAGAGGG - Intergenic
1182398131 22:30051803-30051825 TTTTTTTTTTTTTTTAAACAGGG + Intergenic
1182588772 22:31363027-31363049 TTTCTGTTTTTTAGTAGAGACGG - Intergenic
1183653200 22:39170868-39170890 TCTCTGTTTTTTATTCAACCGGG - Intergenic
1183856571 22:40638641-40638663 TTTCTGTTTTTTAGTAGAGACGG - Intergenic
1183892737 22:40943741-40943763 TTTCTTTTTTTTTTGAAACAGGG + Intergenic
1183900761 22:41004229-41004251 ATTTTGTTTTTTGTGAGACAGGG + Intergenic
1184170020 22:42753203-42753225 ATTTTTTTTTTTTTTAAAGACGG + Intergenic
1185090984 22:48773129-48773151 TTTTTTTTTTTTTTTAAACAGGG + Intronic
949123003 3:410563-410585 ATTCTGTGTTGTATTTTACAGGG - Intergenic
949144981 3:688753-688775 ATTCTTATTCTTATTATACATGG + Intergenic
949214898 3:1554569-1554591 ATTCATTTTTTTTTTAATCATGG + Intergenic
949534981 3:4988712-4988734 TTTTTTTTTTTTTTTAAACAGGG - Intergenic
949655095 3:6208687-6208709 ATTCAGTTTTATAGTAAAGATGG - Intergenic
949765267 3:7519353-7519375 ATTTTTTTTTTTTTTAGACAGGG - Intronic
950501584 3:13367264-13367286 ATTCTGTATTTTAATAGAGACGG - Intronic
951141292 3:19164589-19164611 TTTTTGCCTTTTATTAAACAGGG - Intronic
951885264 3:27518224-27518246 TTACTTTTTTTTTTTAAACAGGG + Intergenic
952031372 3:29146509-29146531 ATTCTGCTTTTCATAAAACTTGG - Intergenic
952227103 3:31389518-31389540 ATTTTGTTTTTTTTTAAACTTGG + Intergenic
952289001 3:31997262-31997284 ATTCTTTTTTTTTTTCAAGATGG + Intronic
952732247 3:36650870-36650892 ATTTTTTTTTTTTTGAAACAGGG - Intergenic
952876359 3:37947850-37947872 AACATGTTTGTTATTAAACAAGG - Intronic
953314903 3:41917807-41917829 TTTTTGTTTTTTATTAGAGACGG - Intronic
953332949 3:42069724-42069746 ATACTGATTTTGATTAAATAAGG - Intronic
953669385 3:44949840-44949862 TTTCTTTTTTTTTTGAAACAGGG + Intronic
953719485 3:45343048-45343070 ATTGTTTTTATTATTAAATAAGG + Intergenic
953943509 3:47124643-47124665 ATACTATTTGTTATTAAAAAGGG - Intronic
954066308 3:48109286-48109308 ATTTTATTTTTTTTGAAACAGGG - Intergenic
954249317 3:49355959-49355981 TTTCTGTTTTTTAGTAGACGGGG - Intergenic
954517857 3:51195940-51195962 TTTTTGTTTTTTTTGAAACAAGG + Intronic
954785343 3:53088505-53088527 ATTTTATTTCTTATTAAACCAGG + Exonic
954933481 3:54304910-54304932 GCTCTTTTTTTTTTTAAACATGG + Intronic
955179378 3:56652788-56652810 ATTGTGTTTTTAATTTCACAGGG - Intronic
955241777 3:57184799-57184821 ATTCTGTTGTTTATTTTGCATGG - Intergenic
955315830 3:57938244-57938266 ATTCTATATTTTATCTAACAGGG - Intergenic
955442836 3:58975612-58975634 ATTCTCCTTTTAAGTAAACAAGG - Intronic
955678970 3:61480404-61480426 TTTCTTTTTTTTTTTAGACAGGG - Intergenic
955811111 3:62790933-62790955 ATTCTGTGTTATTTTAAAAATGG + Intronic
955830722 3:63000355-63000377 ATTCTGGTTTTGATGTAACAGGG + Intergenic
956355289 3:68384954-68384976 AATCTGTTTTGTCTAAAACAAGG + Intronic
956488903 3:69750898-69750920 ATTCATTTTCTGATTAAACACGG - Intronic
956492878 3:69793017-69793039 TTTTTTTTTTTTTTTAAACAGGG + Intronic
956507534 3:69958566-69958588 ATTTTTTTTTTTTTTAATCAAGG - Intronic
956602753 3:71040293-71040315 ATTGTGTTTTTTAATAAAAATGG - Intronic
956759615 3:72428449-72428471 ATTCTAATTTTTTTTAAACTAGG + Intronic
956819374 3:72939684-72939706 CTTTTTTTTTTTTTTAAACATGG + Intronic
957329323 3:78740475-78740497 TTTCTTTTTTTTTTGAAACAGGG + Intronic
957415721 3:79900918-79900940 ATTCTGTTTTTTATTAATAATGG - Intergenic
957516761 3:81264450-81264472 ATTCTGATGTTTATTAAGTATGG + Intergenic
957717212 3:83943146-83943168 TTTTTTTTTTTTTTTAAACAAGG - Intergenic
957740468 3:84261055-84261077 TTTTTTTTTTTTATTAAAGATGG + Intergenic
957817072 3:85314352-85314374 TTTCTGTTTTTTTTTAACAAAGG + Intronic
957987095 3:87586677-87586699 TTTCTTTTTTTTTTGAAACAAGG + Intergenic
958108396 3:89106991-89107013 ACTTTGTTTTTTTTCAAACAGGG - Intergenic
958513051 3:95073640-95073662 ATTTTTTTTTTTTTTAGACAGGG - Intergenic
958704750 3:97641378-97641400 CCTCTGTATTTTATTATACAGGG - Intronic
958791413 3:98655337-98655359 CTTCTTTTTTTTTTTAGACAGGG - Intergenic
958938898 3:100288235-100288257 ATTTTTTTTTTTTTTAGACAGGG - Intronic
959013482 3:101106799-101106821 ATTCTGATTCTTAGTAAAAATGG - Intergenic
959255442 3:104005509-104005531 ACTTTGTTTTTTATTAAATCAGG - Intergenic
959367081 3:105474917-105474939 ATTCATTTTTTTTTTACACAGGG - Intronic
959427337 3:106207293-106207315 ATTTTGTTTGTTTTTAAAAAGGG - Intergenic
960169423 3:114441322-114441344 ATGCTGTTTTTTAAAAATCAGGG + Intronic
960171346 3:114465138-114465160 ATTTTATTTTTTATAAAACCTGG + Intronic
960622828 3:119653108-119653130 TTTCTGTTCTTTATTAAAATGGG - Intronic
960632760 3:119749514-119749536 TTTCTTTTTTTTTTTAGACAGGG - Intronic
960743444 3:120859854-120859876 ATTGTGTTTTTTTTTCTACACGG - Intergenic
961309244 3:125983855-125983877 GTTTTGTTTTTTGCTAAACATGG + Intergenic
961532672 3:127548748-127548770 TTTTTTTTTTTTTTTAAACAGGG - Intergenic
961691405 3:128672530-128672552 ATTTTTTTTTTTTTTAGACAGGG - Intronic
961748793 3:129083240-129083262 ATTTTTTTTTTTTTGAAACAGGG - Intergenic
961753513 3:129112255-129112277 TTTTTTTTTTTTTTTAAACAGGG - Intronic
962002221 3:131309980-131310002 TTTTTTTTTTTTTTTAAACATGG - Intronic
962130815 3:132673667-132673689 TTTTTTTTTTTTTTTAAACAGGG + Intronic
962150623 3:132889415-132889437 TTTGTGTTTTTTAGTAAAGATGG - Intergenic
962577142 3:136765014-136765036 ATTATTTTTTTTCTTAAAGATGG + Intergenic
962690269 3:137889493-137889515 ATACTGTTTTTTCTTAAATCAGG + Intergenic
962797184 3:138859444-138859466 GTTTTTTTTTTTTTTAAACAGGG - Intergenic
962884375 3:139610354-139610376 ATGCTGTTTGTTATTAAATCAGG + Intronic
962916097 3:139905237-139905259 TTTGTGTTTTTTTTTTAACATGG - Intergenic
963224953 3:142853094-142853116 TTTTTTTTTTTTTTTAAACAGGG - Intronic
963229508 3:142895118-142895140 ATTTTGTATTTTAGTAGACACGG - Intergenic
963256926 3:143154309-143154331 TTTCTCTTTTTTTTTAAACCGGG - Intergenic
963381189 3:144532417-144532439 ATTCTGTTTTCTATTATTCTAGG - Intergenic
963499777 3:146111711-146111733 AGTTTTTTTTTTAATAAACAGGG - Intronic
963866320 3:150365632-150365654 ATTCTGTCTTTTAAAAAAAATGG - Intergenic
963886922 3:150593390-150593412 ATACTTTTTTTTTTGAAACAGGG + Intronic
964121312 3:153186359-153186381 TTTGTGTTTTTTAATAAAGATGG + Intergenic
964217558 3:154303559-154303581 CTGCTGTTTTTTATTAAAGTAGG - Intronic
964736058 3:159919091-159919113 ATTTTGTTTATTAATACACAAGG - Intergenic
965484063 3:169257124-169257146 ATTCTTTTTTCTTTTAAACATGG - Intronic
965662865 3:171060522-171060544 ACTATTATTTTTATTAAACAGGG - Intergenic
965731597 3:171777787-171777809 ATTTTGTTTTTTTTTAAAGCAGG - Intronic
965915936 3:173845952-173845974 ATTCTTTTTGTTTTTAAAGATGG + Intronic
966117835 3:176486203-176486225 ATCCTGTTTTTTTTTTAAGAAGG - Intergenic
966308079 3:178560036-178560058 CATATCTTTTTTATTAAACAGGG + Intronic
966330385 3:178805629-178805651 TTTCTTTTTTTTTTTAAACAGGG + Intronic
