ID: 925418675

View in Genome Browser
Species Human (GRCh38)
Location 2:3692707-3692729
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 2, 1: 2, 2: 13, 3: 51, 4: 160}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925418675_925418678 17 Left 925418675 2:3692707-3692729 CCTACAACATGGTGTTGCTGAAC 0: 2
1: 2
2: 13
3: 51
4: 160
Right 925418678 2:3692747-3692769 GTTTCCTCTGGCTGAGTTACAGG 0: 1
1: 0
2: 4
3: 11
4: 111
925418675_925418681 26 Left 925418675 2:3692707-3692729 CCTACAACATGGTGTTGCTGAAC 0: 2
1: 2
2: 13
3: 51
4: 160
Right 925418681 2:3692756-3692778 GGCTGAGTTACAGGGTTTGCAGG 0: 1
1: 0
2: 2
3: 10
4: 176
925418675_925418679 18 Left 925418675 2:3692707-3692729 CCTACAACATGGTGTTGCTGAAC 0: 2
1: 2
2: 13
3: 51
4: 160
Right 925418679 2:3692748-3692770 TTTCCTCTGGCTGAGTTACAGGG 0: 1
1: 0
2: 2
3: 21
4: 205
925418675_925418677 5 Left 925418675 2:3692707-3692729 CCTACAACATGGTGTTGCTGAAC 0: 2
1: 2
2: 13
3: 51
4: 160
Right 925418677 2:3692735-3692757 CTCTGATTTGGTGTTTCCTCTGG 0: 1
1: 3
2: 20
3: 55
4: 262
925418675_925418676 -7 Left 925418675 2:3692707-3692729 CCTACAACATGGTGTTGCTGAAC 0: 2
1: 2
2: 13
3: 51
4: 160
Right 925418676 2:3692723-3692745 GCTGAACAGCAACTCTGATTTGG 0: 2
1: 27
2: 69
3: 69
4: 165
925418675_925418682 27 Left 925418675 2:3692707-3692729 CCTACAACATGGTGTTGCTGAAC 0: 2
1: 2
2: 13
3: 51
4: 160
Right 925418682 2:3692757-3692779 GCTGAGTTACAGGGTTTGCAGGG 0: 1
1: 0
2: 1
3: 7
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925418675 Original CRISPR GTTCAGCAACACCATGTTGT AGG (reversed) Intronic
901799131 1:11697348-11697370 GATCAGCAGCTCCATGTTCTGGG + Intronic
904058395 1:27687118-27687140 GGTCACCTACACCATGTTCTTGG + Intergenic
904275289 1:29379820-29379842 ATTAAGCAGCACCATGCTGTAGG - Intergenic
904426565 1:30427628-30427650 GTTCAGCAGCACCACATTGTAGG + Intergenic
904867105 1:33588667-33588689 GTTTTGTCACACCATGTTGTTGG - Intronic
907982675 1:59499363-59499385 GTCCAGCAAATCCATGCTGTAGG - Intronic
908482100 1:64551338-64551360 GTTCATCAACACTATATTTTAGG - Intronic
911742152 1:101398403-101398425 ATCCAGCAATTCCATGTTGTTGG - Intergenic
911753025 1:101520571-101520593 GTTCAACAGCACCATGTTATAGG - Intergenic
912016288 1:105040679-105040701 ATTCGGCAGCACCATGTTGAAGG + Intergenic
912731344 1:112109053-112109075 GTTGAGCAGCACCATGCAGTAGG - Intergenic
913092932 1:115492212-115492234 GTTCTGCAATACCCTGTTCTGGG - Intergenic
915880371 1:159664796-159664818 GTTCAGCAGCACCATGCAGTAGG - Intergenic
918229868 1:182518431-182518453 GTTCAGCAACATCACACTGTAGG - Intronic
921942195 1:220853730-220853752 GTTCAGCAGCACCATGCTGTAGG - Intergenic
923937656 1:238781381-238781403 GTTCAGCACCATCATGCTGTAGG - Intergenic
1065496570 10:26335410-26335432 GTTTGGCAGCACCATGCTGTAGG - Intergenic
1066456656 10:35578098-35578120 CTTCTGCAACTCCCTGTTGTAGG + Intergenic
1069804693 10:71112980-71113002 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1070040357 10:72772204-72772226 GTTCAGCAGCACCATGCTGTAGG + Intronic
