ID: 925422160

View in Genome Browser
Species Human (GRCh38)
Location 2:3721452-3721474
Sequence TTTTAGTTGGATATTTTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 562
Summary {0: 1, 1: 0, 2: 1, 3: 52, 4: 508}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925422155_925422160 18 Left 925422155 2:3721411-3721433 CCTGTAGTGAAGTCCTTTCCTGA 0: 1
1: 0
2: 0
3: 9
4: 98
Right 925422160 2:3721452-3721474 TTTTAGTTGGATATTTTGTGTGG 0: 1
1: 0
2: 1
3: 52
4: 508
925422154_925422160 21 Left 925422154 2:3721408-3721430 CCTCCTGTAGTGAAGTCCTTTCC 0: 1
1: 0
2: 0
3: 7
4: 138
Right 925422160 2:3721452-3721474 TTTTAGTTGGATATTTTGTGTGG 0: 1
1: 0
2: 1
3: 52
4: 508
925422158_925422160 0 Left 925422158 2:3721429-3721451 CCTGATGCTAGATTCTCGCAGGC 0: 1
1: 0
2: 0
3: 2
4: 32
Right 925422160 2:3721452-3721474 TTTTAGTTGGATATTTTGTGTGG 0: 1
1: 0
2: 1
3: 52
4: 508
925422156_925422160 5 Left 925422156 2:3721424-3721446 CCTTTCCTGATGCTAGATTCTCG 0: 1
1: 0
2: 0
3: 3
4: 99
Right 925422160 2:3721452-3721474 TTTTAGTTGGATATTTTGTGTGG 0: 1
1: 0
2: 1
3: 52
4: 508

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925422160 Original CRISPR TTTTAGTTGGATATTTTGTG TGG Intronic
901283062 1:8054707-8054729 TTTTATTTGGATATGTTTTCTGG + Intergenic
901293085 1:8139900-8139922 TTTTCGTTGGTTCTTTTGGGGGG - Intergenic
902266458 1:15270290-15270312 TTTTATTTTAATATTTTGGGTGG + Intronic
902452635 1:16507198-16507220 TTTTAGATCGAGATTCTGTGGGG - Intergenic
902472695 1:16659861-16659883 TTTTAGATAGAGATTCTGTGGGG - Intergenic
902486109 1:16747582-16747604 TTTTAGATAGAGATTCTGTGGGG + Intronic
902499847 1:16903007-16903029 TTTTAGATAGAGATTCTGTGGGG + Intronic
903076418 1:20770694-20770716 TCTTAATTGGATATTTTTTGGGG - Intronic
903872056 1:26442985-26443007 TGTTAGTTAGATATCTTGGGTGG + Intronic
904516947 1:31063598-31063620 TTTTATTTGTATAATTTGTGAGG - Intronic
909029147 1:70518545-70518567 TTTTAATTGGATTATTTGTGGGG - Intergenic
910288567 1:85579580-85579602 TTCAAGCTGGACATTTTGTGGGG - Intergenic
910469157 1:87532536-87532558 TTTTTGTTGGTTATTTTTGGAGG + Intergenic
910735464 1:90449898-90449920 TTCTAGTTGTTTATGTTGTGAGG - Intergenic
912004985 1:104887138-104887160 TTTTATTTGAACATTTAGTGGGG - Intergenic
912306194 1:108570135-108570157 TTTAACTGGGATTTTTTGTGGGG + Intronic
913263228 1:117020050-117020072 ATCTAGTTGCATCTTTTGTGTGG + Intronic
914004692 1:143722096-143722118 TTTTAGATAGAGATTCTGTGGGG - Intergenic
914933091 1:151951713-151951735 TTTTGGTTCAATATTTTGTTTGG + Intergenic
914978780 1:152393362-152393384 TTTTAGTTGTCTGTTTTATGAGG + Intergenic
915547843 1:156612381-156612403 TTTTGTTTGGATATTTTTTTTGG + Intergenic
916304580 1:163315127-163315149 TTTTATTTGAATAGTTTTTGGGG - Intronic
916671132 1:167021433-167021455 TTTTAATGGTATCTTTTGTGGGG + Intronic
918566891 1:185944426-185944448 TTTTACTTCAATATTTTTTGGGG - Intronic
918569963 1:185978677-185978699 TTTTATTTTTATATTTTGGGTGG + Intronic
918872951 1:190000203-190000225 ATCTAGATCGATATTTTGTGAGG - Intergenic
919043956 1:192427453-192427475 ATATATTTGTATATTTTGTGTGG - Intergenic
919064822 1:192681112-192681134 TTTGAGATGGATATTTGGGGAGG - Intergenic
919218231 1:194589009-194589031 TTTTAGTTGATTTTTATGTGTGG - Intergenic
919655584 1:200194241-200194263 TCTTAGTTGGACATTTTGTTTGG + Intergenic
919888044 1:201949446-201949468 TTTTAGTTAGGTATGTTGGGTGG + Intergenic
921519480 1:216141802-216141824 TTTCAGTTGGATATTATGTCTGG - Intronic
921755625 1:218852864-218852886 TTTCAGTTGGAAATCTTGTGAGG - Intergenic
922651353 1:227341778-227341800 TTAAAGTTGGACATATTGTGAGG + Intergenic
923029186 1:230233788-230233810 TTTGAGTCTCATATTTTGTGTGG - Intronic
923838542 1:237642190-237642212 TTTTGGTTGGGTTTTTTGTGTGG + Intronic
923906661 1:238392549-238392571 TTTTAGTTTGATTATTTGTCAGG - Intergenic
924412494 1:243820276-243820298 CTTTAGATGGAATTTTTGTGGGG - Intronic
1062884813 10:1008470-1008492 CTTGAGTTGGTTATGTTGTGAGG + Intronic
1063082815 10:2784196-2784218 TTTTAGTTGTTTTTTTTGGGGGG - Intergenic
1063397232 10:5700765-5700787 TTTTAATTGGATTATTTGTGGGG + Intronic
1063764120 10:9117431-9117453 TTTTTGTTGTTTTTTTTGTGGGG - Intergenic
1063961715 10:11311449-11311471 GTTTACTTGTATATTTTGTGGGG - Intronic
1064673908 10:17742527-17742549 ATTTAGTTTGATATTTAGTGAGG - Intergenic
1064790902 10:18957105-18957127 CTTTAGCTGAACATTTTGTGAGG - Intergenic
1064912607 10:20419173-20419195 TTTTGGTTGAATATTTTGGAAGG - Intergenic
1066012344 10:31206482-31206504 TTTTTTTTGGTTATTTTTTGAGG - Intergenic
1066303264 10:34115667-34115689 TTATAATTGTATAATTTGTGGGG - Intronic
1067260477 10:44685471-44685493 TTCTAGTTGAATATTTTCTCTGG - Intergenic
1067319136 10:45200384-45200406 TTTTATTTGTATATTTTATTTGG + Intergenic
1068136967 10:52959213-52959235 CTTTAGTTGTATATTCTGTGTGG + Intergenic
1068156171 10:53201608-53201630 TTTTCTTTGGATAGTTTTTGTGG + Intergenic
1068203711 10:53819218-53819240 CTTTGGTTGGATATTTTATAAGG - Intronic
1068323828 10:55457268-55457290 TTTTAGTTGATTATTCTGTGTGG - Intronic
1068337669 10:55658424-55658446 TAATAGTTGGATTTTTTGTTTGG - Intergenic
1068358078 10:55937561-55937583 TTTTATTTGCATAATTTTTGTGG - Intergenic