966423593 3:179758024-179758046 ACTCTACTTTTTATAAAACAAGG + Intronic
966529663 3:180961447-180961469 CTTTTTTTTTTTTTTAAACAGGG + Exonic
966703207 3:182879249-182879271 TTTCTCTTTTTTGTGAAACAGGG - Intronic
966838209 3:184066126-184066148 TTTCTGTATTTTAGTAAAGACGG - Intergenic
967004121 3:185367601-185367623 ATTTTTTTTTTTTTTAAACAAGG + Intronic
967155792 3:186691083-186691105 TTTCTTTTTTTTTTTAAACTTGG - Intergenic
967368531 3:188715995-188716017 CTTCTGCTTTTTTTTAAAGAAGG - Intronic
967418759 3:189250740-189250762 TTTTTTTTTTTTTTTAAACAAGG - Intronic
967433437 3:189416390-189416412 ATTTTTTTTTTTTTTAAATAAGG + Intergenic
967560328 3:190910423-190910445 ATAATATTTTTTATTAAAGAAGG - Intergenic
968011265 3:195279312-195279334 ATTCTGAATTTTTTTAAAAATGG - Exonic
968130007 3:196187571-196187593 ATTTTATTTTTTTTGAAACAGGG + Intergenic
968169968 3:196502414-196502436 TTTCTGTTTTTTAGTAGAGACGG - Intronic
968327356 3:197830252-197830274 AATCTCTTTTTTTTGAAACAAGG + Intronic
968379377 4:77132-77154 ATTCTTTTTTTTTTTAAATTAGG + Intronic
968407495 4:353366-353388 ATTTTTTTTTTTTTTAGACAGGG - Intronic
969545344 4:7822897-7822919 TTTCTTTTTTTTTTTCAACAGGG + Intronic
969699238 4:8757428-8757450 CTTTTTTTTTTTTTTAAACAGGG + Intergenic
969960104 4:10936050-10936072 ATTCAGTTAGTGATTAAACACGG - Intergenic
970019596 4:11552665-11552687 TTTTTTTTTTTTTTTAAACAGGG - Intergenic
970252838 4:14134553-14134575 ATTCTATTTGTCTTTAAACATGG - Intergenic
970316720 4:14835012-14835034 ATTTTATTTTTTAATAAAAAGGG - Intergenic
970652428 4:18193447-18193469 TTTCTGTTTTTTCTCAATCATGG - Intergenic
970695267 4:18669462-18669484 ATTTTGTATTTTATGAAAAATGG + Intergenic
970795147 4:19903541-19903563 GTTCAGTTTTTTGTTAAAAAGGG - Intergenic
970843923 4:20512975-20512997 ATTATGTTTGTTGATAAACAGGG + Intronic
971145530 4:23971961-23971983 ATTATGTATTTGATTAAAAATGG - Intergenic
971529427 4:27666422-27666444 AATTTGTTTTTAATTAAAGAAGG + Intergenic
971701866 4:29987260-29987282 ACTCTGCTTTTTAAAAAACATGG + Intergenic
971910915 4:32796729-32796751 AATCTGTTCTTTATTACAAATGG - Intergenic
971970332 4:33611353-33611375 ATTTTGTTTATAAGTAAACATGG + Intergenic
972083720 4:35185995-35186017 ATTCTGTTTTTTCTAAAATTAGG - Intergenic
972083896 4:35188696-35188718 ATTCTTTGTTTTATCAGACACGG + Intergenic
972410939 4:38793878-38793900 ATTCTTTTTTTTTTTTAATAAGG - Intronic
972497487 4:39647401-39647423 TTTTTTTTTTTTTTTAAACAGGG - Intergenic
972776042 4:42241556-42241578 ATTTTTTTTTTTATTAGAGACGG + Intergenic
972811057 4:42586315-42586337 ATTCTGTGTTTTTATAAAGACGG + Intronic
972976380 4:44641340-44641362 ACTCTTTTTTTTATTCAAGATGG - Intronic
973559011 4:52115611-52115633 TTTTTGTTTTTTTTGAAACAGGG + Intergenic
973888889 4:55349534-55349556 ATTTTTTTTTTTTTTAAATAAGG + Intronic
974212884 4:58804664-58804686 ATTCTGTTTTCTAAGAAAAAAGG - Intergenic
974322654 4:60370594-60370616 TTTGTGTTTTTTATTAATCATGG + Intergenic
974426892 4:61753284-61753306 ATTCTGTTTTTGATTCCAGAAGG + Intronic
974515663 4:62905304-62905326 ATTCTGTTTCCTAATAAAAAAGG + Intergenic
974813591 4:66977349-66977371 ATTCTGATTTTTTTTTGACATGG + Intergenic
974825409 4:67122062-67122084 ATTCTCATTTTTATTATATAAGG - Intergenic
974874187 4:67683080-67683102 ATTATATTTTGTATGAAACAGGG - Intronic
975059181 4:69976455-69976477 AGTCTGTTTTGTCTTAAATAAGG + Intergenic
975151344 4:71024635-71024657 ATTTTGTTCTTCATTAAGCAAGG + Intronic
975261513 4:72306258-72306280 ACTTTTTTTTTTATTAAAGAGGG + Intronic
975293987 4:72711088-72711110 CTTTTTTTTTTTAATAAACAAGG + Intergenic
975303759 4:72823729-72823751 TTTCTGTATTTTAGTAAAGATGG + Intergenic
975680856 4:76874424-76874446 ATTCTCTTTAATATTAAATAGGG - Intergenic
975713022 4:77179218-77179240 ATTCTGTTCTTTATGAAATGAGG + Intronic
975991126 4:80261438-80261460 TTTTTTTTTTTTATGAAACAGGG - Intergenic
976212666 4:82687250-82687272 CTTATATTTTTTATTAAAAATGG - Intronic
976218418 4:82736278-82736300 GTTTTGTTTTTTCTTAGACAGGG - Intronic
976295024 4:83462063-83462085 ATTTTATTTTTTAATAGACATGG + Exonic
976309674 4:83598622-83598644 ATTTTTTTTTTTTTTAAACCAGG + Exonic
976313772 4:83637798-83637820 TTTCTTTTTTTTTTGAAACAGGG + Intergenic
976408842 4:84689555-84689577 ATTCAGTTTTATACTGAACAGGG + Intronic
976411291 4:84716263-84716285 TTTCTGTTTTTTAGTAGAGACGG - Intronic
976573716 4:86643138-86643160 ATTCTTTTATTTATTAGACAGGG - Intronic
976832795 4:89333711-89333733 TATTTTTTTTTTATTAAACAGGG + Intergenic
977255947 4:94740240-94740262 TTTCTGTTTTTTAGTAGAGATGG + Intergenic
977420367 4:96792023-96792045 ATTATATTTGTTTTTAAACAGGG + Intergenic
977519773 4:98066582-98066604 ATTTTATTTTTTTTTAAAGATGG - Intronic
977587307 4:98787911-98787933 ATTCTATTTTTTCTTGAACTGGG - Intergenic
977705470 4:100065745-100065767 ATTTTGTTTATTATTACATATGG - Intergenic
977952514 4:102989434-102989456 ATTATGTTTCTTATTAAAATTGG - Intronic
978051523 4:104206410-104206432 ATTCTGATTTCTAATAAAAATGG - Intergenic
978086239 4:104658800-104658822 ATTCTCTTTCTTATTGAAAATGG - Intergenic
978154764 4:105475769-105475791 CTTTTTTTTTTTTTTAAACAGGG - Intergenic
978994024 4:115126965-115126987 ATACTTTTTTAAATTAAACATGG - Intergenic
979305097 4:119133519-119133541 TTTTTTTTTTTTTTTAAACAAGG + Intergenic
979836091 4:125369547-125369569 ATTCTGTTGTTTAATGAAAATGG + Intronic
979934997 4:126682188-126682210 CTGCTGTTTTTTTTTAAAGAAGG - Intergenic
980143143 4:128946563-128946585 ATTCTATTTTTTAAGAGACAAGG - Intronic
980219015 4:129891097-129891119 TTTCTATTTTTTATTTTACAAGG - Intergenic
980232490 4:130062401-130062423 ATTTTGTTTTGTATGAAGCAAGG - Intergenic
980463095 4:133143701-133143723 ATTCTGTATTTTAAAAATCAAGG + Intergenic
980476237 4:133321354-133321376 ATAATGTTTTTTGTTAAAGATGG + Intergenic
980480653 4:133382963-133382985 ATTCTTTTTTTATTTAAATATGG + Intergenic
980687398 4:136246618-136246640 ATTTTGTTTTTTGTTAAAGCTGG - Intergenic
981051504 4:140314105-140314127 TTTTTTTTTTTTTTTAAACAGGG - Intronic
981232568 4:142374775-142374797 ATTCCGTTTTTTATTCAATGAGG + Intronic
981684860 4:147442163-147442185 ATTCTTATTTTTTTCAAACAGGG - Intergenic
981685896 4:147454533-147454555 ATTCTGTGTTTTAATTAGCATGG - Intergenic
981804480 4:148698264-148698286 ATTCTGTTTTTTATTTCAATGGG + Intergenic
981903624 4:149894282-149894304 TTTCTTTTTTTTATGAGACAGGG - Intergenic
982247165 4:153364508-153364530 TTTTTTTTTTTTCTTAAACAGGG - Intronic
982374080 4:154668719-154668741 TTTCTGGTGTTTAATAAACAAGG + Intronic
982374133 4:154669918-154669940 TTTCTGGTGTTTAATAAACAAGG - Intronic
982909509 4:161121564-161121586 ATTTTTTTTTTTTTTAGACAGGG + Intergenic
982923591 4:161306162-161306184 TTTCTTTTTTTTTTTAAAAATGG - Intergenic
982963486 4:161871996-161872018 ATTTTTTTTTTTTTTAGACAGGG + Intronic
983009073 4:162522447-162522469 ATTCTTTTTTTTAAAAAAAAAGG - Intergenic
983037720 4:162887877-162887899 ATTATTTTTTGTATTAAAAATGG + Intergenic