1072772096 10:98150713-98150735 GTTCAGCAGCACCACGCTGTAGG - Intronic
1075229121 10:120657529-120657551 GCTCAGCAACTCCGTGGTGTAGG + Intergenic
1076635315 10:131878530-131878552 GTCCAGCAAAACCAGGTTGGAGG + Intergenic
1076926329 10:133490001-133490023 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1078361318 11:10670072-10670094 GATCAGCAGCACCTTGTTTTTGG + Intronic
1079814007 11:25032349-25032371 ATTTAGCAACACCATGATTTTGG + Intronic
1080192481 11:29568804-29568826 GTTCAGCAGCACTATGCTGTGGG + Intergenic
1080716995 11:34812505-34812527 GTTCAGCAGCACCATACTGTAGG + Intergenic
1081040292 11:38201496-38201518 ATTCAGCAGCATCATGCTGTAGG + Intergenic
1082935428 11:58652094-58652116 GCTCAGCAGCACCATGCTATAGG - Intronic
1086035960 11:82414702-82414724 TTTTAGCAGCACCATGCTGTAGG + Intergenic
1089797090 11:120989573-120989595 TTTCAGCAACACCAGATTGGTGG + Intergenic
1090756415 11:129795461-129795483 TTTCAGCCTGACCATGTTGTAGG - Intergenic
1091865958 12:3837128-3837150 ATTCAGCAACACCACATTGTAGG + Intronic
1092214805 12:6673475-6673497 GTTCAGCCACACCTTCTTGATGG - Intronic
1092496228 12:8997998-8998020 GTTCAACATCCCCATTTTGTTGG + Intronic
1092941391 12:13410465-13410487 GTTTAGCAGCACCATGCTGTAGG + Intergenic
1093142663 12:15527549-15527571 GTTCAGCAGCACCATACTGTAGG + Intronic
1093824210 12:23662534-23662556 GCTCAGCAACCACATTTTGTGGG + Intronic
1094471694 12:30807462-30807484 CTTCAGCAGCACCATGCTGTAGG + Intergenic
1094805875 12:34091297-34091319 TTTCAGCTACACCAGGTTTTAGG - Intergenic
1095381442 12:41598476-41598498 GTTCATTGAAACCATGTTGTTGG + Intergenic
1095777632 12:46026740-46026762 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1096028096 12:48385864-48385886 GTTCAGAAACCCCATCTTGTTGG + Intergenic
1097646236 12:62237908-62237930 GTTCAGCAACACCAAGATGTAGG - Intronic
1098138272 12:67425992-67426014 GATCAGCAAGACGATGTAGTTGG - Intergenic
1101364359 12:104058000-104058022 GTTCAGCAGCACCACACTGTAGG - Intronic
1103850827 12:123932087-123932109 GTTCAGCCAGTACATGTTGTGGG + Exonic
1105981963 13:25526677-25526699 GCTTAGCAGCACCATGCTGTAGG - Intronic
1106582827 13:31032408-31032430 CTCCAACAACACCATGTTGAAGG + Intergenic
1107793841 13:44030002-44030024 GCTGAGCAGCACCATGTGGTTGG + Intergenic
1108769413 13:53680266-53680288 GTTCAGCAGTACCATGCTGTAGG - Intergenic
1109362711 13:61316845-61316867 GTTCAGCAGCACCATGTGGTAGG - Intergenic
1109679615 13:65733127-65733149 GTTCAGCAACACCATATGACAGG + Intergenic
1113601911 13:111575558-111575580 CCTCAGCAACACCATGCGGTTGG + Intergenic
1113657309 13:112075260-112075282 GTTTAGCAACCCCGTGTTTTAGG + Intergenic
1115279675 14:31647575-31647597 GTTCAGCAGCACCACATTGTAGG - Intronic
1116018537 14:39433660-39433682 GATAAACCACACCATGTTGTTGG - Intergenic
1116745597 14:48814591-48814613 GTTCAGCAGCACTATGCTGCAGG + Intergenic
1117833267 14:59776115-59776137 GCTCAGCAACATCATAATGTTGG - Intronic
