ID: 925419988

View in Genome Browser
Species Human (GRCh38)
Location 2:3703865-3703887
Sequence GCGCCTCGAAGGTGGCCGCG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 56}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925419988_925419994 4 Left 925419988 2:3703865-3703887 CCGCGCGGCCACCTTCGAGGCGC 0: 1
1: 0
2: 0
3: 7
4: 56
Right 925419994 2:3703892-3703914 GGAGCAGCTCACGGAGCAGGTGG 0: 1
1: 1
2: 7
3: 42
4: 421
925419988_925419992 -5 Left 925419988 2:3703865-3703887 CCGCGCGGCCACCTTCGAGGCGC 0: 1
1: 0
2: 0
3: 7
4: 56
Right 925419992 2:3703883-3703905 GGCGCTGCTGGAGCAGCTCACGG 0: 1
1: 0
2: 3
3: 40
4: 325
925419988_925419995 17 Left 925419988 2:3703865-3703887 CCGCGCGGCCACCTTCGAGGCGC 0: 1
1: 0
2: 0
3: 7
4: 56
Right 925419995 2:3703905-3703927 GAGCAGGTGGACGTCCCGTTCGG 0: 1
1: 0
2: 0
3: 8
4: 40
925419988_925419993 1 Left 925419988 2:3703865-3703887 CCGCGCGGCCACCTTCGAGGCGC 0: 1
1: 0
2: 0
3: 7
4: 56
Right 925419993 2:3703889-3703911 GCTGGAGCAGCTCACGGAGCAGG 0: 1
1: 0
2: 6
3: 40
4: 338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925419988 Original CRISPR GCGCCTCGAAGGTGGCCGCG CGG (reversed) Exonic
903982712 1:27201431-27201453 CCGCCTCGAAGGTGACCCGGCGG + Intergenic
904563137 1:31412163-31412185 GTGCCTCGAAGCTGGCCCCAGGG - Intronic
905137144 1:35808404-35808426 GCGCCTCCATGGCGGCGGCGGGG - Exonic
907767401 1:57424243-57424265 GCGCCCCGGAGGGAGCCGCGAGG - Intronic
914678640 1:149923555-149923577 GGGCCTCGAAGTGGGCCTCGAGG + Exonic
916057720 1:161079611-161079633 GCGCCTGGAAGCTGCCGGCGGGG + Exonic
920418225 1:205812834-205812856 GCGCCTGGCAAGTGGCAGCGTGG + Exonic
922933555 1:229407979-229408001 GCGCCTTGGAGCTGACCGCGTGG - Intergenic
924527280 1:244863753-244863775 GGGCCGCCAAGGAGGCCGCGGGG - Exonic
1065077768 10:22098215-22098237 GCGCCTCCAATGTGGCCTCTTGG + Intergenic
1085396162 11:76208191-76208213 GCGCCACGCAGGTGGCGTCGCGG - Intronic
1089169192 11:116500498-116500520 GCAACTCGAAGGTGGCCGGGAGG - Intergenic
1113438510 13:110310995-110311017 GGGCCTGAAAGGTGGCCGGGAGG + Intronic
1113724312 13:112587429-112587451 GCGCCGCGGAGGTGGATGCGGGG - Intronic
1114269594 14:21092621-21092643 GCGCAGCGGAGGTGGCCGCCAGG + Exonic
1122536195 14:102464890-102464912 GCGCCTGGCAGGTGGCAGAGTGG + Intronic
1132499957 16:280819-280841 GCGCCCCCAAAGTTGCCGCGGGG - Intronic
1136413701 16:30091349-30091371 GGGCCTCGAAGGGGTCCGAGAGG + Intronic
1136626354 16:31464553-31464575 GCTCCTCGATGGCGGCGGCGGGG - Exonic
1140223081 16:73058128-73058150 GCGCCTCCAAACTCGCCGCGCGG + Intronic
1142350139 16:89575956-89575978 GCGCCTCGAAGGTGGAGCTGCGG + Exonic
1142396579 16:89835377-89835399 GGGCCTGGAAGGTGGCAGTGAGG - Intronic
1143485627 17:7252134-7252156 ACGCGCAGAAGGTGGCCGCGGGG + Intronic
1147563333 17:41522059-41522081 GCCCCTGGAATGTGGCTGCGGGG - Exonic