983176382 4:164593496-164593518 ATTATTTTTTTTATTAGAGATGG + Intergenic
983182591 4:164666551-164666573 ATTATTTTTTTTATGAAACAGGG - Intergenic
983258536 4:165429693-165429715 ACTTTTTTTTTTTTTAAACAGGG - Intronic
983260185 4:165447816-165447838 ATTCTTTTTTTAAAAAAACAAGG + Intronic
983406827 4:167341951-167341973 ATTATGATTATTATTAAAGATGG + Intergenic
983424728 4:167568761-167568783 ATTTTTTTTTTTTTTAAATAAGG - Intergenic
983679228 4:170332961-170332983 TTTTTTTTTTTTTTTAAACATGG - Intergenic
983763265 4:171441182-171441204 ATTCTGTTTTTTTAGAAATATGG + Intergenic
983929675 4:173439506-173439528 ATCTTTTTTTTTTTTAAACAGGG - Intergenic
983947382 4:173601390-173601412 ATTTTATTTTATATTAAAAATGG - Intergenic
983982980 4:174022321-174022343 ATTTTGTATTTTATTAAGAAAGG + Intergenic
984006154 4:174312474-174312496 ATACTGTTTTTAGTAAAACAAGG + Intronic
984111129 4:175616129-175616151 ATACTTTTTTTTTTTAAAGAGGG - Intergenic
984149728 4:176111777-176111799 ATTATGTTTTTCATGTAACAAGG - Intronic
984250975 4:177334135-177334157 ATTTTTTTTTTTTTTAAACCAGG - Intronic
984686960 4:182679924-182679946 AATTTAGTTTTTATTAAACACGG - Intronic
984799646 4:183702335-183702357 TTTTTTTTTTTTTTTAAACAGGG - Intronic
984838947 4:184050637-184050659 CTTTTTTTTTTTTTTAAACAGGG + Intergenic
984908901 4:184653520-184653542 ATTTTGTTTTTTAGTAGAGATGG + Intronic
985147061 4:186904198-186904220 AGTCTCTTTCTTTTTAAACAAGG - Intergenic
985772121 5:1818305-1818327 ATTGTGTTTTTTCTAAAACTTGG + Intergenic
986135863 5:4977240-4977262 ACACTCTGTTTTATTAAACATGG - Intergenic
986519562 5:8599754-8599776 ATTCTCTTTCCAATTAAACATGG - Intergenic
986613180 5:9590205-9590227 ATTCTTTTTTTTTTGAGACAGGG + Intergenic
987030674 5:13974140-13974162 TTTCTTTTTTTTTTTAGACAGGG + Intergenic
987168417 5:15225532-15225554 ATTCTATTTTTTTTTTAACAGGG - Intergenic
987706743 5:21468740-21468762 ATTATTTTTTTTAATAGACACGG - Intergenic
987716324 5:21577155-21577177 ATTTTGTATTTTATTAGAGACGG + Intergenic
987745620 5:21968041-21968063 ATTATGTTTTTAAATAAACTTGG + Intronic
987792990 5:22592616-22592638 ATTGTCTTTTTCATTAAACCTGG - Intronic
987936854 5:24478277-24478299 TTTCTGTTTTTTCTTAAGGAGGG + Intergenic
988205798 5:28132088-28132110 ATTATGTTTTCTATTATAAAAGG + Intergenic
988230712 5:28475068-28475090 ATTCTGTTTGTTAATAATCCAGG - Intergenic
988358917 5:30210840-30210862 ATTTTTTTTTTTAGTAAAGATGG + Intergenic
988433098 5:31142729-31142751 AGAATGTTTTTTATTAATCATGG - Intergenic
988512338 5:31875577-31875599 ATTTTTTTTTTTTTTGAACAGGG - Intronic
988528845 5:32009722-32009744 ATTTTTTTTTTTAATAGACAAGG - Intronic
988710113 5:33764805-33764827 ATTTTTTTTTTTCTTAAACAAGG + Intronic
988983267 5:36592888-36592910 TTTTTTTTTTTTTTTAAACAGGG - Intergenic
989010245 5:36863340-36863362 ATTCTTTTTTTTTTTTAAGATGG + Intergenic
989233952 5:39122397-39122419 ATTCTGTCTTTTGTTAGACATGG - Exonic
989260230 5:39411288-39411310 ATTATGTTTTTTATGAACCAAGG - Intronic
989736907 5:44718506-44718528 ATTTTCTTTTTCATTAAAAAAGG - Intergenic
990174224 5:53089294-53089316 ATTCAGTTTTTAATTAATTAGGG - Intronic
990216189 5:53535059-53535081 TTTCTGTTTTTTATAAAGAACGG - Intergenic
990575401 5:57119057-57119079 AATTTGTTTTTTATTAAATTAGG + Intergenic
990698628 5:58451396-58451418 ATTTTATTTTTTAAGAAACAGGG + Intergenic
990725102 5:58744687-58744709 ATTATGTTTTTTAAAAAACATGG + Intronic
990894006 5:60677541-60677563 TTTCTTTTTTTTATGAGACAAGG + Intronic
990937417 5:61165069-61165091 TTTTTTTTTTTTTTTAAACACGG + Intergenic
991081087 5:62600214-62600236 ATTTTTTCTTTTAGTAAACAAGG + Intronic
991354348 5:65752229-65752251 ATTTTTTTTTTTTTGAAACAGGG - Intronic
991424730 5:66478883-66478905 TTTCTGTTTTTTAGTAGAGACGG + Intergenic
991513170 5:67402880-67402902 ATTCTTTTTTTAATTTAATAAGG - Intergenic
991720486 5:69491175-69491197 ATTTGGTTTATAATTAAACAAGG - Intergenic
991765818 5:69978168-69978190 ATTATGTTTTTAAATAAACTTGG + Intergenic
991781504 5:70139994-70140016 ATTATGTTTTTAAATAAACTTGG - Intergenic
991845054 5:70853240-70853262 ATTATGTTTTTAAATAAACTTGG + Intergenic
991873947 5:71140308-71140330 ATTATGTTTTTAAATAAACTTGG - Intergenic
991930015 5:71745124-71745146 ATTCTTTTTTTTTTGAGACAGGG + Intergenic
992119009 5:73571771-73571793 TTTCTTTTTTTAATTAAAGATGG - Intronic
992133356 5:73718045-73718067 ATTCTGATTTTTAGTAGAGATGG + Intronic
992213426 5:74503396-74503418 TTTTTTTTTTTTTTTAAACAGGG + Intergenic
992246591 5:74830675-74830697 TATCTATTTTTTTTTAAACAGGG + Intronic
992701553 5:79346136-79346158 TTTCTGGTTTTTTTTAGACAGGG - Intergenic
992922904 5:81545715-81545737 ATTGTTTTTTGTATTATACAAGG - Intronic
992938342 5:81735918-81735940 CTTCTGTGTTTTATTACACCTGG + Intronic
992967040 5:82013131-82013153 TTTGTGTTTTTTAGTAAAGACGG + Intronic
993326723 5:86548078-86548100 CTTCTTTTTTTTATAAAACAAGG - Intergenic
993508683 5:88744380-88744402 ATTCTGTATTTTAGTAGAGATGG - Intronic
993542367 5:89168228-89168250 TTTTTTTTTTTTTTTAAACAAGG + Intergenic
993722397 5:91334535-91334557 TTTCTGTTTTTTTTGAGACAGGG - Intergenic
993759571 5:91776235-91776257 ATACTGTGTTCAATTAAACAAGG - Intergenic
993769983 5:91915035-91915057 ATTTTGTTTTATAGTCAACAGGG + Intergenic
993887430 5:93432364-93432386 ATTCTGTATTTTAATGATCATGG - Intergenic
994135096 5:96277511-96277533 CTTATTTTTTCTATTAAACATGG + Intergenic
994345805 5:98684842-98684864 ATTTTGTGTATTATTAAAGATGG + Intergenic
994447276 5:99893551-99893573 ATCCTGTTTTGTATAATACAAGG - Intergenic
994489760 5:100425926-100425948 ATTTTGTCTTTTAGGAAACATGG + Intergenic
994881525 5:105504239-105504261 CTTCTGTTTTCTAGAAAACATGG - Intergenic
995091298 5:108180499-108180521 TTTCTTTTTTTTTTTAAAGACGG - Intronic
995198717 5:109402314-109402336 AATCTGTCTTTTATTTAAAATGG - Intronic
995319340 5:110814727-110814749 ATTTTTTTTTTTTTGAAACAGGG + Intergenic
995402203 5:111756289-111756311 TTTTTTTTTTTTTTTAAACACGG - Intronic
995563558 5:113409356-113409378 ATACTTTTTTTTTTTAGACAGGG + Intronic
995759385 5:115547327-115547349 ATTTTTTTTTTTTTTAGACAGGG + Intergenic
995760223 5:115554419-115554441 TTTTTTTTTTTTTTTAAACAGGG - Intergenic
995888087 5:116918475-116918497 AAACTTTTTTTTTTTAAACAGGG - Intergenic
995919861 5:117298743-117298765 TTTTTTTTTTTTTTTAAACAAGG + Intergenic
996029429 5:118688375-118688397 ATCCTGTTTCGTATTAAGCATGG - Intergenic
996091780 5:119358519-119358541 ATTCAGTTTTTAATAAAGCAAGG - Intronic
996278289 5:121695620-121695642 ATTATATTTTTTATTAACCCTGG - Intergenic
996408805 5:123133480-123133502 ATTCTGACTTTTAATAAAAAAGG - Intronic
996815460 5:127568791-127568813 TTCCTTTTTTTTATGAAACAAGG - Intergenic
996849226 5:127933955-127933977 ATTCTGTTGTTTATAAACTAAGG + Intergenic
996993893 5:129671071-129671093 AATGTGTTTTTGAATAAACATGG - Intronic
997185483 5:131877635-131877657 CTTTTGTTTTTTTTGAAACAAGG - Intronic
997662741 5:135601905-135601927 TTTCTTCTTTTTATAAAACATGG + Intergenic