1118547346 14:66906183-66906205 GTTCAGCAGTACCACGCTGTAGG - Intronic
1119684258 14:76618514-76618536 GTTCTGCGGCATCATGTTGTAGG + Intergenic
1125365537 15:38911479-38911501 GTTCAGCAGCAGTATGGTGTAGG - Intergenic
1126269184 15:46792879-46792901 GTTCAGTAACACTATGCTGCAGG + Intergenic
1127188079 15:56500851-56500873 GTTCAGCAGCATCGTGCTGTAGG + Intergenic
1128964884 15:72048834-72048856 ATTCATGAACACCATGCTGTTGG + Intronic
1130172966 15:81535717-81535739 GTTCAGCAGCTCCAGGCTGTAGG + Intergenic
1130895029 15:88163270-88163292 GCTCAACAACACCAGGTTGCTGG - Intronic
1131944103 15:97600203-97600225 ACTCAGCATCACCATATTGTGGG - Intergenic
1132248260 15:100314737-100314759 GTTCAGAAACACCAAGTTATTGG + Intronic
1133083343 16:3341762-3341784 GTTCACCAACCCCATATTTTAGG + Intergenic
1135202366 16:20449401-20449423 GTTCAGCAACTTCATTTTGCTGG - Intergenic
1135216738 16:20578465-20578487 GTTCAGCAACTTCATTTTGCTGG + Intergenic
1136099130 16:27980349-27980371 CCTCAGCAACACCATCTGGTGGG - Intronic
1139047175 16:63076056-63076078 GTTCAGCAGCACCACAGTGTAGG - Intergenic
1141783482 16:86181599-86181621 GTTCAGCAACAGCAGGCTGAGGG - Intergenic
1141857105 16:86690884-86690906 GTGAGGCAAGACCATGTTGTGGG - Intergenic
1144065608 17:11621602-11621624 GTTCAGCATCACCATGTGCCAGG + Intronic
1144654193 17:17025039-17025061 TTTCAGCAGGACCATGTGGTTGG - Intergenic
1144732390 17:17536312-17536334 GTTCAGGAACAGCATGTGGCAGG - Intronic
1144853294 17:18254783-18254805 GTTCAGCACCAGCATGTTCTTGG + Exonic
1149636273 17:58172488-58172510 GTCCAGCAGCACCATGCTGTAGG + Intergenic
1149949355 17:60968732-60968754 GTTCAGCAGCACCATGTAGTAGG - Intronic
1150616301 17:66775110-66775132 CATCAGCACCACCATCTTGTAGG - Intronic
1151756690 17:76079306-76079328 GTTCAGCATTACCTTGCTGTTGG + Exonic
1152511059 17:80788877-80788899 GCTCAGCAACACTCTGATGTAGG + Intronic
1155113702 18:22742621-22742643 GTTCAGCAGCACCACACTGTAGG + Intergenic
1155270285 18:24134933-24134955 GTTTTGCAACACCATCCTGTAGG + Intronic
1155978007 18:32152761-32152783 GTTCAGCAGCACCACACTGTAGG - Intronic
1157813134 18:50711901-50711923 GATCACCAGTACCATGTTGTGGG + Intronic
1157917472 18:51680319-51680341 GTTCAGCACCACCAGGCTGTAGG + Intergenic
1158443388 18:57497532-57497554 GTTCACCAACTCCCTGTTCTTGG + Intergenic
1162265753 19:9572560-9572582 GTTCAGGAGCACCATACTGTAGG + Intronic
1162763117 19:12900279-12900301 GCTCAGACACACCATGTTATAGG + Intronic
1164726507 19:30469072-30469094 GGTCAACAGCACCATGTTGCAGG - Intronic
1165201990 19:34152182-34152204 ATGAAGCAACACAATGTTGTAGG + Intergenic
1165566185 19:36730293-36730315 GTTCAGCAGCAGCATGCTGTAGG + Intronic
1166623122 19:44322856-44322878 GTTCAGCATCACTATACTGTAGG - Intergenic
925418675 2:3692707-3692729 GTTCAGCAACACCATGTTGTAGG - Intronic
926132469 2:10312937-10312959 GTTGAGAAGCACCATGATGTTGG - Intronic
926610848 2:14945083-14945105 GTTCAGCAGCACCAAGCTGCCGG + Intergenic
926875397 2:17471139-17471161 GTTCAGCAGCACAATGCTGTAGG - Intergenic
