ID: 925418164

View in Genome Browser
Species Human (GRCh38)
Location 2:3688176-3688198
Sequence GCATTGGAGGGCCCCCTCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 4, 2: 9, 3: 8, 4: 67}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925418164_925418173 29 Left 925418164 2:3688176-3688198 CCCTTGAGGGGGCCCTCCAATGC 0: 1
1: 4
2: 9
3: 8
4: 67
Right 925418173 2:3688228-3688250 ATTTGTCAAGTTTCTCCAGATGG 0: 1
1: 5
2: 27
3: 250
4: 1414
925418164_925418170 0 Left 925418164 2:3688176-3688198 CCCTTGAGGGGGCCCTCCAATGC 0: 1
1: 4
2: 9
3: 8
4: 67
Right 925418170 2:3688199-3688221 CTGCTTCACCGCCTTTTTGATGG 0: 1
1: 0
2: 2
3: 71
4: 3211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925418164 Original CRISPR GCATTGGAGGGCCCCCTCAA GGG (reversed) Intronic
901498927 1:9639551-9639573 GCATTTCAGGGCCCCCAGAAGGG + Intergenic
901678051 1:10898321-10898343 GGGTCAGAGGGCCCCCTCAAGGG + Intergenic
903220057 1:21864469-21864491 TCTCTGGTGGGCCCCCTCAAGGG + Intronic
904553291 1:31339596-31339618 GCATTGGAGTGCTCCATCAATGG + Intronic
904707483 1:32402303-32402325 GCATCGGAGGCCACCCTCAAGGG - Intergenic
907089017 1:51707332-51707354 GCACCAGAGGGCCCCCTAAAGGG - Intronic
910900460 1:92114994-92115016 GCATCAGAGGGGGCCCTCAAGGG - Intronic
911044809 1:93619629-93619651 GCATGGGAGGGACCTCTGAAGGG - Intronic
912451837 1:109772161-109772183 GCGATGGAGAGCCCCCTCCATGG - Intronic
913227656 1:116714026-116714048 GCATCAGAGGGCCCCCTCAAGGG - Intergenic
913503669 1:119496029-119496051 GAATTGGAAGGCTCCCTCAAGGG - Intergenic
915466392 1:156100826-156100848 CCATTAGAGGGACTCCTCAAGGG - Intronic
922749916 1:228065459-228065481 TCCTTGGAGGACCCCCTCCAAGG - Intergenic
924207210 1:241725597-241725619 GCCTGGGAGGAACCCCTCAAAGG - Intronic
1063224437 10:4002579-4002601 GCCATGGAGGGCCTCCTCACAGG - Intergenic
1068338347 10:55667540-55667562 GCATCGGAGGGCCCGCTCAAGGG - Intergenic
1072091970 10:92137576-92137598 GAATTGGTGGACCCCCTCCAGGG - Intronic
1076040903 10:127247736-127247758 GCATTGTGAGACCCCCTCAAGGG + Intronic
1077595893 11:3531416-3531438 TCATGGGAGGGCCCCCCCATGGG - Intergenic
1086581794 11:88408371-88408393 GCATCAGAAGGCCCCTTCAAGGG - Intergenic
1087942790 11:104120702-104120724 GGAATGGAGGGCCCCCTGCAGGG - Intronic
1089458861 11:118641235-118641257 GCATTGGTGGGCACCCTCGGTGG - Intronic
1092193928 12:6537851-6537873 GCGTCGGAGGGCCCCCTCAAGGG + Exonic
1096182361 12:49557820-49557842 GCACTGGAGAGCCCCCACCAGGG + Exonic
1101252919 12:102952902-102952924 GCCTTGGAGGGCCTGCTCAGGGG - Intronic
1103535776 12:121633038-121633060 GCATGGGAGGGCTGCCTCAGAGG + Intronic
1103955488 12:124574168-124574190 GCACAGGAGGGCCCCATCAAGGG + Intergenic
1105547122 13:21359103-21359125 GTATCGGAGGGCCCCCTCAAGGG + Intergenic
1106388077 13:29307570-29307592 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1115651354 14:35404589-35404611 GCCATGGAGGGCCCCCGCGACGG - Exonic
1118972446 14:70648484-70648506 ACATGGGAGTGCCCCCTCCAAGG + Intronic
1122778258 14:104132559-104132581 GCATTGCAGAACCCCCTCCAGGG + Intergenic
1126398599 15:48245880-48245902 GCTTTCCAGGGCCACCTCAAAGG - Intronic
1127727712 15:61766595-61766617 GCATTCGAGGCCCACCACAATGG + Intergenic
1146938643 17:36828200-36828222 GCATGGGAGGGCCACCTAAGGGG + Intergenic
1156163782 18:34393367-34393389 GACTTTGAGGGCCCTCTCAAAGG - Intergenic
1160527161 18:79544657-79544679 GCAGTGGAGGGCCCCCACCTCGG + Intergenic
1162243556 19:9379211-9379233 CCACTGGACTGCCCCCTCAAGGG - Intronic
1164879018 19:31715186-31715208 GCATCGGTGGAACCCCTCAAAGG - Intergenic