998416373 5:141949226-141949248 ATTTTTTTTTTTTTTAGACAGGG - Intronic
998682819 5:144488886-144488908 TTTCTGTTTTGTCTTTAACATGG + Intergenic
999139744 5:149351330-149351352 TTTCTTTTATTTATTAAACTAGG + Exonic
999454824 5:151706533-151706555 AGTCTTTTTTTTTTTAGACAAGG - Intergenic
999464127 5:151785435-151785457 TAGCTGTTTTTTTTTAAACAGGG - Intronic
999565705 5:152858590-152858612 TTTCTACTTTTTTTTAAACATGG + Intergenic
999711429 5:154321887-154321909 TTTCTGGTTTTTCTTAAACTTGG - Intronic
999725936 5:154437777-154437799 ATTCTTTTTTTTATGAGACAGGG - Intergenic
999884273 5:155903393-155903415 ATTTTGTTTTGTTTTCAACAAGG + Intronic
999962937 5:156776423-156776445 AATTTTTTTTTTTTTAAACAGGG + Intergenic
999993543 5:157070276-157070298 TTTCTTTTTTTTCTTAGACACGG + Intergenic
1000080524 5:157841259-157841281 TTTCTTTTCTTTTTTAAACACGG - Intronic
1000463111 5:161546795-161546817 TTTTTTTTTTTTTTTAAACAAGG - Exonic
1000605434 5:163322584-163322606 TTTCTGTTTTTTAGTAGAGACGG + Intergenic
1000739714 5:164952996-164953018 TTTTTTTTTTTTTTTAAACAGGG + Intergenic
1000850508 5:166334366-166334388 ATTCTGTTTTTTCTTAACTTAGG + Intergenic
1000937122 5:167315851-167315873 ATTTTCTTTTTCATTTAACAAGG - Intronic
1000952886 5:167506008-167506030 ATTTTTTTTTTAATTAAACATGG - Intronic
1000985061 5:167857297-167857319 ATTCTGTTTTTCATAGGACATGG + Intronic
1001058222 5:168466631-168466653 ATCCTGTTTATAAGTAAACAGGG - Intronic
1001095194 5:168770653-168770675 ATTGTTTTTTTTTTTAAAAAAGG + Intronic
1001359674 5:171069227-171069249 ACTCTGATTTTTGTTAGACAGGG + Intronic
1001391881 5:171386305-171386327 ATTTTTTTTTTTTTTAAACGGGG - Intergenic
1001423316 5:171603564-171603586 ATTTTATTTTTAATTATACAAGG + Intergenic
1001499087 5:172214724-172214746 AATTTGTTTTTTATTTAATATGG + Intronic
1001504206 5:172264085-172264107 CTTTTGTTTTTTTTGAAACAGGG + Intronic
1001520270 5:172386433-172386455 ATTCTTTTTTAAATTAAAGAGGG - Intronic
1001738208 5:174024339-174024361 ATTCTCTTTTTTCTTATAAAAGG - Intergenic
1001802602 5:174557197-174557219 ATTTTTTTTTTTTTGAAACAGGG + Intergenic
1001805551 5:174582673-174582695 ATTTTTTTTTTTTTTAAACAGGG - Intergenic
1002617144 5:180463021-180463043 TTTGTATTTTTTATTAAAGAGGG + Intergenic
1003094199 6:3129975-3129997 TTTGTGTTTTTTAGTAAAGACGG + Intronic
1003105061 6:3209159-3209181 ATTCTGTTTTTAATTTACCGGGG + Intergenic
1003105311 6:3210808-3210830 ATTAATTTTTTTTTTAAACAGGG + Intergenic
1003305967 6:4929434-4929456 CTTCTGGTTTTTATCAAATATGG + Intronic
1003577430 6:7310603-7310625 ATGCTGTTTTCTTTTAAACGTGG - Intronic
1003863249 6:10341022-10341044 ATTTTTTTTTTTATTAGAGACGG - Intergenic
1003869889 6:10393210-10393232 ATTCTTTTCTATATTAAACTTGG - Intronic
1004067490 6:12262864-12262886 TTTTTTTTTTTTTTTAAACAGGG - Intergenic
1004339328 6:14794564-14794586 TTTTTGTTTTTTTTTTAACAAGG - Intergenic
1004490103 6:16106800-16106822 ATTTTTTTTTTTAGTAGACATGG + Intergenic
1004797855 6:19108873-19108895 GTTCTGCTTATTTTTAAACAGGG + Intergenic
1004985876 6:21081746-21081768 ATTTTTTTTTTTAGTAAAGATGG + Intronic
1005035987 6:21555267-21555289 CTTCTTTTTTTTTTTAAAAACGG - Intergenic
1005255705 6:24000884-24000906 ATTTTATTTTATTTTAAACAGGG + Intergenic
1005374730 6:25170607-25170629 ACTCTGTCTTTTATCAAAGAAGG + Intergenic
1005414729 6:25587714-25587736 AATTTGTTTCTTAGTAAACATGG - Intronic
1005451466 6:25977108-25977130 ATCCTGTTTTTTGATAAATAGGG + Intronic
1005505470 6:26465522-26465544 TTTTTTTTTTTAATTAAACAGGG - Intronic
1005951474 6:30634684-30634706 TTTTTTTTTTTTTTTAAACAAGG - Intronic
1006469574 6:34220087-34220109 TTTCTGTTTTGTAATAAATAAGG - Intergenic
1006552654 6:34837670-34837692 ATTATTTTTTTTTTGAAACAGGG - Intronic
1006555653 6:34863981-34864003 TTTGTTTTTTTTTTTAAACAGGG + Exonic
1006662048 6:35655149-35655171 TTTCTGTTTCTTTTTAGACATGG - Intronic
1006892076 6:37437352-37437374 TTTCTGTTTTTTAGTAGAGATGG - Intronic
1006946284 6:37786465-37786487 ATTCTTTTTTTTTTTAGACAGGG - Intergenic
1006979130 6:38132498-38132520 ATTTTGTTTTCTATGAGACAGGG - Intronic
1007245325 6:40457630-40457652 TTTTTTTTTTTTTTTAAACAGGG - Intronic
1007422176 6:41726404-41726426 ATTCTGTTGTTTATTCACCTGGG + Intronic
1007521899 6:42456529-42456551 TTTTTTTTTTTTTTTAAACAGGG + Intergenic
1007579598 6:42949478-42949500 ATTTTTTTTTTTTTAAAACAGGG - Intergenic
1007667215 6:43521913-43521935 TTTCTGTTGTTTTTGAAACAGGG - Intronic
1007898135 6:45383604-45383626 TTTTTCTTTTTTTTTAAACAAGG - Intronic
1008002192 6:46372148-46372170 ATGGTGTTTCTTATTAACCATGG + Intronic
1008243337 6:49140585-49140607 ATTCTGATTGTTATTACTCAAGG - Intergenic
1008337944 6:50328769-50328791 TTTTTTTTTTTTTTTAAACAGGG - Intergenic
1008593877 6:53021511-53021533 ACTCCTTTTTATATTAAACAGGG + Intronic
1008757604 6:54816317-54816339 ATTTTTTTTTTTTTTAGACAGGG + Intergenic
1008833085 6:55792781-55792803 CCTCTGTGGTTTATTAAACAAGG + Intronic
1008843908 6:55938639-55938661 ATTGTGTTTTTCTTTAAGCATGG - Intergenic
1008867397 6:56229359-56229381 ATTCTGTTGTTTTTGAGACAGGG - Intronic
1009054753 6:58321309-58321331 TTCCTATTATTTATTAAACAGGG - Intergenic
1009433069 6:63587937-63587959 ATTTTGTTTTTTAGTAGAGACGG + Intergenic
1009958877 6:70494588-70494610 ATTCTTTTTTATATTAAAAAAGG - Intronic
1009966950 6:70587979-70588001 ACTGTGTTGTTAATTAAACAAGG - Intronic
1010028659 6:71248884-71248906 ATTGTGTTTTTTTTTTATCAAGG - Intergenic
1010110395 6:72221733-72221755 ATTTTATCTTTTATAAAACAAGG - Intronic
1010380692 6:75221142-75221164 GTTATTTTTTTTTTTAAACAAGG + Intergenic
1010430880 6:75777432-75777454 TTTCTTTTTTTTTTGAAACAGGG + Intronic
1010477764 6:76310068-76310090 ATTCTGATTTTTATTTAGAATGG + Intergenic
1010720259 6:79275564-79275586 ATTCTGTTGTTCCTTAAGCAGGG + Intergenic
1010740406 6:79495865-79495887 ATTTTTTTTTTCAATAAACACGG - Intronic
1010871058 6:81040232-81040254 ATTCTTATTTTTATTAGACTAGG - Intergenic
1011312736 6:85998497-85998519 ATCCTGTTTTTTTTTTAACAGGG - Intergenic
1011368996 6:86612127-86612149 ATTTTGTTTTTTATGTTACAAGG + Intergenic
1011875855 6:91960612-91960634 ATTATTGTTTTTCTTAAACAGGG + Intergenic
1012147684 6:95706863-95706885 ATACTATTTTTTCTTAAAAATGG - Intergenic
1012266231 6:97146886-97146908 CTTTTCTTTTTTCTTAAACAGGG - Exonic
1012512138 6:100014282-100014304 ATTCTGATTTTTAATAACAAAGG + Intergenic
1012813308 6:103988805-103988827 TTTATGTTGTTTATAAAACATGG - Intergenic
1012817093 6:104037820-104037842 ATTCTGTTTTCTAGTAATGATGG + Intergenic
1012857374 6:104518333-104518355 CTTTTTTTTTTTTTTAAACAGGG + Intergenic
1013202087 6:107908201-107908223 ATTTTATTTTTTTTTAAAGAGGG + Intronic
1013364143 6:109422580-109422602 ATTCTTTTTTTTTTGAGACAGGG - Intronic
1013791412 6:113841020-113841042 GTTTTGTCTTTTATTAAACATGG - Intergenic
1013923999 6:115446360-115446382 ATTTTGTGTTTAAATAAACAAGG - Intergenic