927523830 2:23719904-23719926 GTTAAGCAGCGCCATGCTGTAGG + Intergenic
930177715 2:48316884-48316906 TTACAGCAACACCATTTTATTGG + Intronic
930858753 2:56047228-56047250 GTTCAGCAGCACCTTGCTGGTGG + Intergenic
931324265 2:61202103-61202125 CTTCAGCAAAACCATCTTATTGG - Intronic
932609056 2:73185187-73185209 GTTCAGCAGCACCATCCTCTTGG - Intergenic
933902231 2:86858340-86858362 GGACAGCATCACCATCTTGTTGG + Exonic
935778312 2:106490928-106490950 GGACAGCATCACCATCTTGTTGG - Intergenic
939080410 2:137654297-137654319 GTTCAGCAGTACCACGCTGTAGG - Intronic
940532013 2:154889850-154889872 GTTCGGCAGCACCACATTGTAGG - Intergenic
940788170 2:158003989-158004011 CTTCAATAACACCATGTTGTTGG - Intronic
941477870 2:165970774-165970796 GCTCACCAGCACCATGCTGTAGG + Intergenic
941589913 2:167406761-167406783 ACTCAGCAACACCATGCTGTCGG + Intergenic
942284068 2:174396121-174396143 TTTCAGAAACATCATATTGTTGG - Intronic
943102479 2:183505172-183505194 GTTCAGCAGCATCATGCTGTTGG - Intergenic
944277691 2:197858002-197858024 GTTCAACAGCCCCATGATGTAGG - Intronic
947305386 2:228740634-228740656 GTACAGCAGCACCATGCTCTAGG - Intergenic
948739962 2:240039849-240039871 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1170432993 20:16294416-16294438 GCTCAGCAACACCCCTTTGTTGG - Intronic
1170863492 20:20130774-20130796 GTTCAGCAGCACCACACTGTAGG - Intronic
1171508347 20:25658171-25658193 GTTCACCAGCACCATGCTGTAGG - Intergenic
1172792983 20:37519087-37519109 GTTCAGCCACTCCATGTTCATGG - Exonic
1174172023 20:48623726-48623748 GTCCGGCACGACCATGTTGTGGG + Intergenic
1174271311 20:49371373-49371395 GGCCAACAACACCATGCTGTTGG + Exonic
1176220251 20:63966194-63966216 GGTCAGCAGCACCATTTTGCAGG + Exonic
1177414663 21:20778133-20778155 GTCCAGGAACCCCATGTTCTTGG - Intergenic
1178582925 21:33851092-33851114 GTTCAGAAACAACATGTGGAAGG - Intronic
1180607975 22:17075547-17075569 GTTAAGCAGCACCATGTGGTAGG - Intergenic
952425797 3:33173669-33173691 GTTCAGTAACATCATGGTGCTGG + Intronic
954457809 3:50609467-50609489 GTTCAGTAACACCATATTCTTGG + Intronic
955395226 3:58552470-58552492 GTTCAGCAGCACCATGCTGTAGG - Intergenic
956380514 3:68659983-68660005 GTTCAGCATCAGCATTTTGGGGG + Intergenic
959759951 3:109949545-109949567 CTTCAGTAACACCATGTTTCTGG - Intergenic
959766460 3:110036142-110036164 GTTCAGCCACACTATGCTATAGG - Intergenic
961236442 3:125372181-125372203 TATCAGAAAGACCATGTTGTAGG - Intronic
962247860 3:133812289-133812311 GTTCATCACCACCATCTTGTGGG - Intronic
962497928 3:135961580-135961602 GTTCAGCAGCAACATGATGTAGG - Intergenic
962763309 3:138538286-138538308 GTTCAGCAGCACCACACTGTAGG + Intronic
963010766 3:140768193-140768215 TTTCAACAACACCATGAGGTTGG + Intergenic
964612206 3:158626975-158626997 GATCAGCTGCAACATGTTGTCGG - Intergenic
964803543 3:160581213-160581235 GCTCAGCAGCAACATGCTGTAGG + Intergenic
965867386 3:173221343-173221365 GTTCAGCAGCACCATATAGTAGG - Intergenic
965884629 3:173429869-173429891 GTTCAGCAGCAACATGCTTTAGG - Intronic
