ID: 925422240

View in Genome Browser
Species Human (GRCh38)
Location 2:3722154-3722176
Sequence GAGGTTATACAACTTGATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 998
Summary {0: 1, 1: 1, 2: 13, 3: 129, 4: 854}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925422240 Original CRISPR GAGGTTATACAACTTGATCA AGG Intronic
900009460 1:92611-92633 GAGGTTAGGTAACTTGTTCAAGG - Intergenic
900025570 1:269187-269209 GAGGTTAGGTAACTTGTTCAAGG - Intergenic
900035333 1:402960-402982 GAGGTTAGGTAACTTGTTCAAGG - Intergenic
900056954 1:638713-638735 GAGGTTAGGTAACTTGTTCAAGG - Intergenic
901183999 1:7360469-7360491 GAAGTTAAGCCACTTGATCAAGG - Intronic
901759381 1:11460768-11460790 GTGGTTAAGCAACTTGTTCAAGG + Intergenic
901882562 1:12202790-12202812 GAGGTTAAACAGCTTCTTCAAGG + Intronic
902187837 1:14738819-14738841 GAGGTTAAGCAACTTGCTGAAGG + Intronic
902203361 1:14850498-14850520 GAGGTTAAGCAACTTGCCCACGG + Intronic
902433224 1:16379674-16379696 TAGGTTATATAATTTGACCATGG - Intronic
902556802 1:17251611-17251633 GAGGTTAAACAACTTGTCCAAGG + Intronic
902649648 1:17828352-17828374 GAGGTTAAATAACTTGCCCAAGG - Intergenic
902668479 1:17955530-17955552 GAGGTTAAGCAACTTGCCCAAGG - Intergenic
902741446 1:18441337-18441359 GAGGTTAAACAACTGGCCCAGGG - Intergenic
902835203 1:19042958-19042980 GAGGTTAAATAACTTGCCCAAGG + Intergenic
902844311 1:19097629-19097651 AAGGTTACACAGCTTGTTCAAGG + Intronic
902936173 1:19766460-19766482 GAGGTTAAGCGACTTGATCAAGG + Intronic
903374230 1:22855824-22855846 GAGGTTAGGTAACTTGCTCATGG + Intronic
903411122 1:23143852-23143874 GAGGTTATGCAATTTGCTCAGGG + Intronic
903782679 1:25831747-25831769 AAGGTTATACAAGTTGCCCAAGG - Intronic
903865754 1:26396508-26396530 GAGATTAAACAATTTGCTCATGG - Intergenic
903893631 1:26587475-26587497 GAGGTTAAATAACTTACTCAAGG + Intergenic
903992128 1:27280056-27280078 GAGGTTAAAGAACTTGCTCAAGG + Intronic
904052385 1:27647505-27647527 GAGTTTATGCAGCTTGTTCAAGG - Intergenic
904350173 1:29899932-29899954 GAGGTTAAATGACTTGACCATGG - Intergenic
904355126 1:29933791-29933813 GAGGTTAAACACATTGACCAAGG - Intergenic
904868370 1:33600750-33600772 GAGGTTATACAACTCACTCAAGG + Intronic
904917359 1:33979844-33979866 GAGGTTAAAGAACTTGCCCAAGG - Intronic
905008868 1:34733241-34733263 GAGGATAAACAACTTGTTCAAGG - Intronic
905023568 1:34834853-34834875 GAGTTCAAACAACTTGCTCAAGG + Intronic
905234612 1:36537369-36537391 GAAGTTAAGCAACTTGCTCAAGG + Intergenic
905234913 1:36539545-36539567 GAAGTTAAGCAACTTGCTCAAGG + Intergenic
905486366 1:38299779-38299801 GGGTTTAAACAACTTGCTCAAGG + Intergenic
905514091 1:38548802-38548824 GAGGTTAAATAGCTTGCTCAAGG - Intergenic
905911336 1:41657004-41657026 GAGGAAATACAACTTGCACATGG + Intronic
905948487 1:41924572-41924594 GAGGTTATATAACTTGCCCAAGG - Intronic
906460405 1:46031842-46031864 GAAGTTAAGCAACTTGCTCAAGG - Intronic
906613932 1:47222343-47222365 GAGGTTACCCAGCTTGATCAAGG - Intronic
906707624 1:47906356-47906378 GAGGTTAAAGAACTTGCTAAAGG + Intronic
906730250 1:48074711-48074733 GAGGTTAAACAACTTGTCCATGG - Intergenic
906782281 1:48583423-48583445 GAGGTTATACAACTCACCCAAGG + Intronic
906791669 1:48663863-48663885 GAGGTTATATAACTTGTTCAAGG + Intronic
907188450 1:52629859-52629881 GAGGTTAAGTAACTTGCTCAGGG - Intergenic