1013969034 6:115994052-115994074 ATTAAGTTTTCTATAAAACATGG - Intronic
1014037228 6:116781009-116781031 CTTCTTTTTTTTTTTAAATAGGG + Intergenic
1014051471 6:116960393-116960415 ATTCAGTCTTCTATAAAACATGG + Intergenic
1014303713 6:119714664-119714686 TTTCTGTTTATTATTTGACAGGG + Intergenic
1014379263 6:120718885-120718907 ATTCTAATTTTGATTAATCATGG - Intergenic
1014427986 6:121332616-121332638 TTTCTGGTTTTTATTTTACATGG - Intronic
1014475661 6:121869622-121869644 ATTTTTTTTTTTTTTAAAAAAGG + Intergenic
1014503355 6:122222272-122222294 ATTTTATGTTTTATTAAACAAGG + Intergenic
1014609163 6:123519477-123519499 TTTTTTTTTTTTTTTAAACAGGG + Intronic
1014632053 6:123800764-123800786 ATTCTGTTTTCTATTATTCCTGG - Intergenic
1014676706 6:124376692-124376714 ATTCTGTTTTATATTGGATAGGG - Intronic
1014847723 6:126299133-126299155 ACTTTTTTTTTTTTTAAACAAGG + Intergenic
1014915516 6:127142821-127142843 TTTTTGTTTTTTTTTAGACAAGG + Intronic
1014925497 6:127266298-127266320 ATTCTGTTTTTTTTAAAAAAAGG + Intergenic
1014927847 6:127296195-127296217 TGTCTGTTTTTTTTTAGACAGGG + Intronic
1014983286 6:127971719-127971741 ATTTTTTTTTTAATTAAAAAAGG + Intronic
1015280574 6:131429881-131429903 ATTTTTTTTTTTTTTAAACAGGG - Intergenic
1015470582 6:133601250-133601272 TTTCTATTTTTTAGTAGACATGG + Intergenic
1015665276 6:135621215-135621237 ATACTTTATTTCATTAAACATGG - Intergenic
1015741608 6:136461155-136461177 ATTCTCTTAGTTATAAAACATGG - Intronic
1015990043 6:138930713-138930735 GTTCTGTTTTTTTGTTAACAAGG - Intronic
1016186420 6:141202929-141202951 TTTCTGTTTTTAATTATAAATGG - Intergenic
1016588905 6:145721154-145721176 TTTCTCTTTTTTATTTGACAGGG - Intronic
1016656827 6:146528402-146528424 ATTCTGATTTCTGTTAAATATGG + Intergenic
1016672331 6:146723350-146723372 ATCAAGTTTTTTATTAAAAATGG - Intronic
1017143386 6:151212347-151212369 ACTTTTTTTTTTTTTAAACAAGG - Intergenic
1017167200 6:151419664-151419686 TTTTTTTTTTTTTTTAAACAGGG - Intronic
1017218419 6:151937049-151937071 CCTTTGTTTTTTATAAAACAAGG - Intronic
1017246163 6:152227903-152227925 ATTCTGTTTCTGATCAAAAAGGG + Intronic
1017294128 6:152774693-152774715 ATTTTCTTTTTCATTAAACTGGG - Intergenic
1017511588 6:155118945-155118967 ATTTTTTTTTTTTTTAAAGATGG - Intronic
1017640909 6:156493066-156493088 ATTCTTTTCTTGATTAATCAAGG - Intergenic
1017730229 6:157309391-157309413 TTTTTGTTTGTTTTTAAACAGGG + Intronic
1017882413 6:158571267-158571289 TTTGTGTTTTTTAGTAAAGACGG + Intronic
1018194118 6:161339613-161339635 ATTTTCTTTTTTATGAGACAGGG - Intergenic
1018241075 6:161775247-161775269 ATTCTTTTTTTTTTAAGACAGGG + Intronic
1018403302 6:163448555-163448577 ATTTTTTTTTTTAGTAGACACGG - Intronic
1018541999 6:164891866-164891888 TTTCTGTATTTCATTAAATAAGG + Intergenic
1018781811 6:167075186-167075208 TTTCTTTTTTTTATTGCACAGGG - Intergenic
1018879767 6:167865684-167865706 AATCTGTATTTTATTAAAACAGG - Intronic
1019115202 6:169754932-169754954 ATTTTTTTTTTAATTAAACCAGG - Intronic
1019672797 7:2291290-2291312 TTTCTTTTTTTTTTTAAACAGGG - Intronic
1019698512 7:2461017-2461039 TTACTCTTTTTTATTAAACAAGG - Intergenic
1020121457 7:5506253-5506275 TTTCTTTTTTTTTTTAGACAAGG + Intronic
1020377964 7:7509135-7509157 ATTTTGTTTTTTTTGAGACAGGG + Intronic
1020671853 7:11125526-11125548 ATTCTTTTGATTATTAAACAAGG + Intronic
1020954485 7:14723297-14723319 ATTCTATTTTTAATTAACAAAGG + Intronic
1021245697 7:18258974-18258996 TTTTTTTTTTTTTTTAAACAGGG + Intronic
1021373259 7:19877018-19877040 TTTCTTTTTTTTATTTAATAAGG + Intergenic
1021404768 7:20252199-20252221 ATTCCGTCTTTTATTAGTCAGGG - Intergenic
1021468597 7:20974489-20974511 ATTTTGTTTTTTATTATGGAAGG - Intergenic
1021552741 7:21888861-21888883 ATTCTTTTTGTTTTTAAAAAAGG + Intronic
1021715433 7:23457454-23457476 ATTTTTTTTTTTTTGAAACAGGG - Intronic
1021884264 7:25123665-25123687 TTTCTGTTTTGTAATAAATAAGG + Exonic
1021973937 7:25993341-25993363 TTTTTTTTTTTTTTTAAACAGGG + Intergenic
1022164676 7:27746070-27746092 ACTATTTTTTTTATAAAACAAGG - Intronic
1022608472 7:31841631-31841653 TTTCTGTTTGTTTTTAAATATGG + Intronic
1022609345 7:31853714-31853736 TTTTTGTTTTTTTTTAAACAGGG + Intronic
1023179546 7:37468456-37468478 ATTTTGTTTTTTAGTAGAGATGG - Intergenic
1023312941 7:38906349-38906371 TTTCGTTTTTTTTTTAAACAGGG + Intronic
1023380011 7:39597974-39597996 TTTCTTTTTTTTATTAAATAGGG + Intronic
1023585324 7:41724183-41724205 ATTCTTTTTTTTCTTAGAAATGG + Intergenic
1023710495 7:42987404-42987426 ATTTTGTTTTTCATTGAATATGG + Intergenic
1023818429 7:43967150-43967172 TTTCTTTTTTTTTTTAAACAGGG + Intergenic
1023846859 7:44126479-44126501 TTTCTTTTTTTTTTGAAACAAGG + Intergenic
1023973548 7:45009914-45009936 TTTTTTTTTTTTTTTAAACAGGG + Intronic
1024446123 7:49481641-49481663 AGTATGTTTTTTGTTGAACATGG - Intergenic
1024670670 7:51591185-51591207 ATTCCGTATTTTATAAAAGAAGG + Intergenic
1025061404 7:55811667-55811689 TTTCTGTTTTTTAGTAGAGAAGG + Intronic
1025195456 7:56928844-56928866 TTTCTGTATTTTAGTAAAGACGG - Intergenic
1025220706 7:57105141-57105163 CTTCTTTTTTTTATGAGACAAGG - Intergenic
1025245837 7:57316531-57316553 ATCCTATTTTTTGTTCAACATGG - Intergenic
1025288956 7:57695271-57695293 AATCTATTTTAAATTAAACAAGG - Intergenic
1025676496 7:63648098-63648120 TTTCTGTATTTTAGTAAAGACGG + Intergenic
1025875625 7:65477774-65477796 GTTCTGTTTTTTTTTTAAGATGG + Intergenic
1026012078 7:66644361-66644383 ATTTTGTTTTTTAATAGAGATGG - Intronic
1026082032 7:67230440-67230462 GTTTTGTTTTTTAATAAACTTGG - Intronic
1026201270 7:68216612-68216634 ATACTCTTTTTTTTGAAACAGGG + Intergenic
1026458397 7:70592854-70592876 TTTTTGTTTTTTATTAGAGACGG + Intronic
1026671291 7:72392824-72392846 ATTTTTTTTTTAATGAAACAGGG - Intronic
1026695034 7:72583549-72583571 GTTTTGTTTTTTAATAAACTTGG + Intronic
1026858799 7:73771379-73771401 TTTTTTTTTTTTTTTAAACAGGG - Intergenic
1026885354 7:73939049-73939071 GTTCTCTTTATTATTAAAAATGG + Intergenic
1026905215 7:74059079-74059101 ATTTTTTTTTTTTTTAAACTGGG - Intronic
1027206592 7:76105286-76105308 ATTCTGTATTTTAGTACAGATGG - Intergenic
1027367938 7:77477926-77477948 ATTTTGTATTTTAGTAAAGACGG + Intergenic
1027454771 7:78375574-78375596 ATTTTGTTTTTTTTTTAAAAAGG - Intronic
1027560074 7:79718443-79718465 ATTCTTTTTTTTTTGAGACAGGG - Intergenic
1028055849 7:86241690-86241712 AGTTTTTTTTTTATTTAACAGGG + Intergenic
1028149267 7:87353152-87353174 TTTCTTTTTTTTTTGAAACATGG + Intronic
1028314286 7:89380929-89380951 ATTCTGTATTTTGTTAACCTGGG - Intergenic
1028394084 7:90348209-90348231 ATTTTCTTTTTTTTGAAACAGGG - Intronic
1028463236 7:91119870-91119892 GTTGTGCTTTTTATTCAACAGGG - Intronic
1028750369 7:94376017-94376039 GTTTTGTTTTTTTTTAAACTGGG - Intergenic
1028785095 7:94783577-94783599 CTTCTTTTATTTATTAAACTAGG + Intergenic
1029573562 7:101387937-101387959 TTTTTGTTTCTTATTAAAGAGGG + Intronic
1029874663 7:103737448-103737470 CTTCTGTTTTTTATTATTTATGG + Intronic