966260511 3:177973113-177973135 CTTCAGCAACCCCATTTTATTGG - Intergenic
966456075 3:180117837-180117859 ATGCAGCCACACCATGTTGTTGG - Intergenic
966456162 3:180118195-180118217 ATGCAGCCACACCATGCTGTGGG - Intergenic
968205341 3:196794734-196794756 GTTCAGCAACACCATGTTGTAGG + Intronic
968719086 4:2186380-2186402 GGTCAGTAGGACCATGTTGTAGG + Intronic
969473823 4:7409399-7409421 GTTCAGCAGCACCATGCTGTTGG - Intronic
973950425 4:56007449-56007471 GTTCAGTAACAACATGCTGTAGG - Intronic
974964063 4:68738235-68738257 GCTTAGCAACAGCATGCTGTAGG - Intergenic
974977573 4:68909525-68909547 TTTCAGCAACCCCATGAGGTCGG + Intergenic
975944722 4:79692033-79692055 GTTCATCCTCACCTTGTTGTGGG + Intergenic
976833890 4:89348173-89348195 GTTCAGCAGTATCATGCTGTAGG - Intergenic
978888217 4:113791234-113791256 GTTCAGCAGCCCTATGCTGTAGG + Intergenic
979380796 4:120004189-120004211 GTTCAGCAGCACCACATTATAGG + Intergenic
980500203 4:133641143-133641165 ATTCAGAAAAAACATGTTGTGGG + Intergenic
980868045 4:138576758-138576780 ATTCAGCAGCACCATGCTGTAGG + Intergenic
981159554 4:141481723-141481745 GTTCAGCAGCAGTATGCTGTAGG - Intergenic
981900692 4:149858378-149858400 ATTCAGCAGCACCATGCTGTAGG + Intergenic
983738431 4:171093115-171093137 ATTCAGCAAAAGCATGATGTTGG + Intergenic
984552814 4:181181218-181181240 GTACAGTAACACAATGTGGTTGG - Intergenic
986923583 5:12717804-12717826 TTTCAGCTCCACCATGTGGTGGG - Intergenic
988499175 5:31769801-31769823 GCTCATCAACACCATCTTGATGG + Intronic
989256302 5:39369294-39369316 CTCCAGCAAGACCATGGTGTGGG - Intronic
995278792 5:110308861-110308883 GTTTAGCAGCACCATACTGTAGG + Intronic
995553124 5:113300016-113300038 GTGCACCAACACCATGCTGTGGG + Intronic
995827534 5:116317395-116317417 GTTCAACAGCAACATGCTGTAGG - Intronic
996113454 5:119592340-119592362 GTTCTGCAGCACCATGCTGTAGG + Intronic
998580700 5:143372416-143372438 GTTCAGCATCTCCATGCTGTAGG - Intronic
999412402 5:151363277-151363299 GTTCAGCAGCACCACACTGTAGG - Intergenic
1000806111 5:165794824-165794846 GTTCATCAGAACCATGCTGTGGG - Intergenic
1002857250 6:1048930-1048952 GGTCATCAACACCTTGTTGTGGG + Intergenic
1003079623 6:3010744-3010766 GTTCAGCAGCACCACACTGTAGG + Intronic
1003561174 6:7181956-7181978 TTCCATCAACACCATGATGTCGG + Exonic
1015216856 6:130760076-130760098 ATTCAGCAGCACCATGCTATAGG + Intergenic
1015736177 6:136402457-136402479 GTGCAGGAGCACCGTGTTGTGGG - Intronic
1016263771 6:142207445-142207467 GTTCAGCAGTACCATGCTGTAGG + Intronic
1016615356 6:146041622-146041644 GTTCAGCAGCACCACATTGTAGG - Intronic
1017934132 6:158989534-158989556 GTTCAGCAGCACCACATTGTAGG - Intronic
1021616339 7:22506562-22506584 GAACAGCAACTCCATGTTGGTGG + Intronic
1021771830 7:24010811-24010833 GTTCAGCAGCACCACACTGTAGG - Intergenic
1022926132 7:35057774-35057796 GCACAGCAACTCCATGTTGGTGG + Intergenic
1024996395 7:55275943-55275965 GCTCTGACACACCATGTTGTGGG + Intergenic
1025040637 7:55641525-55641547 GTTCAGTAACACCATGCTGTAGG - Intergenic