1068369517 10:56095207-56095229 TTTTGGATGGGTTTTTTGTGGGG + Intergenic
1068437089 10:57006306-57006328 TTTTAAATGGGTATGTTGTGTGG + Intergenic
1069993787 10:72330456-72330478 TTGAAATTGCATATTTTGTGGGG - Intergenic
1071211968 10:83352410-83352432 TTTTAGTGCAAAATTTTGTGGGG + Intergenic
1072116184 10:92372460-92372482 TTTTAATTGGATATTTTGTCTGG - Intergenic
1072365071 10:94701213-94701235 TCATTGTTGGATATTTGGTGTGG - Intronic
1072823199 10:98579021-98579043 TTTTAATTGTATATAATGTGGGG + Intronic
1073633678 10:105175472-105175494 TATTAGTTGGGTTTTTTGTTTGG - Intronic
1077789898 11:5427190-5427212 TTTGAGTTTCATATTTTATGTGG + Intronic
1077940661 11:6837874-6837896 TTTGAGTTGATTATTGTGTGTGG + Intergenic
1079830757 11:25264576-25264598 TGAAAGTTGGATTTTTTGTGGGG - Intergenic
1080328145 11:31102266-31102288 TCTTAGTTGGGAAGTTTGTGAGG - Intronic
1081258744 11:40931514-40931536 TTTTACTTGGCTTATTTGTGTGG + Intronic
1082921185 11:58496098-58496120 TTTCAGTTTTATATTTGGTGAGG + Intergenic
1085163096 11:74367182-74367204 TCTTAGGTGTATATGTTGTGGGG + Intronic
1085225062 11:74912255-74912277 TTTTAAATGTATATTTTGTCTGG - Intronic
1085797025 11:79551039-79551061 TTTTAATAGGATAATTTCTGGGG + Intergenic
1085968751 11:81561342-81561364 TTTGAGTGGAATATTTTGTCTGG - Intergenic
1086730963 11:90249232-90249254 TTTTAGTTAGATATATGGAGTGG - Intergenic
1087335860 11:96843567-96843589 TTTTAATTAGATACTTTCTGTGG + Intergenic
1088704484 11:112449110-112449132 TTTTTGATGGATATTTTCTCTGG + Intergenic
1088795422 11:113263521-113263543 AATTTGTTGGATATTTTCTGGGG + Intronic
1089250396 11:117155858-117155880 TTTTTGTTTGCTATTTTGGGGGG - Intronic
1089317014 11:117598886-117598908 TTTTAGTGGTATATTTTTTTGGG + Intronic
1089854410 11:121529937-121529959 TTTTATTTAGATTTTTTGGGGGG + Intronic
1090795821 11:130134933-130134955 TTTCTGTTGGATGTTATGTGGGG + Intronic
1092643264 12:10540164-10540186 TTGTAGTTGGATAGTGTCTGTGG - Intergenic
1093631527 12:21415458-21415480 TTTTAGTAGGAGCTTTTGTGTGG + Intronic
1093761909 12:22920405-22920427 TATTAGTGGGAAATTTTGTCTGG + Intergenic
1095371904 12:41477729-41477751 TTTTATTTGGCTGTTTTGTGCGG - Intronic
1095451445 12:42335261-42335283 TTTTAATTTCACATTTTGTGAGG + Intronic
1095528964 12:43161870-43161892 TTTTAGTTAGAACTTGTGTGTGG - Intergenic
1095575303 12:43730877-43730899 TTTTAGTTAGCTATTTTCTTTGG - Intronic
1097152538 12:56989894-56989916 TTTTAGTGGGATTATTTGTGGGG - Intergenic
1097622208 12:61953282-61953304 TTTAAGGTGGTTATTTTGTTTGG + Intronic
1097945265 12:65360663-65360685 TTTTAATGGGATAGCTTGTGTGG + Intronic
1098123005 12:67262885-67262907 TTTTTGGTGTATATTTTGTAGGG - Intergenic
1098630534 12:72716427-72716449 TTTGAGTCTCATATTTTGTGTGG + Intergenic
1099047575 12:77741033-77741055 TTTCTGATGGATAATTTGTGGGG + Intergenic
1099671554 12:85700445-85700467 TTATGGTTGGTTTTTTTGTGGGG - Intergenic
1100272711 12:93041712-93041734 TTTTAGTTGGAAATTGGGGGTGG + Intergenic
1100427037 12:94497242-94497264 TCTAAGTTTCATATTTTGTGTGG - Intergenic
1102810798 12:115822689-115822711 TTTTAGTTGGAAAGTTCTTGAGG - Intergenic
1102946204 12:116990766-116990788 GTTGAGTTGGAAATTTTGAGAGG - Intronic
1104319806 12:127740408-127740430 CTTTAGTTGGGTACATTGTGTGG + Intergenic
1104377430 12:128277404-128277426 TTTTAGTTGAGTATGCTGTGTGG - Intronic
1104570950 12:129925467-129925489 GTTTTGTGGGAAATTTTGTGGGG - Intergenic
1105978041 13:25490590-25490612 TTTTAGTGGGTTTTATTGTGTGG - Intronic
1106008560 13:25795491-25795513 TTTTAGATGTATATTTTTAGTGG + Intronic
1106453643 13:29907936-29907958 CCTTATTTGGATATTTTTTGTGG + Intergenic
1107316680 13:39139680-39139702 TTTTCTTTTGAAATTTTGTGGGG + Intergenic
1107762906 13:43700296-43700318 ATTTAGTGGGATATTTTCTTGGG + Intronic
1108290356 13:48953960-48953982 TTTTAGTTAGATATTTGATTTGG + Intergenic
1108961399 13:56236422-56236444 TTTTCCTTGTATGTTTTGTGAGG - Intergenic
1109094665 13:58097547-58097569 TTTTAGTTGGTTAGTTAGTTTGG + Intergenic
1109129894 13:58571711-58571733 TTTTAGTTGAGTGTTTTATGTGG + Intergenic
1109549844 13:63880251-63880273 TTTTAGTTGGACATTATCTTTGG + Intergenic
1109772315 13:66993144-66993166 TTTTAGTGGGAAATTCTTTGTGG - Intronic
1110604282 13:77412927-77412949 TTTTAAATGCAGATTTTGTGAGG + Intergenic
1110900566 13:80818000-80818022 TTTTAATTTAATATTTTTTGTGG - Intergenic
1111059652 13:82999496-82999518 CTTTAGTTGGTTATGTTGTGTGG + Intergenic
1111556879 13:89892418-89892440 TTTTCCTTGGTCATTTTGTGTGG - Intergenic
1112096397 13:96136603-96136625 TTATAGTTCGAGATTTGGTGGGG + Intronic
1112140783 13:96639591-96639613 TGTTATTTGGATATATTGTGTGG + Intronic
1112432698 13:99366088-99366110 TTTTAGATTTATCTTTTGTGGGG + Intronic
1112606818 13:100914470-100914492 TTTTACATGGATATGTTGTGTGG + Intergenic
1112804666 13:103150683-103150705 ACTGAGTTGTATATTTTGTGAGG + Intergenic
1114536018 14:23423179-23423201 ATTTCTTTGGAAATTTTGTGAGG - Intronic
1114845998 14:26322794-26322816 TTTTATCTGGATGTATTGTGAGG - Intergenic
1115232266 14:31173828-31173850 TTTTAGGTGGATTTTATCTGTGG - Intronic
1115357281 14:32461552-32461574 CTTTAGATGGAGTTTTTGTGTGG - Intronic