1029929135 7:104352156-104352178 ATTTTTTTTTTTTTTATACAGGG - Intronic
1030472610 7:109985345-109985367 ATTCTGTTTTTTATGAAAGCAGG - Intergenic
1030498130 7:110325657-110325679 ATTCATTTCTTTATTACACATGG - Intergenic
1030588825 7:111454135-111454157 TTTTTGTTTTTTATTAGAGATGG + Intronic
1030632398 7:111909953-111909975 TTTTTCTTTTTTTTTAAACAGGG - Intronic
1030743896 7:113141544-113141566 ATTTTGTTTTTTTTTAATCCTGG + Intergenic
1030766850 7:113421034-113421056 AGTTTACTTTTTATTAAACAAGG - Intergenic
1030787524 7:113680913-113680935 TTTTTGTTTTTTATTTAACTTGG - Intergenic
1030838272 7:114315577-114315599 ATTTTCTTTTTTATAATACAAGG - Intronic
1030867458 7:114717014-114717036 TTTGGGTTTTTTTTTAAACAAGG + Intergenic
1031202669 7:118709436-118709458 CTTCTCTATTTTATTAAACATGG - Intergenic
1031348838 7:120703230-120703252 ATTTTGTTGTTAATTTAACAGGG - Intronic
1031407094 7:121398784-121398806 TTTCTGTTTTGTAATAAATAAGG - Intergenic
1031440092 7:121783797-121783819 AATTTGTTTTTTGTTAAAAATGG + Intergenic
1031546453 7:123055897-123055919 ATTCTGATTTTTAATATAAATGG - Intergenic
1031621631 7:123940663-123940685 ATTTTCTATTTTTTTAAACATGG + Intronic
1031700675 7:124921440-124921462 ATTTTCTTTCTTATTAAATAAGG - Intronic
1031789849 7:126088212-126088234 AATCTTTTTCTTATTAAAAATGG - Intergenic
1032187887 7:129743168-129743190 TTTTTTTTTTTTTTTAAACAAGG - Intronic
1032202798 7:129834831-129834853 ATTTTTTTTATTACTAAACAAGG - Exonic
1032362381 7:131267996-131268018 TTTTTGTCTTTTGTTAAACATGG - Intronic
1032886759 7:136148644-136148666 TTTTTTTTTTTTTTTAAACAGGG + Intergenic
1033003257 7:137530886-137530908 CTTCTCTTTTGTATTAAGCAGGG - Intronic
1033183356 7:139202194-139202216 TTTCTTTTTTTTTTTAGACATGG - Intergenic
1033442179 7:141390106-141390128 TTTCTCTTTTTTTTTAAAAAGGG - Intronic
1033475043 7:141683932-141683954 ATTTTTTTATTTTTTAAACAGGG + Intronic
1033674932 7:143531497-143531519 ATTGTGTTTTATATTAATTAAGG - Intergenic
1033696904 7:143797943-143797965 ATTGTGTTTTATATTAATTAAGG + Intergenic
1033890857 7:146011527-146011549 TTTCTGTATTTTAGTAAAGATGG + Intergenic
1034328494 7:150260258-150260280 ATTCTTTCATTTATTCAACAGGG + Intronic
1034764717 7:153709134-153709156 ATTCTTTCATTTATTCAACAGGG - Intergenic
1035873220 8:3157965-3157987 CTTTTGTTTTCTTTTAAACAGGG - Exonic
1036013056 8:4749981-4750003 ATTTTTTTTTCAATTAAACAAGG - Intronic
1036059285 8:5297021-5297043 ATTCCATTTTTTAATAAAGATGG + Intergenic
1036488703 8:9203634-9203656 ATTCTGTCTTTTCTTTAACATGG - Intergenic
1036805170 8:11826641-11826663 TTTGTATTTTTTAGTAAACACGG - Intronic
1037276638 8:17187405-17187427 ATGCTTTTTTTTTTTAAACTTGG - Intronic
1037365063 8:18113502-18113524 ATTTTTTTTTTTTTTAAAGATGG + Intergenic
1037495305 8:19434829-19434851 TTTTTTTTTTTTCTTAAACAAGG - Intronic
1037871099 8:22497331-22497353 ATTTTTTTTTTTTTTAAAGATGG + Intronic
1038119452 8:24596219-24596241 AATTTGTTCTTTATTAAAAATGG + Intergenic
1038257571 8:25964455-25964477 ATTCTTTTTTTAATTAAATGTGG - Intronic
1038265193 8:26033828-26033850 ATTTTTTATTTTATAAAACATGG - Intronic
1038500944 8:28043185-28043207 ATTCTTTTGTTTATCCAACAAGG - Intronic
1038550818 8:28466948-28466970 ATTCTGTTTTTTTAGAGACAGGG + Intronic
1038561990 8:28588804-28588826 ATTCTTTTTTTTTTGAGACAGGG + Intergenic
1038647099 8:29370997-29371019 ATTTTGTTTTGTTTTAGACAGGG - Intergenic
1038809089 8:30821841-30821863 ATTTTTTTTTTTTTTAAACAGGG + Intergenic
1039151833 8:34515245-34515267 CTTCTGTTTTTTCTTAAATCGGG - Intergenic
1039155437 8:34551238-34551260 ATTCTATTTATTATTGAAAATGG + Intergenic
1039178387 8:34835046-34835068 ATTTTTTTTTTTTTTAGACAGGG - Intergenic
1039327622 8:36502600-36502622 TTTTTGTTTTTTTTTAAAGAAGG - Intergenic
1039331939 8:36547141-36547163 ATTCTGTTTCATTTTATACAAGG - Intergenic
1039452520 8:37686979-37687001 ATTCTATTTTTTAAAAAAAAGGG + Intergenic
1039505375 8:38048264-38048286 ATTTTTTTTTTTTTGAAACAGGG - Intronic
1039553866 8:38462909-38462931 TTTTTTTTTTTTTTTAAACAGGG + Intronic
1039598813 8:38815953-38815975 TTTTTTTTTTTTTTTAAACATGG - Intronic
1039654875 8:39393250-39393272 ATTCTTTTTTTTATTATTTAAGG + Intergenic
1039816866 8:41101903-41101925 ATTTTATTTTTTCTGAAACAGGG + Intergenic
1039880708 8:41623839-41623861 TTTTTTTTTTTTTTTAAACACGG + Exonic
1040283990 8:46090538-46090560 ATGCTGTTTTTCACTAAAGAAGG - Intergenic
1040466170 8:47697277-47697299 TTTCTTTTTTTTTTTTAACAGGG - Intronic
1040728273 8:50410007-50410029 ATTGTGTGTTTTATTCCACAAGG - Intronic
1040754996 8:50762454-50762476 ATTCTGTTTTGTAATAAATAAGG + Intronic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1040846583 8:51848408-51848430 ATTCTGTCTTATAGGAAACATGG - Intronic
1040950626 8:52935501-52935523 TTTCTATTTTTTATTAGAGATGG - Intergenic
1040996823 8:53410740-53410762 ATTTTTTTTTTTTTTAGACAGGG - Intergenic
1041009957 8:53531990-53532012 TTTTTGTTTTTAATTAGACAAGG + Intergenic
1041425314 8:57714125-57714147 ATTCTGGTTTTTATTAAATAGGG + Intergenic
1041929627 8:63272607-63272629 TTTCTTTTTTTTTTGAAACAGGG + Intergenic
1042219139 8:66456132-66456154 ATTCTTTTTTTTTTTAGAGATGG - Intronic
1042617163 8:70662692-70662714 ATTCTTTTTTTTTTGAGACAGGG + Exonic
1042746505 8:72113645-72113667 ATTATTTTTATTATTAAAAAAGG + Intronic
1042845390 8:73164970-73164992 ATTTTGTATCTTATTACACAAGG - Intergenic
1042891025 8:73610266-73610288 GTTTTTTTTTTTTTTAAACAGGG - Intronic
1042910356 8:73819982-73820004 TTTCTTTTTTTTATTAGAGATGG + Intronic
1042984912 8:74572949-74572971 AATCTGATTTTTTTTAAAGAAGG - Intergenic
1042991461 8:74645215-74645237 ATTCACTTTTTTATTTACCAAGG - Intronic
1043391604 8:79797440-79797462 ATTTTATTTTTTATTTAAAAAGG + Intergenic
1043432309 8:80206858-80206880 ATTCTAAATTTTATTAGACATGG + Intronic
1043451959 8:80376822-80376844 ATTCAGATTTCTATAAAACAAGG - Intergenic
1043481295 8:80655369-80655391 ATTCTTTTTTTTTTTATACTGGG - Intronic
1043733522 8:83715753-83715775 AATATGTTTTTTATGAAATAAGG + Intergenic
1044261449 8:90128376-90128398 ATTATGTTTCTCATCAAACAAGG - Intergenic
1044588759 8:93893360-93893382 TTTTTTTTTTTTACTAAACAGGG + Intronic
1045067976 8:98469101-98469123 TTTCTTTTTTTTTTTAAAGATGG - Intronic
1045203949 8:100017002-100017024 TTTTTTTTTTTTTTTAAACAGGG + Intronic
1045463768 8:102450233-102450255 TTTTTTTTTTTTTTTAAACAGGG + Intergenic
1045854565 8:106749168-106749190 TTTCTGTTTTTTAGTAGAGATGG - Intronic
1046409552 8:113821901-113821923 TTTTTGTTTTTTATTAAATTAGG + Intergenic
1046762988 8:118040804-118040826 TTGCTGCTTTTTATTAAACAAGG - Intronic
1046907696 8:119591716-119591738 ATTCCAATTTGTATTAAACAAGG - Intronic
1047037773 8:120958143-120958165 TTTTTGTTTTTTTTAAAACAGGG - Intergenic
1047140706 8:122135826-122135848 ATTTTGTCTTTTCTTAAAAAGGG + Intergenic
1047162241 8:122393423-122393445 ATTCTCTGTTTAATGAAACATGG + Intergenic
1047527882 8:125649236-125649258 CTTTTTTTTTTTTTTAAACAGGG - Intergenic