907260716 1:53216509-53216531 GAGATTTTGCAACTTGCTCAGGG - Intronic
907286804 1:53385714-53385736 GAGGTGAATTAACTTGATCAAGG - Intergenic
907377775 1:54058034-54058056 GAGGCTAAATAACTTGACCAAGG - Intronic
907806957 1:57830412-57830434 TAGGTTATAAAACTTGTCCAAGG + Intronic
908324724 1:63012597-63012619 GAGGTTACATAACTTGTCCAAGG - Intergenic
908408643 1:63841211-63841233 GAGGTTAAGTAACTTGCTCAAGG + Intronic
908411930 1:63875124-63875146 GAGGTTAAACAACTTGCCTAGGG - Intronic
908463833 1:64372043-64372065 GAGGTTAAGTAACTTGACCAAGG - Intergenic
908720844 1:67124092-67124114 GAGGTTAAACAATTTGCACAAGG - Intronic
908804567 1:67916786-67916808 GAGGTTAAACAACTTGCCCAAGG - Intergenic
908953809 1:69596262-69596284 GAGGTTAGATAACTTGATCAAGG + Intronic
909475012 1:76072869-76072891 GAGGTTAAGAAACTTGATCAAGG + Intergenic
910041254 1:82854155-82854177 GAGATTAAACAACTTGCTCAAGG + Intergenic
910255746 1:85245614-85245636 GAGGTTATGTAATTTGTTCAAGG - Intergenic
910544861 1:88403673-88403695 GAGTTTATATAACTTATTCAAGG + Intergenic
910877486 1:91890756-91890778 GAGGTTATGTAACTTGCCCAAGG + Intronic
911172318 1:94782824-94782846 GAGGTTCTGCAACTTGCTTAGGG - Intergenic
911173615 1:94796311-94796333 AAGGTTAGATAACTTGCTCAAGG + Intergenic
911693422 1:100861199-100861221 GAGGTTAAATAATTTGTTCAAGG - Intergenic
911897294 1:103452771-103452793 AAGTTTAAATAACTTGATCATGG - Intergenic
912122865 1:106494250-106494272 GAGGTTAAACAAGTTGTTCGAGG - Intergenic
912134434 1:106642746-106642768 CAGGTTAAACAACTTGCCCAAGG - Intergenic
912146477 1:106799984-106800006 GAGGTTATGTAACTTGTTCAAGG + Intergenic
912505685 1:110154254-110154276 GAGGTTAAATAATTTGTTCAAGG + Intronic
912665791 1:111578329-111578351 AAGGTTACACAGCTAGATCAAGG + Intronic
912954799 1:114147707-114147729 CAGGTTAAATAACTTGCTCAAGG - Intronic
912987651 1:114450781-114450803 GATGTTATACACCTTGATATGGG + Intronic
913017230 1:114751465-114751487 GAGATTAAATAACTTGTTCATGG - Intronic
913271519 1:117098404-117098426 GAGGTTAAATAACTTGCCCAAGG + Intronic
913441659 1:118904895-118904917 GAGGTTATATAACTTGGCAAAGG - Intronic
913497363 1:119440705-119440727 GAGGTTAATTAACTTGTTCAAGG + Intergenic
913508415 1:119540484-119540506 GAGGTTAATCAACTTGTCCAAGG + Intergenic
913678226 1:121162988-121163010 GAGGTTAAAGAACTTGTTCGTGG - Intergenic
913701679 1:121380530-121380552 GAAGTTAAACAATTTGAGCAAGG - Intronic
914030066 1:143950628-143950650 GAGGTTAAAGAACTTGTTCGTGG - Intronic
914159383 1:145117323-145117345 GAGGTTAAAGAACTTGTTCGTGG + Intergenic
915042386 1:152980120-152980142 AAGGTTAGGCAACTTGCTCAAGG + Intergenic
915315868 1:155028906-155028928 GAGGTTAAGCAACTTGCTGAAGG + Intronic
915472936 1:156136616-156136638 GAGGTTAAATAACCTGCTCAAGG - Intronic
915894998 1:159805030-159805052 GAACTTAGACAACTTGTTCAAGG + Intronic
916431110 1:164729676-164729698 GAGGTTAGGCAACTTGCTGAAGG + Intronic
917121670 1:171649872-171649894 GAGGTTATTCAGCTTGTCCATGG - Intronic
917188669 1:172390328-172390350 GAGGTTAAACAGCTTGCCCAAGG + Intronic
917266020 1:173221759-173221781 GAGGTTATGCAACTTGGCCTTGG + Intergenic
917759306 1:178138533-178138555 GAGGTTATACAGCTCGTTCAAGG - Intronic
918449042 1:184641514-184641536 GAGGTTAGACAGCCTGATCAAGG - Intergenic