1115507039 14:34102646-34102668 CTTAAGTTGGATATTTTGAGGGG - Intronic
1116143322 14:41030204-41030226 TTTTAGTTTATTATTTTGTGTGG - Intergenic
1116366392 14:44070806-44070828 TTCTAGTTTGATATTTTATAAGG + Intergenic
1116389085 14:44370550-44370572 TTTTTGTTTAATATTTTATGTGG - Intergenic
1116459125 14:45151206-45151228 TTTTATATGGATATTATTTGGGG + Intronic
1116727350 14:48577071-48577093 GTTTCTTTGGAGATTTTGTGTGG - Intergenic
1116738473 14:48725343-48725365 TTATATTTGGATGTTGTGTGAGG - Intergenic
1117068777 14:52037129-52037151 TTTGAGTTGGATATGCTGTGAGG + Intronic
1117826227 14:59706394-59706416 TTTGAGTTTCATATTTTGTGTGG + Intronic
1118316677 14:64730058-64730080 TTTGTGTTGGATACTTTCTGTGG + Intronic
1118841810 14:69519153-69519175 TTTTTGTTGAAAGTTTTGTGGGG - Intronic
1119052155 14:71380280-71380302 TTTTAGTTGAATATCCTTTGTGG + Intronic
1119355990 14:74006873-74006895 TTTTAGTTGAATAATAGGTGGGG - Intronic
1119979199 14:79060330-79060352 TTTTAGTTGAATACTTCTTGAGG + Intronic
1120368893 14:83607302-83607324 TTTTGGATGGAATTTTTGTGGGG + Intergenic
1120485536 14:85109277-85109299 TTATAGTTGGAAATTATGTGTGG + Intergenic
1120497640 14:85256417-85256439 TTTTAGTTGTAAATTTCTTGGGG + Intergenic
1120660656 14:87246464-87246486 TTTAAATTGGATTATTTGTGGGG + Intergenic
1120945365 14:89990020-89990042 TTTTATTTGGCTATCTTGTCTGG - Intronic
1121621790 14:95355203-95355225 TTTTATTTGTATATTTTTGGGGG - Intergenic
1124676100 15:31687121-31687143 TTTTATTTGAAGATTATGTGTGG - Intronic
1124697219 15:31874428-31874450 TTTTAATTGAGCATTTTGTGTGG + Intergenic
1124713903 15:32040345-32040367 GTTTAGTTGGACATTTTATATGG + Intronic
1124990018 15:34663597-34663619 TTGTAGTTGAAATTTTTGTGAGG - Intergenic
1125438362 15:39672972-39672994 TTTTAGATTGACACTTTGTGCGG - Intronic
1125471287 15:40006723-40006745 TTTTAGTTAAATATTCTCTGTGG - Intronic
1125526557 15:40379725-40379747 TTTTATTTTTTTATTTTGTGGGG + Intergenic
1126042309 15:44603568-44603590 TTTTTGTTTGATATTTTCTTGGG - Intronic
1126198777 15:45961662-45961684 TTTAACTTGGACATTTTCTGAGG - Intergenic
1126485590 15:49176560-49176582 TCTTATTTGGATTTTTTGAGAGG + Intronic
1128486315 15:68093586-68093608 TTTAAGTGGTTTATTTTGTGGGG + Intronic
1128587723 15:68865571-68865593 TTGTAGTTAATTATTTTGTGGGG + Intronic
1128903904 15:71450809-71450831 TTTGAGTCTCATATTTTGTGGGG - Intronic
1129575762 15:76743541-76743563 TTTTCTTTGGCTATTTTGTATGG - Intronic
1130201661 15:81834876-81834898 TTTTATTTTCATGTTTTGTGTGG - Intergenic
1133017739 16:2952247-2952269 TTTTAGTTTTATTTTTTTTGAGG + Intergenic
1135155655 16:20050694-20050716 TTTGAGTTGGATCTGTTGGGAGG + Intronic
1135779194 16:25284524-25284546 TTTTTGTTGCAAATTTTTTGAGG - Intergenic
1137803697 16:51284418-51284440 TTATAGTTGGTTATATTATGAGG + Intergenic
1138064341 16:53924933-53924955 TTTAAGATGGCTCTTTTGTGAGG - Intronic
1138079867 16:54080314-54080336 TATTAGTAGAATATTTTCTGAGG - Intronic
1139262306 16:65606408-65606430 TTTTAGGTGGCTTCTTTGTGAGG - Intergenic
1141225972 16:82115132-82115154 TTTTATTTGGATAGTTTTTGGGG + Intergenic
1141338120 16:83176566-83176588 TTTTAGTGGAACATTTAGTGGGG + Intronic
1143132226 17:4686093-4686115 CTTTAGTTGGCTTTTTTTTGAGG - Intronic
1143842867 17:9747342-9747364 TTTTAATTGGATCTTGTGTCTGG + Intergenic
1144239048 17:13291396-13291418 TTTTAGTTGGACTTTTGGAGAGG + Intergenic
1145026105 17:19469029-19469051 TTTTGGATGGATGATTTGTGAGG - Intergenic
1145780366 17:27559078-27559100 TTTTGGTTGGATAGTGTTTGCGG + Intronic
1146377061 17:32301885-32301907 TTTTATTTGGATTTTTTTTAAGG + Intronic
1147473351 17:40685300-40685322 TTTTGGTTGGATAATTCTTGGGG - Intergenic
1148926374 17:51089529-51089551 TTTTATTTCAATATTTTTTGGGG - Intronic
1149663689 17:58351276-58351298 TTTTTGGGGGTTATTTTGTGTGG - Intronic
1150099848 17:62413315-62413337 TTTAACTTGGATCTTTTATGAGG - Intronic
1150282001 17:63934258-63934280 TTTTATTTCAATATTTTCTGGGG - Intergenic
1150524419 17:65907374-65907396 TGTTAGTTTGATATTTTGCCAGG + Intronic
1150919600 17:69469295-69469317 GATTACTTGGATATTTTGAGCGG - Intronic
1151020400 17:70609916-70609938 ATTTATTTGGATATTTTGAAAGG - Intergenic
1152481179 17:80554192-80554214 TTTTTTTTGGATTTTTTGTAGGG + Intronic
1153453676 18:5257899-5257921 TTTGAGTGTCATATTTTGTGTGG + Intergenic
1153575903 18:6521542-6521564 TTTTAGTCAGATATTTTTGGGGG + Intronic
1155369477 18:25082512-25082534 TTTGAGTTTTATATTTTGTGTGG + Intronic
1156076540 18:33285913-33285935 TTTTATGTGTGTATTTTGTGTGG - Intronic
1156385980 18:36605761-36605783 TTTTAATTTGTTATTTTGTTTGG - Intronic
1156618451 18:38818168-38818190 TTTTAGTTGAACATTTAGTACGG - Intergenic
1158023897 18:52873100-52873122 ATTTTGTAGGATATTTTGTAAGG - Intronic
1158783908 18:60685592-60685614 TGTTGGTTGGTTGTTTTGTGTGG - Intergenic
1159209089 18:65292706-65292728 TGTTAGATGAATTTTTTGTGAGG - Intergenic
1159650216 18:70969656-70969678 TTTTAATTGGATTATTTGTGGGG - Intergenic
1161762311 19:6183232-6183254 TTCTGGTTGGATATCGTGTGGGG - Exonic
1163386796 19:17004859-17004881 TTTTAGGTCGTTATATTGTGGGG - Intronic
1163964174 19:20728943-20728965 TTTTTATAGGATAGTTTGTGGGG - Intronic