1047585877 8:126271694-126271716 CTTCTTTTTTTTTTGAAACAGGG - Intergenic
1048085072 8:131168509-131168531 ATTCTGCTTATTATTAGTCAGGG + Intergenic
1048145539 8:131838361-131838383 ATTCTATTTTTTTTTTAACAGGG + Intergenic
1048175263 8:132146597-132146619 CTTTTTTTTTTTTTTAAACAGGG + Intronic
1048239271 8:132725043-132725065 TTTCTTTTTTTTTTTTAACAGGG + Intronic
1048486708 8:134855111-134855133 ATTTTTTTTTTTTTTAGACAGGG + Intergenic
1048739266 8:137536493-137536515 ATTTTTTTTTTTCTTAGACAGGG - Intergenic
1048802864 8:138210233-138210255 TTTCTGATTTTAATTATACAAGG + Intronic
1049045349 8:140146555-140146577 ATGCTGTTTTTTTTAAAAAATGG - Intronic
1049084475 8:140467906-140467928 ATTTTGTTTTTTAGTAGAGATGG + Intergenic
1049185336 8:141248557-141248579 ATTATTTTTTTTTTTAAACAGGG - Intronic
1049699025 8:143998941-143998963 CTTTTTTTTTTTTTTAAACAGGG - Intronic
1049752732 8:144292946-144292968 TTTCTTTTTTTTCTTAGACAGGG - Intronic
1049794735 8:144491923-144491945 ATTATGTTTTTTAAGAGACAGGG - Intronic
1049847309 8:144809137-144809159 AGGCTTTTTTTTTTTAAACAGGG - Exonic
1049858552 8:144880928-144880950 GTCCTGTTTTGTATGAAACAAGG - Exonic
1050543219 9:6687812-6687834 TTTTTTTTTTTTTTTAAACAGGG + Intergenic
1050626162 9:7505861-7505883 ATTCTGTTGTGTAACAAACATGG + Intergenic
1050626983 9:7515217-7515239 ATTCTCTTTTTTTAAAAACATGG - Intergenic
1050796580 9:9553052-9553074 AATTTCTTTTTTATTAAATATGG + Intronic
1051017680 9:12500552-12500574 TTTCTTGTTTTTATTAAACAAGG - Intergenic
1051138876 9:13955650-13955672 AATCTGTTTTTTGTTATAGAGGG + Intergenic
1051266634 9:15315662-15315684 ATTTTGTTTTTTTTTAGACAGGG - Intergenic
1051288565 9:15521913-15521935 ATTTTGTTTGTTTTGAAACAGGG - Intergenic
1051580952 9:18673511-18673533 ATTATGTTTTTGTTTGAACAAGG - Intronic
1051642862 9:19239467-19239489 ATTCTTTTTTTTTTTTAAGATGG + Intronic
1051792070 9:20816361-20816383 CTTCTGTTTTTAATTAAAATGGG + Intronic
1051969889 9:22875864-22875886 ATAATGTTTTTTATTCATCAAGG - Intergenic
1052171752 9:25407083-25407105 TTTCTTTTTTTTTTGAAACAAGG - Intergenic
1052295094 9:26889244-26889266 TTTCTGTTTTTTATTAGACACGG - Intronic
1052571183 9:30226400-30226422 TTTTTTTTTTTTTTTAAACAGGG + Intergenic
1052605512 9:30693568-30693590 ATTCTGTTTTTAATAACATAAGG + Intergenic
1052930765 9:34053650-34053672 ATTCTTTTTTTTCTTAGACAGGG + Intergenic
1052950945 9:34210713-34210735 ATTTTTTTTTTTTTTAAAGATGG - Intronic
1053118919 9:35530644-35530666 TTTCTGTTTTTTATGAGACTGGG + Intronic
1053339541 9:37311895-37311917 ATTTAGATTTTTATTAAACTTGG + Intronic
1053569989 9:39294699-39294721 ATTCTGTTTATTATGAAAAATGG - Intergenic
1053835949 9:42135728-42135750 AATCTGTTTATTATGAAAAATGG - Intergenic
1054091618 9:60853702-60853724 ATTCTGTTTATTATGAAAAATGG - Intergenic
1054113033 9:61129276-61129298 ATTCTGTTTATTATGAAAAATGG - Intergenic
1054127160 9:61324311-61324333 ATTCTGTTTATTATGAAAAATGG + Intergenic
1054146898 9:61568908-61568930 ATTCTTTTTTTTTTGAGACAGGG + Intergenic
1054594683 9:67052916-67052938 ATTCTGTTTATTATGAAAAATGG + Intergenic
1055077870 9:72235706-72235728 ATTCTCTTTTTTCTGAGACAAGG - Intronic
1055164469 9:73174810-73174832 ATTCTGTTTTCAAATAAACCTGG + Intergenic
1055315895 9:75033844-75033866 TTTTTGTTTGTTTTTAAACAAGG + Intergenic
1055328793 9:75160466-75160488 ATTTTTTTTTTTTTTAAACAGGG - Intergenic
1055406678 9:75981730-75981752 ATTCTTTTTTTTTGTAAAGATGG + Intronic
1055465872 9:76565225-76565247 ATTTTATTTTTTATGAGACAGGG - Intergenic
1055605237 9:77962717-77962739 TTTGTATTTTTTATTAGACACGG - Intronic
1055688220 9:78801278-78801300 ATTGTGTTTTTTTATAATCATGG - Intergenic
1055786868 9:79880189-79880211 ATACTGATTTTTCTTAAAAAGGG + Intergenic
1056140716 9:83677064-83677086 AATCTGATTTTTAATAAACCTGG + Intronic
1056350811 9:85746869-85746891 ATTTTGTTTTTTTTGAGACAGGG + Intergenic
1056403471 9:86250888-86250910 ACTCTGTCTTTTAATAAAAAAGG - Intronic
1056472966 9:86924000-86924022 ATTTTGTATTTTATTAAAGACGG - Intergenic
1056476299 9:86954455-86954477 TTTCTTTTTTTTAGTAAAGATGG - Intergenic
1056842111 9:90006268-90006290 TTTATGTTCTTTATTAAAAAGGG + Intergenic
1056906365 9:90652688-90652710 GTTCTATTTTTTATTTAAAATGG - Intergenic
1056907756 9:90668356-90668378 ATTTTTTTTTTTTTTAAAGATGG + Intergenic
1056979657 9:91297597-91297619 AATTTTTTTTTTTTTAAACAGGG + Intronic
1057621488 9:96639920-96639942 TTTCTATTTTTTAGTAAAGATGG - Exonic
1057898426 9:98928190-98928212 GTTCTTTTTTTTTTTAAAAAGGG - Intergenic
1057905819 9:98982646-98982668 TTTCTTTTTTTTTTTAGACAGGG + Intronic
1057940965 9:99283991-99284013 ATTTTTTTTTTTTTTAAATAAGG + Intergenic
1058024193 9:100122754-100122776 TTTCTGTTTTTTAGTAGAGAGGG + Intronic
1058028250 9:100166514-100166536 CTTCTTTTTTTTCTTAAACAAGG - Intronic
1058048965 9:100387497-100387519 ATTTTGTTCTTTTTTTAACAGGG + Intergenic
1058269409 9:102951476-102951498 ATTTTGTTTCTTATTAGGCAAGG - Intergenic
1058369917 9:104254370-104254392 ATTCTGTTCTTTGTAAAAGACGG - Intergenic
1058414618 9:104774656-104774678 ATTCTATTTTTGCTTAAACCGGG - Intronic
1058664754 9:107301711-107301733 ATTTTTTTTTTTCATAAACAGGG + Intronic
1058854679 9:109049518-109049540 TTTTTGTTTTTTAAGAAACAGGG + Intronic
1058995050 9:110291591-110291613 ATTTTTTTTTTTAGTAGACATGG + Intergenic
1059189911 9:112315212-112315234 AGTTTGTTTTATGTTAAACATGG - Intronic
1059194641 9:112359268-112359290 TTTCTATTTTTTAGTAAAGATGG - Intergenic
1059303199 9:113332049-113332071 ATTCTTCTTTTTATTAAACAGGG - Exonic
1059432065 9:114256317-114256339 TTTCTGTTTTTTAGTAGAGACGG - Intronic
1059487162 9:114635670-114635692 ATTCTTTTTTTTTTGAGACAGGG - Intronic
1059610938 9:115893511-115893533 ATTCATTTTTTTATTAAACTAGG - Intergenic
1059921452 9:119165116-119165138 ATTCTTTTTTTTTTTAAGAATGG - Intronic
1060262190 9:122085633-122085655 GATCTATTTTTTCTTAAACAGGG - Intronic
1060336402 9:122727263-122727285 CTTCTGTTTTTTAAGAGACAGGG + Intergenic
1060363021 9:122978908-122978930 ATTTTATTTTATTTTAAACAGGG + Intronic
1060428906 9:123531110-123531132 ATTCTGTTTTTTACTATTCTGGG + Intronic
1060452148 9:123753109-123753131 CTAATGTTTTTTAATAAACATGG + Intronic
1060579191 9:124728461-124728483 TTTCTGTTTTTTAGTAGAGATGG - Intronic
1060651908 9:125335373-125335395 TTTCTTTTTTTTTTTAAAAATGG + Intronic
1060688754 9:125637391-125637413 ATTTTTTTTTTTAGAAAACAGGG - Intronic
1060840941 9:126792755-126792777 ATTCTTTTTTTTTTTCAAGACGG - Intergenic
1060948174 9:127582777-127582799 TTTTTGTTTTTTTTTAGACAGGG + Intergenic
1061076841 9:128346693-128346715 ATTTTGTTTTTTTTGAGACAGGG - Intronic
1061319496 9:129819309-129819331 ATACTGATTTTTATTTAAAAAGG + Intronic
1061490769 9:130942934-130942956 ATTTTTTTTTTTTTTTAACACGG + Intergenic
1061501656 9:131007170-131007192 GTTTTGTTTTTTAAAAAACAGGG + Intergenic
1061527502 9:131178999-131179021 TTTTTGTTTTTTCTTAGACAAGG + Intronic