1028560362 7:92168460-92168482 ATTCAGCAGCACCATGCTGTAGG + Intronic
1029824142 7:103172461-103172483 GCACAGCAACTCCATGTTGGTGG + Intergenic
1032466008 7:132145536-132145558 GTTCAACCAAACCGTGTTGTTGG - Intronic
1033942717 7:146675975-146675997 GTTCAGTCACATAATGTTGTTGG + Intronic
1034595156 7:152182445-152182467 GTTCAGATACACCAAGTAGTGGG - Exonic
1037282772 8:17261814-17261836 ATTCAGCAGCTCCATGTTGTAGG - Intronic
1037552406 8:19987244-19987266 ATTCAACAACATCATGTTGGTGG + Intergenic
1037758253 8:21725314-21725336 GGTCAGCAACAGCATGCTGAAGG + Intronic
1038347231 8:26743532-26743554 GTTTAGCAGCACCAGGTGGTTGG - Intergenic
1039769018 8:40664094-40664116 TATCAGCAACACCTTGTTTTGGG + Intronic
1040774350 8:51021295-51021317 GTTCAGCATCACCATGCTATAGG + Intergenic
1043033125 8:75164249-75164271 GTTCGGCAGCACCATGCTGAAGG - Intergenic
1047913838 8:129560423-129560445 TTACAACAACACCATGATGTAGG - Intergenic
1048019184 8:130522679-130522701 GATCAGCAAAACCATGTAGGAGG - Intergenic
1048169622 8:132093499-132093521 GTTGAGCAACGGCAAGTTGTTGG + Intronic
1048361668 8:133702550-133702572 GTTCTGCAACACAATTTTATGGG - Intergenic
1049953590 9:670597-670619 GTTCGGCAGCACTATGCTGTAGG - Intronic
1050138966 9:2497600-2497622 GTTCAGAAACACAATGGTGCAGG - Intergenic
1050435708 9:5607862-5607884 GTTTAGCAACATCATGTTGGTGG - Intergenic
1050841821 9:10158979-10159001 GTTCAGCAGCACCATGTTGTAGG + Intronic
1052689544 9:31800037-31800059 GTTCAGCAGCACCATGCTATAGG + Intergenic
1052734671 9:32328812-32328834 GTTCAGCAGCACCGTGCTGTAGG + Intergenic
1054836804 9:69683914-69683936 GTTAAGGAATAACATGTTGTGGG + Intergenic
1055319528 9:75068622-75068644 GTTCTGCGACACCAAGTTCTAGG - Intronic
1057296303 9:93845023-93845045 GTTCACCAGCACCATGCTGTAGG - Intergenic
1057439393 9:95072037-95072059 GTTCAGTGACATCATGTTGGTGG + Intronic
1060005084 9:119992654-119992676 GCTAAGAAACACCATGTTGAAGG - Intergenic
1060166955 9:121425315-121425337 GTTCAGCAGCACCACGCTGTGGG + Intergenic
1060302965 9:122386657-122386679 GTTCAACACCTCCATGTTGGTGG + Exonic
1060729960 9:126030944-126030966 ATTCAGCCACACCTTGTGGTTGG + Intergenic
1060737143 9:126073281-126073303 GGTCATCATCACCATGTTCTTGG - Intergenic
1186858409 X:13647615-13647637 GTGCAGCAACTCCATGTACTAGG + Intergenic
1187941406 X:24386331-24386353 GTTCAGCAGCACCGTGTTGTAGG - Intergenic
1188479026 X:30618444-30618466 GCTCAGCAGCACCATGCTATAGG + Intergenic
1192760769 X:74094172-74094194 TTTCAGCAGCACCATGCTGGAGG + Intergenic
1193178247 X:78420874-78420896 GTTCAGCACCACCATGTTGTAGG + Intergenic
1194530037 X:95035917-95035939 GTTCATCAGCACCATGCTGTAGG - Intergenic
1194613656 X:96074847-96074869 ATTCAGCAGCATCATGTTGTAGG + Intergenic
1195073568 X:101304636-101304658 GTTCAGCAGCATCATGCTGTAGG - Intergenic
1196067988 X:111487082-111487104 TTTCAGCCACACCATGCTATTGG + Intergenic
1199194821 X:145016010-145016032 ATTCAGCAGCACCATGCTATAGG + Intergenic
1199245045 X:145593953-145593975 GTTCAGCAGCAGCATGCTATAGG + Intergenic