1164042707 19:21507556-21507578 TTTTTCTTGGAATTTTTGTGGGG + Intronic
1164046336 19:21545419-21545441 TTTTCCTGGAATATTTTGTGAGG + Intronic
1164660342 19:29959490-29959512 TTTTTCTTGGACATTTTGTATGG + Intronic
1164936036 19:32214121-32214143 AATTTGTTGGGTATTTTGTGTGG - Intergenic
1202705088 1_KI270713v1_random:16681-16703 TTTTAGATAGAGATTCTGTGGGG - Intergenic
925422160 2:3721452-3721474 TTTTAGTTGGATATTTTGTGTGG + Intronic
927193912 2:20534885-20534907 TTATAGAAGGATATTTTGTAAGG + Intergenic
928126825 2:28622428-28622450 TTTTTGGTGGGTATTATGTGTGG - Intronic
928556875 2:32435937-32435959 TCTAAGTATGATATTTTGTGTGG + Intronic
928665187 2:33543908-33543930 TTTTTGGTGGAGATTTTTTGAGG - Intronic
929143981 2:38690417-38690439 TTTTAGCTGGCTTTTTTGGGAGG + Intronic
929191197 2:39141731-39141753 TTTTAATTAGCTATTTTCTGAGG - Intergenic
929219359 2:39447551-39447573 TTTTATTTGTTTATTTTTTGAGG - Intergenic
930303592 2:49649294-49649316 TTTTAGTAAGAGGTTTTGTGAGG - Intergenic
931368141 2:61637285-61637307 TTTTAGTTTCACATTTTGTGTGG + Intergenic
931565766 2:63614245-63614267 TTTGAGTTTCATATTTTGTATGG + Intronic
932034967 2:68235232-68235254 CTTTAGATGGATGGTTTGTGTGG - Intronic
932287059 2:70543637-70543659 TTTGAGTTGAATAGATTGTGAGG + Intronic
932834726 2:75025667-75025689 TTTTATTTTGATATTTCATGGGG + Intergenic
933017605 2:77148939-77148961 TTTTAGGAGGATTTTATGTGAGG - Intronic
933055596 2:77659840-77659862 TTTAAGTTAAATATTTTCTGAGG - Intergenic
933055768 2:77662346-77662368 TTTGAGTTTAATATTTTTTGTGG + Intergenic
933468388 2:82686651-82686673 TTTTAATTCGATATTTTATGAGG + Intergenic
935036077 2:99375237-99375259 TTATAGCTGGATATTTTGCTTGG + Intronic
935319528 2:101872345-101872367 TTTTAATTTAAAATTTTGTGTGG + Intronic
936702224 2:115025834-115025856 TTTTAATAAGATATTTTGTGGGG + Intronic
936830148 2:116634191-116634213 TTCCAGTTGGGGATTTTGTGGGG - Intergenic
938439339 2:131313621-131313643 TTTATATTAGATATTTTGTGAGG - Intronic
938598709 2:132815550-132815572 TTTTATTTAGCTATTTGGTGTGG + Intronic
940768867 2:157819194-157819216 TTTTTGTTTGATTTTGTGTGTGG - Intronic
941025464 2:160451561-160451583 TTTTATTTCTATATTTTGTCTGG - Intronic
941842752 2:170105387-170105409 TTTCAGTTGGATATTGGCTGGGG - Intergenic
942829344 2:180220968-180220990 TTAAAGTTGGATATTTTTGGAGG + Intergenic
942938466 2:181587673-181587695 TTTGAATTGGATTTTTTATGAGG - Intronic
943147589 2:184065317-184065339 CTTTGGATGGAGATTTTGTGTGG + Intergenic
943191197 2:184681286-184681308 TTTTAGTGGGATTTTTTTTGTGG - Intronic
943580423 2:189677296-189677318 TTTTATTTCGATAGTTTTTGGGG + Intronic
943768059 2:191683922-191683944 TTTTTATTGTATGTTTTGTGAGG + Intronic
944035614 2:195290996-195291018 CTTTAGATGGGTTTTTTGTGTGG - Intergenic
944714027 2:202361151-202361173 TTTGAGTTTCATATTTTGTATGG + Intergenic
945598508 2:211827450-211827472 ATTTAGTTTGACATTTTGGGTGG + Intronic
945793359 2:214332248-214332270 TTTTTGTTTGTTTTTTTGTGAGG - Intronic
945861031 2:215122673-215122695 CTTTAGTTGTTTATTTTCTGTGG - Intronic
945883402 2:215350130-215350152 TTTTAATTTGTTATTTTGAGAGG + Intergenic
946813483 2:223551608-223551630 TTTTATTTGTTTGTTTTGTGTGG - Intergenic
947547177 2:231018482-231018504 TTTTAGTCTCATAGTTTGTGTGG + Intronic
948542387 2:238699847-238699869 TTTGAGTTTGCTTTTTTGTGAGG - Intergenic
948635406 2:239331398-239331420 TTTTATTCAGATATTTTATGAGG - Intronic
1169449182 20:5696795-5696817 TTTTTGTTGTTTATTTTTTGAGG - Intergenic
1169615362 20:7437596-7437618 AATTAGTTAGATATTTTGTTTGG - Intergenic
1170305075 20:14929528-14929550 CTTTATTTGGAGTTTTTGTGGGG + Intronic
1170410625 20:16087074-16087096 TTTAAATTGGATTGTTTGTGTGG - Intergenic
1170532321 20:17306931-17306953 ATTTAGATAGATAATTTGTGAGG + Intronic
1170722389 20:18894977-18894999 TTTTGGTGAGATATTTTGTCAGG - Intergenic
1171750087 20:29040154-29040176 TTTTATTTGGAAATTATGTATGG + Intergenic
1172252822 20:33491623-33491645 CTTTAGTTGGAAATTTCATGAGG - Intronic
1172862080 20:38062442-38062464 TATTAGTTGGATATCTTGATAGG + Intronic
1173194803 20:40905450-40905472 TTTTACATGGATATCTTGTTGGG + Intergenic
1173539649 20:43842010-43842032 TCTTGGTGGGATTTTTTGTGCGG + Intergenic
1173988550 20:47281791-47281813 TTTTGGTTTGATTTTTTGGGAGG - Intronic
1176315132 21:5235758-5235780 TTTTATTTGGAAATTATGTATGG - Intergenic
1176951778 21:15056102-15056124 TTTTAGATGCATCTTTTGTATGG - Intronic
1176985032 21:15425885-15425907 TTTGAGTTTCATATTTTGTATGG + Intergenic
1177046745 21:16180593-16180615 TTTTTATTGGTTATTTCGTGAGG + Intergenic
1177138842 21:17336409-17336431 TATTAGTTGTATATATTTTGGGG + Intergenic
1177172788 21:17672213-17672235 TTATATTTGGATTTTTTGAGTGG + Intergenic
1177471781 21:21569225-21569247 TTTTATTTTTAAATTTTGTGGGG + Intergenic
1177753387 21:25315114-25315136 TTTAGGTTGGATATTTTCAGAGG - Intergenic
1177846772 21:26298617-26298639 TTTAAGTTCGATTTTCTGTGAGG + Intergenic
1177891488 21:26809216-26809238 TTATAGTTGGAAATTTAGGGTGG + Intergenic
1178869725 21:36362862-36362884 GTTTAGTTGGGTATCTTCTGAGG + Intronic
1180884646 22:19232739-19232761 ATTTAATTGGATATTGTGTTTGG - Intronic
1180944868 22:19687214-19687236 TTTTAATTGAATTTTTTCTGTGG - Intergenic