1061571514 9:131480619-131480641 ATTTTTTTTTTTTTTAAAGATGG + Intronic
1062120602 9:134832092-134832114 ATTTTGTTTTTTAATAGAGATGG - Intronic
1203611589 Un_KI270749v1:11679-11701 AATCTATTTTAAATTAAACAAGG + Intergenic
1185566472 X:1099057-1099079 ATTTTTTTTTTTTTTAGACAGGG - Intergenic
1185794327 X:2951793-2951815 TTTTTTTTTTTTTTTAAACAGGG - Intronic
1185948986 X:4409572-4409594 TTGCTGTTTTTTAGTAAACCAGG - Intergenic
1185956698 X:4498636-4498658 ATTTTGTCTCTTATTGAACATGG + Intergenic
1186002895 X:5033992-5034014 ATTCTATCTTTTATTCAACTAGG - Intergenic
1186104754 X:6193485-6193507 TTTCTTTTTTTTTTTAAATAGGG - Intronic
1186127652 X:6431439-6431461 TTTCTTTTTTTTTTTAGACAGGG - Intergenic
1186217972 X:7320460-7320482 ATGCTGTTTTATTTAAAACAAGG + Intronic
1186855613 X:13623336-13623358 ATTTTTTTTTTTTTTAAAAAAGG + Intronic
1186945783 X:14565412-14565434 GTTCTATTTATTATTAAAAATGG + Intronic
1186952992 X:14648164-14648186 AGTCTGTTATTTATTAGGCATGG + Intronic
1187010285 X:15271429-15271451 ATTCTTTTTTTTTTGAGACAGGG + Intergenic
1187287320 X:17917928-17917950 ATTTTCTTTTTTATAAAAAAAGG - Intergenic
1187533239 X:20115410-20115432 TTTCAGTGTTTTATTATACAAGG + Intronic
1187736213 X:22306442-22306464 ATTCTGTTTTATATTCCATATGG + Intergenic
1188064196 X:25637470-25637492 GTTTTGTTTTTTAGTAAAGATGG - Intergenic
1188235322 X:27722201-27722223 ATTTTGTTTTCTTTTAAAAAAGG - Intronic
1188256498 X:27967379-27967401 ATGCTGTTTTACATTAAACAGGG + Intergenic
1188260788 X:28020698-28020720 ATTTTATTTTTTATTAGAGATGG - Intergenic
1188476097 X:30593859-30593881 TTTTTTTTTTTTTTTAAACAGGG + Intergenic
1188877771 X:35452344-35452366 ATTATTTTATTTATTAATCATGG + Intergenic
1189205200 X:39232092-39232114 ATCTTGTTTTTTATTTAGCATGG - Intergenic
1189255064 X:39631569-39631591 ATTTTTTTTTTTTTTTAACAAGG + Intergenic
1189417791 X:40830456-40830478 TTTCTTTTTTTTTTGAAACAGGG + Intergenic
1189475014 X:41345561-41345583 ATTTTTTATTTTATTAGACATGG + Intronic
1189690708 X:43613896-43613918 GTTTTGTTTTCTGTTAAACAGGG + Intergenic
1189779934 X:44504533-44504555 ATTTTGTATTTTAGTAAAGACGG - Intergenic
1189794229 X:44632433-44632455 TTTTTTTTTTTTTTTAAACAAGG + Intergenic
1189897213 X:45667986-45668008 TTTTTTTTTTTTATGAAACAAGG - Intergenic
1190010083 X:46776774-46776796 ATTCTTTTTTTTTTTTAAGATGG - Intergenic
1190195329 X:48313218-48313240 ATTTTGTTTTATTTTAGACAGGG + Intergenic
1190196157 X:48320247-48320269 ATTTTGTTTTATTTTAGACAGGG - Intergenic
1190365405 X:49689032-49689054 ATTATGTTTTTAATAACACAGGG - Intronic
1190416664 X:50186820-50186842 AGTTTGTTCTTTAATAAACATGG + Intergenic
1190428375 X:50353765-50353787 ATTCTTTTTTTTTTTAAGCAGGG - Intergenic
1190467510 X:50740515-50740537 ATTCTGTCTTTTATTGAAAGTGG - Intronic
1190635921 X:52433859-52433881 ATTCTTTTATTTTTTAAAAAAGG - Intergenic
1190661776 X:52661440-52661462 ATTTTGTTTTATTTTAGACAGGG + Intronic
1190662863 X:52670594-52670616 ATTTTGTTTTATTTTAGACAGGG - Intronic
1190676560 X:52787888-52787910 ATTTTGTTTTATTTTAGACAGGG + Intronic
1190832825 X:54074585-54074607 ATTTTGTTTTTTAGTAGAGACGG + Intronic
1191803973 X:65113555-65113577 TTTTTTTTTTTTATAAAACAAGG - Intergenic
1191829243 X:65398081-65398103 ATTTTTTTTTAAATTAAACATGG + Intronic
1191996499 X:67101419-67101441 TTTGTGTTTTTTAGTAAAGACGG + Intergenic
1192103515 X:68290768-68290790 ATTTTTTTTTTTTTTAATCAGGG - Intronic
1192571895 X:72212937-72212959 ATTCTTTTTTTTTTGAGACAGGG - Intronic
1192758609 X:74071650-74071672 TTTCTTTTTTTTTTTAAACCTGG + Intergenic
1192893224 X:75412433-75412455 ATTCTTTTTTTTTTTTGACACGG + Intronic
1193262195 X:79421319-79421341 TTTCTGTTATTTTTTTAACATGG + Intergenic
1193595196 X:83437330-83437352 ATTCTGTTTTGTCATAAACTAGG + Intergenic
1193613830 X:83664763-83664785 AGTCTGTTTTGTATGAAACTAGG + Intergenic
1193658857 X:84232281-84232303 AATTAGTTTTTTTTTAAACATGG - Intergenic
1194053165 X:89098069-89098091 TTTATGTTTTTTAAAAAACATGG - Intergenic
1195226251 X:102797221-102797243 ATTCTTTTTTTTTTTTAAGACGG + Intergenic
1195264651 X:103168481-103168503 CTTTTTTTTTTTTTTAAACAGGG - Intergenic
1195367735 X:104142233-104142255 GTTCAGTTTTTTTTGAAACAGGG - Intronic
1195623261 X:106980610-106980632 ATTCTTATTTTTTTTAAAAAAGG + Intronic
1195699974 X:107697437-107697459 AATCTCTTTTTTTTTAGACAGGG - Intergenic
1196148715 X:112348199-112348221 TTTCTGTTTCTGATTAGACATGG + Intergenic
1196436417 X:115678763-115678785 CTTTTGTTTTTTTTTAGACAGGG - Intergenic
1196534924 X:116832641-116832663 ATTCTGTTTTTGAATAATAAAGG + Intergenic
1196558300 X:117117498-117117520 ATTTTATTTTTTAGTAAAGACGG + Intergenic
1196648842 X:118148092-118148114 ATTCTTTTTTTTTTCAAACAGGG + Intergenic
1196912572 X:120499152-120499174 TTTCTGGTTTTTTTTCAACAGGG + Intergenic
1196928757 X:120660508-120660530 ATTTTTTTTTTTATTAGAGATGG + Intergenic
1197186898 X:123597650-123597672 TTTCTGTTTTTTTTGAAACAGGG - Intergenic
1197220687 X:123910695-123910717 TTTCTGTTTTTTAGTAGAGACGG - Exonic
1197260142 X:124308684-124308706 ATTCTTTTTTTCCTTAAACAGGG - Intronic
1197531369 X:127631278-127631300 ATTTTGTATTTTTTTAAAAAAGG + Intergenic
1197566405 X:128093493-128093515 ATTCTGTTTTTTCTTTGACTGGG + Intergenic
1197577968 X:128244361-128244383 ATTCTGTGTTTTCCTATACATGG - Intergenic
1197653911 X:129095262-129095284 ATTTTATTTTTTATTCAAAAGGG - Intergenic
1197852578 X:130878965-130878987 ATTGTCATTTTTATTAAATATGG + Intronic
1198088363 X:133303069-133303091 ATTCCATTTTTTTTTAAACTAGG - Exonic
1198134609 X:133735954-133735976 TTTTTTTTTTTTTTTAAACAGGG - Intronic
1198138406 X:133778019-133778041 ATTGTGTTCTTTACAAAACAAGG - Intronic
1198433262 X:136589209-136589231 GTTTTGTTTTTTAGTAAAGATGG + Intergenic
1198543658 X:137668892-137668914 ATTTTGTATTTTAGTATACACGG + Intergenic
1198821539 X:140653216-140653238 TTTTTTTTTTTTTTTAAACAGGG - Intergenic
1199098599 X:143770774-143770796 TTTTTGTTTTTTTTTAGACAGGG - Intergenic
1199208461 X:145176915-145176937 TTTCTGTTTTGTAATAAATAAGG - Intergenic
1199313611 X:146350283-146350305 ATTTTGTTTTACATAAAACATGG + Intergenic
1199471002 X:148196481-148196503 ATTATGTTTCTTCTTTAACAAGG + Intergenic
1199559766 X:149150499-149150521 ATTCTGTCTTTTATTTCACAGGG + Intergenic
1199764650 X:150932172-150932194 TTTCTGTTTTTTAGTAGAGATGG - Intergenic
1200130555 X:153841582-153841604 TTTCTGTTTTGTAATAAACAAGG - Intergenic
1200665604 Y:6018338-6018360 ATTCTGTGTTTTGTGAAACATGG - Intergenic
1200842012 Y:7791968-7791990 GTTTTTTTTTTTTTTAAACATGG - Intergenic
1201286217 Y:12380991-12381013 TTTTTTTTTTTTTTTAAACAGGG + Intergenic
1201316575 Y:12653172-12653194 ATTATTTTTTTTATTAGAGATGG + Intergenic
1201526504 Y:14941517-14941539 TTTCTGTTTTGTAATAAATAAGG + Intergenic
1201726336 Y:17155899-17155921 ATCCTATGTTTTCTTAAACATGG - Intergenic
1201745114 Y:17363500-17363522 ATTCTGTCTCTTATTGCACATGG + Intergenic