1166969919 19:46559427-46559449 GCATTGGAGGACCCCCTCAAGGG + Intronic
925418164 2:3688176-3688198 GCATTGGAGGGCCCCCTCAAGGG - Intronic
926350081 2:11986264-11986286 CCATTGGAGGGCTTCCTCTAAGG + Intergenic
926411260 2:12605000-12605022 GCCTTGGGGAGCCCCCTCATTGG - Intergenic
926891011 2:17638853-17638875 GCATAGGAGGGCCCCTTCCCAGG + Intronic
927503945 2:23601234-23601256 GACTTGCCGGGCCCCCTCAATGG - Intronic
927721880 2:25388304-25388326 GCATTGGCCGGCCGCCTCCATGG + Exonic
932416018 2:71574355-71574377 ACATACCAGGGCCCCCTCAAGGG - Exonic
937482623 2:122278030-122278052 GCATTGGAGTTTCCCCTCCACGG - Intergenic
946321333 2:218956108-218956130 GCTTTAGAGGGGCCCCTGAAAGG - Intergenic
1170169317 20:13393465-13393487 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1176267742 20:64219515-64219537 GAATTGTAGGGCCCCCTTCATGG + Intronic
1178096708 21:29223070-29223092 GCATTGGAGGGCCCCTTCAAGGG + Intronic
1179908334 21:44435489-44435511 CCATTAGAGGGCACCCTCCACGG + Intronic
1184100673 22:42340420-42340442 GCAGTGGAGGTCCCTTTCAATGG - Intronic
952239033 3:31510850-31510872 CCAGTGGAGGGCTCCCACAATGG - Intergenic
952963746 3:38608515-38608537 GCCTTGGTGGGCCCCCTGAGTGG - Intronic
961814553 3:129542831-129542853 GGATTAGAGGGCCGCCTCAGCGG + Intergenic
962812825 3:138973803-138973825 GCCTTGCTGGGCCCACTCAAGGG + Intergenic
963292196 3:143503461-143503483 GCTTTGGAGGGTCCCCTCAAGGG - Intronic
968749354 4:2379189-2379211 GCATTGGGGGGACCGCTCCAGGG + Intronic
970379518 4:15492917-15492939 GCATCAGAGGGCCCCCTCAAGGG - Intronic
976628051 4:87207877-87207899 ACATCGGAGGGCCCCCTCAAGGG + Intronic
977146392 4:93446253-93446275 GCATTGGAGGGCTGGCACAATGG - Intronic
979642351 4:123023899-123023921 GCCTCGGAGGGCCCCCAGAACGG - Intronic
980234406 4:130086493-130086515 GCACTGGAGGACCCCCTCTTAGG + Intergenic
988840765 5:35081486-35081508 GCATCGGAGGGCCCCTTCATAGG + Intronic
990740614 5:58908832-58908854 GCCATGGAGGGACCCCTCAGTGG + Intergenic
994447885 5:99900855-99900877 GCATTGGAGGTCCTCCTGATAGG + Intergenic
999243560 5:150140982-150141004 GCAATGCAGGGCCCCCTCCCTGG - Intronic
1000300312 5:159950686-159950708 GCATTGGAGTGTCCCCCCAAGGG - Intronic
1001984575 5:176061961-176061983 GCCTCGGAGGGCACCCTCAGAGG + Exonic
1002263052 5:178007583-178007605 GCCTCGGAGGGCACCCTCAGAGG + Intronic
1003404557 6:5817610-5817632 GTATTGGAGGGCCCCCTCAAGGG - Intergenic
1007108379 6:39298629-39298651 GCGTTTGAAGGCCCCATCAACGG - Intergenic
1009895737 6:69746636-69746658 GCATTGGAGGGTCCCTTCAAAGG + Intronic
1010781829 6:79953198-79953220 GCATCAGAGGGCCCCCTCAAAGG - Intergenic
1011071809 6:83393195-83393217 GCGTCAGAGGACCCCCTCAAAGG + Intronic
1012102265 6:95104899-95104921 CCATTGAAGGGCTCCCTAAAAGG - Intergenic
1018658691 6:166065082-166065104 GCATCAGAGGGCTCCCTCTAGGG + Intergenic
1020551778 7:9615770-9615792 GCATCAGAGGGCTCCCTCAAGGG + Intergenic
1035388815 7:158491401-158491423 GGATTGGAGGCTCCCGTCAATGG - Intronic
1049358900 8:142202497-142202519 GCAGGGCAGGGCCCCCTCCATGG + Intergenic
1061202389 9:129145494-129145516 GCCTTGGAGGGCCTCCTTAGGGG - Intronic
1061424218 9:130489077-130489099 GCGTCTGAGGGCCCCTTCAAAGG + Intronic
1186007169 X:5085433-5085455 GCATTGCAGGGCACACTCACAGG - Intergenic
1189276114 X:39787325-39787347 GCATCGGAGGGCCCCCTCAAGGG - Intergenic
1189973394 X:46439899-46439921 GCGTTGAAGGCCCCCCTCAAGGG - Intergenic
1194434655 X:93855760-93855782 TAATTGGAGGGGCCCCTCCAAGG - Intergenic
1199414578 X:147566431-147566453 GCATTGGAGGGCCTCAGTAATGG + Intergenic