1181481491 22:23202129-23202151 TTTTTGTTGGACATTTCGAGTGG + Intronic
1184090609 22:42291154-42291176 TGTTTGTTGGACAGTTTGTGGGG - Intronic
1184627303 22:45746226-45746248 TTTTAGTGGGTTTTTTGGTGGGG + Intronic
951240559 3:20281482-20281504 ATTATGTTGGATATTTTGTGGGG + Intergenic
951639735 3:24823304-24823326 TTTTGGGGGGATATTTTGGGGGG + Intergenic
952052793 3:29405934-29405956 GTTCAGTTGGAATTTTTGTGAGG - Intronic
952069910 3:29622251-29622273 ATTTATTTGGATATTTTTTCAGG - Intronic
952434650 3:33260713-33260735 TTTTATTTCAATATTTTTTGGGG + Intergenic
952591301 3:34957751-34957773 TTTTACTTTCTTATTTTGTGGGG - Intergenic
952667985 3:35930853-35930875 TTTTTGTTTGTTATTTTGTTTGG + Intergenic
952984968 3:38770901-38770923 TTCTACTTTTATATTTTGTGTGG + Intronic
953279950 3:41545083-41545105 TTTTTGTTGGTTTTATTGTGCGG + Intronic
953903403 3:46856165-46856187 TTTTAGTTGGGTTGTTTGGGGGG + Intergenic
955001971 3:54935531-54935553 TTTTACTTAGATCTTTTGAGTGG + Intronic
956920555 3:73924214-73924236 TTTAATTTGGTTATTTAGTGAGG - Intergenic
957227741 3:77471707-77471729 TTTCAGTCTCATATTTTGTGTGG - Intronic
957307466 3:78476368-78476390 TTTTAGATGGATATTCTGAAGGG - Intergenic
957503863 3:81094543-81094565 TTTTAGTTTTACATTTTATGTGG + Intergenic
957563328 3:81854323-81854345 TTTTTGTTTGCTATTTTGGGAGG - Intergenic
958221662 3:90692851-90692873 TTTAAAGTGGATATTTAGTGCGG - Intergenic
958221820 3:90696255-90696277 TTTCAACAGGATATTTTGTGTGG - Intergenic
958769141 3:98406050-98406072 TTTCAGTACGATATTTTCTGTGG - Intergenic
959154985 3:102656190-102656212 TTTTACTTTCTTATTTTGTGTGG - Intergenic
959213618 3:103421186-103421208 TTTCAGTTAGAAAATTTGTGAGG + Intergenic
959244268 3:103844500-103844522 TTTTAACTTCATATTTTGTGGGG + Intergenic
960025067 3:112999631-112999653 TTTTATTTCGATAGTTTTTGGGG + Intronic
960091091 3:113638729-113638751 TTATGGTTGGATATTTCCTGTGG + Intergenic
960490860 3:118314969-118314991 TGTTTGATGGATATTTTGTGGGG - Intergenic
962561836 3:136614212-136614234 TTTTATTTGTTTATTTTTTGAGG - Intronic
962906464 3:139807940-139807962 TTTTAGTTGGAAATGATGTTTGG - Intergenic
963257396 3:143159308-143159330 TTCTAGTTGGATGTTATTTGAGG - Intergenic
964675332 3:159272057-159272079 TTTTATTTGGATATTTTATTTGG + Intronic
965116023 3:164489850-164489872 TTTGAGTTGGAGATAATGTGAGG - Intergenic
965341607 3:167498356-167498378 TTTGAGTCTCATATTTTGTGGGG - Intronic
965417654 3:168417072-168417094 TTTTAGTTGATTATTTTTTGGGG + Intergenic
965712903 3:171574232-171574254 TTAAAGTTTGATATTTTGTTTGG + Intergenic
966139015 3:176733744-176733766 TTTTATTTCAATAGTTTGTGGGG - Intergenic
966632213 3:182089721-182089743 TTTTAGTTTGACATTAAGTGTGG - Intergenic
967578883 3:191128001-191128023 TTTTATTGGGATATTTTCTTTGG + Intergenic
968264649 3:197353619-197353641 TGCTAGGTGGCTATTTTGTGGGG + Intergenic
968373151 4:13635-13657 TTTTATTTGTATCTTTTGTATGG - Intergenic
968497161 4:925196-925218 TTTTATTTGGACATTTTGATGGG - Intronic
969148544 4:5146009-5146031 TTTTGATTTGATTTTTTGTGTGG + Intronic
969400298 4:6950801-6950823 TTTGATTTGCATATTTTGTTTGG + Intronic
970607994 4:17699601-17699623 TTTTTGTTGGATATTTTTACTGG - Intronic
970800503 4:19967135-19967157 TTTGAGTTGGTTTTTGTGTGTGG + Intergenic
971277350 4:25210867-25210889 TTTGAGGGGGATATTTTTTGAGG + Intronic
971650785 4:29270536-29270558 TTTTAGTTGGTTGGTTTATGGGG + Intergenic
971740154 4:30509057-30509079 CTTTATTTGGATATTAAGTGTGG + Intergenic
971768918 4:30870987-30871009 TTTTATTTGGCTCTTCTGTGAGG + Intronic
971874640 4:32291011-32291033 TTTGAATTGGATATTTTTAGAGG - Intergenic
972461393 4:39306896-39306918 TTTTAGTTTTTTATTTTGGGTGG - Intronic
972836890 4:42882087-42882109 TTTTTGTTTTATATTTTGAGGGG + Intergenic
973082210 4:46007591-46007613 TTATACTTGGATATTCTCTGCGG - Intergenic
973089750 4:46120673-46120695 TTTCAGTAGTATGTTTTGTGTGG - Intronic
973196561 4:47449586-47449608 TTTTATTTGAATAATTTTTGAGG - Intergenic
973594792 4:52476802-52476824 TGTTACATGGATATATTGTGTGG - Intergenic
973702436 4:53550657-53550679 TTATGGTTGGATTTTTTCTGGGG - Intronic
974543122 4:63265601-63265623 TATTTGTTAGATATTTTATGTGG - Intergenic
974650042 4:64743404-64743426 TTTTTTTTGGCTGTTTTGTGTGG + Intergenic
975082467 4:70297497-70297519 ATTTAGTTGGCTCTTTTTTGAGG - Intergenic
975256716 4:72245527-72245549 TTTTATTTAGATATTATTTGAGG - Intergenic
975481659 4:74887796-74887818 TTTTAATAGGATTATTTGTGGGG - Intergenic
975513807 4:75222288-75222310 CTTTGGATGGAGATTTTGTGTGG - Intergenic
976138835 4:81968143-81968165 TTTGAGTTGGTTTTTGTGTGTGG - Intronic
976231707 4:82850969-82850991 TTTTAGTTTGATACTGTCTGTGG - Intronic
976434488 4:85001718-85001740 TGTCATTTGTATATTTTGTGAGG - Intergenic
976539376 4:86255553-86255575 TTTGAGTTAGATATATGGTGTGG - Intronic
976692014 4:87878426-87878448 TTTTAGTTGGCAAATTTGTATGG - Intergenic
976831034 4:89314156-89314178 TTTGAGTTGGTTATACTGTGTGG - Intergenic
976921329 4:90447706-90447728 TTTGACTTGGGTATTTTGTTAGG - Intronic
977673052 4:99717565-99717587 TTTGAGTCTTATATTTTGTGAGG + Intergenic
977940364 4:102851066-102851088 TTTTATTTCAATAGTTTGTGGGG - Intronic