1152876531 17:82789645-82789667 GTGCCTCTAAGGTGACTGCGTGG - Intronic
1158478995 18:57803801-57803823 GCGCGTCAAAGTTCGCCGCGTGG + Intergenic
1160025387 18:75211645-75211667 GCGCCGGGAAGCGGGCCGCGCGG + Intronic
1160733490 19:651582-651604 GGGCCCCGGGGGTGGCCGCGAGG - Intronic
1160809944 19:1008988-1009010 TCGCCCCGAAGCCGGCCGCGGGG + Intronic
1162392015 19:10395589-10395611 GCGCCTCGAGCGCGGCCGGGCGG + Intronic
1163304846 19:16471695-16471717 TCGCCTCGCCGGTGCCCGCGAGG + Intronic
1166039013 19:40191313-40191335 GCGGCCCGAGGCTGGCCGCGGGG + Intergenic
925419988 2:3703865-3703887 GCGCCTCGAAGGTGGCCGCGCGG - Exonic
934978648 2:98823000-98823022 GCGCCTCTGAGGTGGCGGCGGGG + Exonic
937338737 2:121077505-121077527 GCCGCTCGAGGGTGGCCCCGTGG + Intergenic
945188948 2:207166626-207166648 GCGCGGCGCAGGGGGCCGCGGGG + Intronic
947122872 2:226835871-226835893 GTGGCTCTAAGGGGGCCGCGAGG - Intronic
947669170 2:231925871-231925893 GAGCGGCGAAGGCGGCCGCGTGG - Intronic
1174203446 20:48823203-48823225 GCTCCTCGAAGGTCTCCCCGTGG - Intronic
1180184376 21:46132183-46132205 GCGCCTCGTGGATGGCCGTGAGG - Exonic
1180847915 22:18994455-18994477 GCACCTCGAAGCTGGCCGTGTGG - Intergenic
1181862355 22:25828863-25828885 GCTCCTCAAAGGTGGCCGCCCGG - Exonic
1184234183 22:43174291-43174313 GCGCCGGGCAGGTGGCCCCGAGG - Exonic
1185268620 22:49918273-49918295 GCGCTTCGAAGGACGCCGCCGGG - Exonic
953326056 3:42013537-42013559 GCGGCCCGCAGGTGGCGGCGCGG + Intergenic
955340709 3:58123110-58123132 CGGCCTCGAAGGTGGTCTCGTGG + Exonic
961736575 3:129005443-129005465 GGGCCTGGAAGGTGGCAGCAAGG + Intronic
970195116 4:13544593-13544615 GGGCCTCTAAGGTGGGGGCGAGG - Exonic
979349681 4:119629029-119629051 GCGGCTGGAAGGAGGCCGCGCGG + Intergenic
979455465 4:120922290-120922312 GCGCCACGTAGGTGGCGGCGGGG - Intronic
979468618 4:121070848-121070870 GCGCCCCGAAGGGGGCCAGGAGG + Intronic
990954878 5:61331786-61331808 GCGCCTCGTGGGTCGCAGCGGGG - Intergenic
1001381334 5:171308555-171308577 GTGTCTCCAAAGTGGCCGCGAGG + Exonic
1001831618 5:174793886-174793908 GCTTCTCGCAGGCGGCCGCGCGG - Intergenic
1006933099 6:37699051-37699073 CCGCCTCGAAGGGGCCCTCGCGG + Intronic
1019517030 7:1444640-1444662 GCGCCTGGCAGGTGAGCGCGTGG - Exonic
1022286151 7:28957365-28957387 GCGGTGCGAAGGTGGCCGCGTGG + Exonic
1032578573 7:133081895-133081917 CCGCCTCGAAGGTGACCCGGCGG + Exonic
1036910582 8:12754709-12754731 GCGCCTCGCAGGCGGCGGCCAGG + Exonic
1041107876 8:54459251-54459273 GGGCCCCGAGGGCGGCCGCGTGG + Exonic
1041166339 8:55096359-55096381 CCGCCTTGAAGGTGGCCTAGAGG - Intergenic
1060662824 9:125414361-125414383 GTCCCTCGCAGGTGGCCCCGTGG + Intergenic
1060969145 9:127728201-127728223 GGGCCTCGAAGGGGGCCCCAAGG - Intronic
1062592706 9:137281256-137281278 GCACCGCGAAGGTGGAGGCGGGG + Exonic