978553358 4:109951368-109951390 TTTCACTTGGTTTTTTTGTGGGG - Intronic
979536015 4:121821765-121821787 TTTTAGTTGTATTGATTGTGAGG - Intronic
979952525 4:126911293-126911315 TTTTATTTGACTATTTTTTGGGG - Intergenic
980027059 4:127780523-127780545 TTTTACTTTGATATTTTAAGTGG + Intergenic
980039201 4:127919633-127919655 TTTTAGTTGGATTTTTAATTTGG - Exonic
980063803 4:128159852-128159874 TTTTTGTTGGATATTTACTTAGG - Intronic
980230442 4:130039955-130039977 TTTGAGGTGGATATCTTTTGGGG + Intergenic
980443463 4:132877840-132877862 TTTTATTTCAATATTTTTTGGGG + Intergenic
980814644 4:137928337-137928359 TTTTAGGTGAATGTGTTGTGTGG + Intergenic
981125375 4:141099921-141099943 TTTTAGTAGGGTATTTGGTTTGG + Intronic
981142612 4:141287014-141287036 TTTTAATGGGATTATTTGTGGGG + Intergenic
981154094 4:141413580-141413602 TTTTAATTAGATATATTGTGTGG + Intergenic
982278138 4:153657939-153657961 TGTTACCTGGATATATTGTGTGG + Intergenic
982307260 4:153945599-153945621 TTATTGAAGGATATTTTGTGGGG + Intergenic
983355228 4:166648353-166648375 ATTCAGTTTGATATTTGGTGTGG + Intergenic
984218212 4:176941015-176941037 TTATTGTTTGATATTTTGTTTGG + Intergenic
984687396 4:182685607-182685629 ATTTAATTGGATATTTTTTGTGG - Intronic
984861522 4:184244498-184244520 TGTTACTTGGCTATTTTCTGGGG + Intergenic
985131726 4:186745372-186745394 TAATAGTTTGATATTTTTTGAGG - Intergenic
985442985 4:189998047-189998069 TTTTAATTTGATTTTTTATGTGG + Intergenic
985462241 4:190118929-190118951 TTTTATTTGTATCTTTTGTATGG + Intergenic
986157172 5:5187976-5187998 TGTTTTTTGGATTTTTTGTGGGG + Intronic
986542085 5:8855284-8855306 TTTTAGTTGTATATCCTGAGTGG - Intergenic
986630750 5:9770074-9770096 TTTTAGTTTGATTTTTTATATGG + Intergenic
986926608 5:12761446-12761468 TTTTTCTTGGACATTTTGAGGGG + Intergenic
986932817 5:12848420-12848442 TTTTAATTGCATTATTTGTGGGG - Intergenic
988170049 5:27641702-27641724 TTTTTTTTGTATTTTTTGTGGGG - Intergenic
989677699 5:43991162-43991184 TTTTAAATATATATTTTGTGGGG + Intergenic
989711730 5:44405901-44405923 TTTTGATTGAATATTTTTTGAGG - Intergenic
990104440 5:52239665-52239687 TTTTTGTTAGTTATTTTGTCTGG + Intergenic
990465982 5:56071853-56071875 TTTTTATAGGAAATTTTGTGTGG + Intergenic
990803615 5:59632707-59632729 CTTTAGATGGAGTTTTTGTGTGG - Intronic
990969410 5:61486775-61486797 TTTTAATGGGATTATTTGTGGGG + Intronic
991052614 5:62289103-62289125 TTTTTGTTTGTTTTTTTGTGTGG + Intergenic
991599343 5:68336899-68336921 TTTTAGCTGAGTCTTTTGTGAGG + Intergenic
991630874 5:68655353-68655375 GTTTCTTTGGATGTTTTGTGTGG - Intergenic
993104398 5:83582715-83582737 TTTTTCTTGGAAATTCTGTGTGG - Intergenic
993176417 5:84491652-84491674 TTCTATTTGGATATTTTTAGTGG - Intergenic
993208487 5:84918228-84918250 TTTTAATTGAATTATTTGTGGGG - Intergenic
993421336 5:87704651-87704673 TGTTACATGGATATATTGTGTGG - Intergenic
993508325 5:88738946-88738968 TTTTAGTGTGCTATTTTGAGTGG + Intronic
993548131 5:89238735-89238757 TTAGATTTGGATATTTTCTGTGG + Intergenic
993956518 5:94241126-94241148 TTTTATTTGGAAATCTTGTTTGG + Intronic
994277897 5:97861222-97861244 TTTTATTTCAATATTTTTTGGGG - Intergenic
994645535 5:102464176-102464198 TTTTATTTCGATAGTTTTTGGGG - Intronic
995233889 5:109803438-109803460 TTTTAATTGTGTGTTTTGTGTGG + Intronic
995394011 5:111667952-111667974 TTTTCGTTGGATTTTTAGTTTGG + Intronic
995499610 5:112790296-112790318 TTTTATTTGGGTTTTTTTTGGGG + Intronic
995617501 5:113981993-113982015 TTTTATTGGGATTATTTGTGGGG + Intergenic
996916411 5:128717159-128717181 TTTAAGGGGTATATTTTGTGTGG + Intronic
996973367 5:129399658-129399680 TGTTAGATGGATATTTTGGGTGG + Intergenic
996996746 5:129705966-129705988 TTTTATTTCAATAGTTTGTGGGG + Intronic
997044053 5:130292138-130292160 TTTTAGTTGGTTTTTGTGTATGG - Intergenic
998223096 5:140304039-140304061 AGTCACTTGGATATTTTGTGGGG + Intergenic
999213350 5:149910054-149910076 TTTTTGTTTTATATTTTTTGAGG + Intronic
999356359 5:150936138-150936160 TTTTAGTTTTATGTATTGTGGGG - Intergenic
999695076 5:154181561-154181583 TTTGAGTTTCATATTTTGTGTGG + Intronic
999714356 5:154347764-154347786 TTATAGGTGAATATTTTGTCTGG - Intronic
1000171042 5:158703549-158703571 TTTTAACAGGACATTTTGTGAGG + Intronic
1000228050 5:159288658-159288680 TTCTTGTTGGATAATCTGTGAGG + Intergenic
1000808598 5:165831219-165831241 TTTGAGCTTTATATTTTGTGCGG - Intergenic
1000981451 5:167820942-167820964 TTTCAGTTGGATATTTGGCTTGG - Intronic
1002094088 5:176820797-176820819 TCTTAGTGGGGTATTTTGGGGGG + Intronic
1002812651 6:647817-647839 TTTTAGTTGGACAGATTTTGAGG - Intronic
1003369395 6:5509983-5510005 TTTTAGCTCTACATTTTGTGAGG + Intronic
1003660391 6:8055461-8055483 TTATAGTTCTATTTTTTGTGTGG + Intronic
1003933593 6:10952840-10952862 GTTTGGATGGATATTTTCTGGGG - Intronic
1004407793 6:15350798-15350820 TTTTAGTGAAATATTTGGTGTGG + Intronic
1004966060 6:20853042-20853064 ATTTATTTGCATATTTTCTGTGG - Intronic
1005203207 6:23370425-23370447 ATTTAGGTAAATATTTTGTGTGG - Intergenic
1006014561 6:31069634-31069656 GTTTAGTTGTTTAGTTTGTGAGG - Intergenic
1007620253 6:43208842-43208864 TTTTACTTGTATTTTTTGAGAGG + Intronic
1007879437 6:45146562-45146584 TTTTATTTCAATAGTTTGTGGGG - Intronic
1008776098 6:55039654-55039676 TTTTTGTTATTTATTTTGTGGGG + Intergenic
1009709858 6:67303331-67303353 TTTAAGTTGTCTATTTTGTTTGG + Intergenic
1010062317 6:71636953-71636975 TTTTAATTGGTTTATTTGTGGGG + Intergenic
1010246538 6:73664663-73664685 TTTAAATTGGATTATTTGTGGGG - Intergenic
1011495227 6:87930811-87930833 TTTTAGCTGGATATACTGTGGGG + Intergenic
1011682880 6:89800103-89800125 TTTTAATTGGATATTTCATTAGG - Intronic
1012648435 6:101719635-101719657 TTTTATTTGGAATTTTTGTGTGG + Intronic
1012695097 6:102370869-102370891 ATTTAGTTAGATAATTTGTATGG + Intergenic
1013672719 6:112422336-112422358 CTTTAGATGGATTTTTTGTGTGG - Intergenic
1014995121 6:128133613-128133635 TTAAAATTGGATTTTTTGTGTGG + Intronic
1015300512 6:131648383-131648405 TTTTTTTTGTATATGTTGTGAGG + Intronic
1015605203 6:134947551-134947573 TTTAAATTGGATTTTTTGGGCGG - Intronic
1016226312 6:141743098-141743120 TTTCAGTTAGATATTTTAAGTGG + Intergenic
1016955095 6:149619135-149619157 TTTTAATTGGATTATTTGTGGGG - Intronic
1017605766 6:156131061-156131083 TTTTTGTTGGTTATTTATTGAGG + Intergenic
1019868765 7:3738018-3738040 TGCTAGTTGGTTGTTTTGTGAGG + Intronic
1020966445 7:14875860-14875882 TGTTAGTTGTATTTTATGTGTGG + Intronic
1021149393 7:17130976-17130998 TTTCTGTTGGAAGTTTTGTGAGG - Intergenic
1022318484 7:29266025-29266047 TCTAAGTTGGATCTTTTTTGGGG - Intronic
1022363963 7:29691653-29691675 TTTTTGTTGGATTTATTCTGAGG - Intergenic
1022430007 7:30309198-30309220 TTTTATTTGGATATCATGAGTGG + Intronic
1022697403 7:32722088-32722110 TTTTTGTTGGATTTATTCTGAGG + Intergenic
1022811777 7:33875883-33875905 CTTTAGTTGTATATTTTTTCTGG - Intergenic
1023213607 7:37834566-37834588 TTTGAGTTGAATGTTGTGTGTGG + Intronic
1023540495 7:41260016-41260038 TTTTATTTGCATAGTTTCTGAGG + Intergenic
1024742230 7:52366992-52367014 TTTTAATTGTATATTTTCTCTGG + Intergenic
1024907880 7:54409340-54409362 TTTCATTTGTATATTTTGGGGGG + Intergenic
1025723790 7:64039294-64039316 TTTTACTTGGATTTTTTTTCTGG + Intronic
1026551228 7:71370316-71370338 TTTTAGTTTGTTACTTTTTGAGG + Intronic
1027972817 7:85107763-85107785 ATTTAGCTGGATGTTGTGTGAGG - Intronic
1027982697 7:85246868-85246890 TTTTATTTATACATTTTGTGTGG - Intergenic
1028347685 7:89803130-89803152 TGTTAGATGCATAGTTTGTGAGG + Intergenic
1028360351 7:89960069-89960091 TTTTATTTGGAGATTAAGTGTGG - Intergenic
1028366153 7:90035113-90035135 TTTTAGCTGTAAATTATGTGTGG - Intergenic
1029129747 7:98321023-98321045 TTTTTTTGGGACATTTTGTGGGG + Intronic
1029966369 7:104745101-104745123 TTTGGCTTGGATATTTTGTGGGG - Intronic
1030788453 7:113692946-113692968 TTTTACTTTGTTTTTTTGTGGGG + Intergenic
1030950802 7:115788992-115789014 TTGGAGTTGGCTCTTTTGTGAGG + Intergenic
1031324812 7:120381519-120381541 TTTTAATTTGATATAATGTGAGG + Intronic
1031495384 7:122440974-122440996 TGTTTGCTGGTTATTTTGTGGGG + Intronic
1031739165 7:125406844-125406866 TTTTATTTCAATATTTTGTGTGG - Intergenic
1032028979 7:128466150-128466172 TTTAACTTGGATCTTTTATGAGG - Intergenic
1033847438 7:145451181-145451203 TTTTAGTTGGCTATATTAAGTGG + Intergenic
1033882846 7:145907817-145907839 TTCTAGGTGAATATTTCGTGTGG - Intergenic
1034649988 7:152682571-152682593 TTTTTGTTGGTTTTTTTGTTTGG - Intergenic
1035029269 7:155846868-155846890 TTTGAGGTGGATACATTGTGAGG + Intergenic
1035029308 7:155847128-155847150 TGTGAGTTGGAGATGTTGTGAGG + Intergenic
1035192301 7:157182015-157182037 TTTTAGAAGGATATTTTGAAAGG + Intronic
1035779301 8:2215308-2215330 TTTTGCTTGTGTATTTTGTGCGG - Intergenic
1035910807 8:3564025-3564047 TTGTAGTTGTATATATTTTGGGG + Intronic
1037075072 8:14705190-14705212 ATTTAGTTGAATATTTTTGGTGG + Intronic
1037497522 8:19454230-19454252 TCTTAGTTGGCTATATTGTATGG - Intronic
1037674299 8:21041030-21041052 TTTCAGCTGGATAATATGTGGGG + Intergenic
1038678474 8:29644947-29644969 TCCCAGTTGGATATTTTTTGGGG - Intergenic
1038787823 8:30637025-30637047 CTTAAGTTGGATTTTTTGGGAGG - Intronic
1039332732 8:36556955-36556977 TGTTACCTGGATATATTGTGTGG - Intergenic
1039395868 8:37224753-37224775 ATTAACTTTGATATTTTGTGTGG - Intergenic
1040798434 8:51314173-51314195 TTTTAGTTTAATTTTTTTTGAGG - Intergenic
1040867461 8:52063817-52063839 TTTTAGTTCAATAGTTTTTGGGG + Intergenic
1041205041 8:55490599-55490621 TTTTAATTTTATATTTTTTGGGG - Intronic
1042505954 8:69560645-69560667 TTTGAATTGGATACTTTGTGGGG - Intronic
1042853828 8:73243859-73243881 TTTTAGATAAATATTTTTTGAGG - Intronic
1043079859 8:75753030-75753052 TTTTATTTGTATATGTTGAGAGG + Intergenic
1043673373 8:82917465-82917487 TTTTAGCTGTATATGTTGGGGGG + Intergenic
1044031275 8:87240948-87240970 GTTTAGCTGGATACTTTTTGTGG + Intronic
1044559118 8:93595472-93595494 TTTTAGTTAGAGTTTTTATGCGG + Intergenic
1044717411 8:95113175-95113197 CTTTAGTCTGATTTTTTGTGGGG + Intronic
1045481400 8:102595578-102595600 TTTTAGTTTGGCATTTTCTGTGG - Intergenic
1045581662 8:103487827-103487849 TATTAGCTGCATATTTTATGGGG - Intergenic
1045615465 8:103904907-103904929 TTTTTGTAGGTTTTTTTGTGTGG + Intronic
1045839455 8:106561946-106561968 TTTTAGATGGTGTTTTTGTGTGG - Intronic
1045853329 8:106730689-106730711 TTTTAGATGTAGATTTTGTGTGG + Intronic
1045977909 8:108150040-108150062 GTTTGGTTGGGTTTTTTGTGGGG - Intergenic
1047395785 8:124497642-124497664 TTTGGGTTGGATTTTTTGTGGGG + Intronic
1047504871 8:125471285-125471307 TTTTAATTGGATTGTTTGTCTGG - Intergenic
1048030372 8:130626025-130626047 TTTTAGATAAATATTTTGGGAGG - Intergenic
1048678465 8:136811899-136811921 TTTTAGTTGCATATTTTTTATGG + Intergenic
1048940198 8:139393857-139393879 TGTTATATGGATATATTGTGTGG - Intergenic
1049890410 9:64199-64221 TTTTAGTGGTGTATATTGTGCGG + Intergenic
1050136010 9:2465554-2465576 TTTTATTTTTATATTTTGTAAGG + Intergenic
1050159994 9:2708450-2708472 TTTTAAATGGATATTGTGTAAGG - Intergenic
1051387860 9:16529241-16529263 TTTGACATGGATATTTTGAGTGG + Intronic
1051653664 9:19355772-19355794 CTCTAGTTGGATTTTTTTTGAGG - Intronic
1051703152 9:19846634-19846656 TGTTAGCTGGTTGTTTTGTGTGG + Intergenic
1051802481 9:20951755-20951777 TTGTACTTGGAGATTTTCTGGGG + Intronic
1051814422 9:21088186-21088208 GTTCAGATGGAGATTTTGTGTGG - Intergenic
1052634115 9:31078787-31078809 TTTTAGATGTATTATTTGTGAGG + Intergenic
1053170201 9:35873303-35873325 TTTTTCTTGGATATTTTCTTAGG + Intergenic
1053170370 9:35875115-35875137 TTTTAGTTGCTTGTCTTGTGTGG + Intergenic
1053721168 9:40947853-40947875 TTTTATTTGGAAATTATGTATGG + Intergenic
1053731873 9:41065382-41065404 TTTTAGTGGTGTATATTGTGCGG + Intergenic
1054344823 9:63904306-63904328 TTTTATTTGGAAATTATGTATGG - Intergenic
1054884805 9:70185047-70185069 TTTTGGATGGGGATTTTGTGTGG + Intronic
1055178606 9:73353098-73353120 TTTTAATTAATTATTTTGTGTGG - Intergenic
1055181668 9:73395728-73395750 TTTTATTTCAATATTTTTTGGGG + Intergenic
1055570370 9:77610279-77610301 TTTGAGTTTCCTATTTTGTGTGG + Intronic
1055917541 9:81421088-81421110 TTTGAGTTTTATATTTTGTATGG + Intergenic
1056333999 9:85548021-85548043 TGTTTATTTGATATTTTGTGTGG - Intronic
1056341574 9:85638775-85638797 TTTTTGTTATATATTTTTTGAGG - Intronic
1056345580 9:85691024-85691046 TTTTTGTTGGGTTTTTTGTTTGG + Intronic
1057333422 9:94138076-94138098 TGTTAATTGGATACTGTGTGTGG - Intergenic
1058182630 9:101816489-101816511 TTTTGGATGGAGATTTTGTGTGG - Intergenic
1058225923 9:102363263-102363285 TATTTGATGGATATTTTATGAGG - Intergenic
1058376663 9:104329678-104329700 TTTTACTGGGATATTTTTTGGGG + Intergenic
1058403873 9:104649419-104649441 TTTGAGTTGAATTTTGTGTGTGG - Intergenic
1059167087 9:112087909-112087931 TTTTACTTGGATACATTTTGGGG - Intronic
1059233846 9:112745630-112745652 TTTTAATTTAATATTTTTTGTGG + Intergenic
1062675635 9:137741917-137741939 TTTTGAATAGATATTTTGTGGGG - Intronic
1186801729 X:13099511-13099533 TTTTAGTATCATATTTTGTATGG - Intergenic
1186845135 X:13523189-13523211 TTTTAGTTTTATATGTGGTGTGG + Intergenic
1186912681 X:14185807-14185829 TTTGTGCTGGATATTATGTGGGG + Intergenic
1187067085 X:15851342-15851364 TATGGGTTGGATATTTTGTCAGG - Intronic
1188079690 X:25821905-25821927 TTTGAGTTGGTTTTTATGTGTGG - Intergenic
1188202836 X:27313170-27313192 TTTTTGCTTGATATTTTTTGGGG - Intergenic
1188911294 X:35851213-35851235 TTTGAGTTTCATATTTTGTGTGG - Intergenic
1189590749 X:42507990-42508012 CTTCAGTTGGATTTTCTGTGTGG - Intergenic
1189631151 X:42954669-42954691 TTTTATTTGGAGATTAAGTGTGG + Intergenic
1189703262 X:43733565-43733587 TTTTATTTGTATAGTTTTTGAGG - Intronic
1190031055 X:46973273-46973295 TTTTCCTTGGATGTTTTTTGAGG + Intronic
1190940100 X:55031710-55031732 TTTTAATTGTATATTATGAGAGG - Intergenic
1193119364 X:77807261-77807283 TTTTAGTTGATTTTTGTGTGTGG + Intergenic
1193164219 X:78263513-78263535 TTTCAGATGGGTTTTTTGTGGGG + Intergenic
1193354993 X:80508830-80508852 TGTTACATGCATATTTTGTGTGG - Intergenic
1193645819 X:84067098-84067120 TTTTATATGGAGTTTTTGTGTGG - Intronic
1194164607 X:90499543-90499565 CTTTATATGTATATTTTGTGTGG - Intergenic
1194168014 X:90545940-90545962 TTTTAGTTGAAATTTATGTGGGG - Intergenic
1194181881 X:90720463-90720485 TTTTATTTCAATATTTTTTGGGG - Intergenic
1194509324 X:94772920-94772942 TTTTATTTGGAAATTATGTATGG + Intergenic
1194519805 X:94904548-94904570 TTTTAATTGGATATTTTAATTGG + Intergenic
1195596017 X:106690814-106690836 ATTTATTTGGGTGTTTTGTGAGG + Intergenic
1195731815 X:107976180-107976202 TTATAGTTGTATTTCTTGTGTGG + Intergenic
1195929313 X:110058107-110058129 TTTGAGTTGGTTTTTGTGTGTGG + Intronic
1196047347 X:111270164-111270186 TTTTGGTTGGTTATTTTGAGGGG - Intronic
1196335678 X:114530171-114530193 TTTTGCTTGCATATATTGTGTGG + Intergenic
1196630481 X:117933487-117933509 TTATAGTTGGTTTTTGTGTGTGG - Intronic
1196660095 X:118260364-118260386 TTTTTGTTGGGTGTTTTGTTTGG + Intergenic
1197625806 X:128801178-128801200 CTTCAGTTGGTTATTTGGTGGGG + Intergenic
1198565061 X:137895823-137895845 TTTCAGGTGCATAGTTTGTGGGG + Intergenic
1198703858 X:139426124-139426146 TGGTTGTTGGAGATTTTGTGTGG + Intergenic
1199013392 X:142782955-142782977 TTTCAGTTGCATATCTTGTTAGG + Intergenic
1199273675 X:145916236-145916258 TTTAAGTTGGTTATTTTATATGG - Intergenic
1199781347 X:151063289-151063311 TATCTGTTGGCTATTTTGTGTGG + Intergenic
1200510434 Y:4072050-4072072 TTTTAGTTTAATACTTTTTGTGG + Intergenic
1200510866 Y:4077338-4077360 CTTTATATGTATATTTTGTGTGG - Intergenic