919047990 1:192477383-192477405 GCGGTTAAGCAACTTGATTAAGG - Intergenic
919131614 1:193458041-193458063 GAGGCTATACACCTGGTTCAGGG - Intergenic
919229775 1:194759250-194759272 TAAGTTAAACAACTTGACCAGGG + Intergenic
919401339 1:197121208-197121230 TAGTTTGTTCAACTTGATCAAGG + Intronic
919577844 1:199334098-199334120 GAGGTTATATACCTTGCCCAAGG - Intergenic
919688704 1:200508838-200508860 GAGGTTAAGCAACGTGTTCAAGG - Intergenic
919878509 1:201887814-201887836 GAGGTTAAAGAACTTGTTCAAGG - Intergenic
920465533 1:206181512-206181534 GAGGTTAAAGAACTTGTTCGTGG - Intergenic
920582745 1:207127502-207127524 GAGGTTAAAAGACTTGCTCAAGG + Intronic
920870239 1:209788103-209788125 GAGGTTAAAGGACTTGTTCAAGG + Exonic
920958736 1:210645129-210645151 GAGGTTACACAACTTGTTCAAGG + Intronic
921027248 1:211297367-211297389 GAGGTTAACCAACTTGTTCAAGG + Intronic
921189639 1:212698886-212698908 GAGGTTAAACAAATTGCTCAAGG + Intronic
921218671 1:212958047-212958069 GAGGTCATGCAGCTTGACCAGGG + Intronic
921548137 1:216498496-216498518 GAAGTTAAATAACTTGCTCAAGG - Intergenic
921587279 1:216963007-216963029 GAAATTATAGAACTTGTTCAGGG - Intronic
921949038 1:220909876-220909898 GAAGTGACACAATTTGATCATGG - Intergenic
922027258 1:221761933-221761955 GAGGTTATGTAACTTACTCAAGG + Intergenic
922219797 1:223549929-223549951 GAGGTTATATGATTTGCTCAAGG + Intronic
922246583 1:223804768-223804790 GAGGTTATGCAATTTGTTCAGGG - Intronic
922257865 1:223908520-223908542 GAGGTTAGGTAACTTGTTCAAGG - Intergenic
922987224 1:229875106-229875128 GAGGATGTACATCTGGATCAGGG + Intergenic
923054688 1:230417205-230417227 GAGGAAATACAACATGATCTTGG - Intronic
923216122 1:231849457-231849479 GAGGTTAGACAACATGCCCAAGG + Intronic
923373320 1:233334378-233334400 GAAGTTATATAACTTGCTCAAGG - Intronic
923538818 1:234873565-234873587 GAGGTTAAACGACTTGTCCAAGG - Intergenic
923554363 1:234989276-234989298 GAGGTTAAGTAACTTGCTCAAGG + Intergenic
924697210 1:246413004-246413026 GAGGTTAAACAGTTTGCTCAAGG + Intronic
924796492 1:247296344-247296366 GAGGTTAGAAAACTTGCTTAGGG - Intergenic
1063070323 10:2656009-2656031 GAGTTTAGAGAACTTGACCAAGG - Intergenic
1063573778 10:7242417-7242439 GAGTTTATATAACTTGCGCAGGG - Intronic
1063724965 10:8626814-8626836 GAGGTTAAATAACTTTTTCAAGG - Intergenic
1065249610 10:23797377-23797399 GAGAATAAACAACTTGCTCAAGG + Intronic
1065353819 10:24819856-24819878 GAGGTTAAACCACTTGTCCATGG + Intergenic
1065383699 10:25114228-25114250 GAGGTTATGTAACTTGCCCAAGG + Intergenic
1065443907 10:25777883-25777905 GAGGTTAAATAAGTTGACCAAGG - Intergenic
1065627477 10:27646764-27646786 GAGGTTATGCAACTTGCCCAGGG + Intergenic
1065961610 10:30738442-30738464 GAGGTTAGAAAACCTGCTCAAGG - Intergenic
1066084730 10:31964984-31965006 GAGGTTGCATAACTTGCTCAAGG - Intergenic
1067320868 10:45219618-45219640 GAGGTTAAGCAACTTGCCCAAGG + Intergenic
1067546511 10:47196138-47196160 GAGGTTAAGCAACTTGCTCAAGG + Intergenic
1067930230 10:50553308-50553330 GAGGCTAAACACCTTGACCAAGG - Intronic
1067991531 10:51218957-51218979 GAGGTTAAATAACTTGCCCAAGG - Intronic
1068442474 10:57076214-57076236 GAAGCTATGCAATTTGATCAGGG - Intergenic
1068594731 10:58890501-58890523 GAGGTTCCATAACTTGCTCAAGG + Intergenic
1068731838 10:60366712-60366734 GAAGTTATACTACTTGCTCAAGG - Intronic
1068813606 10:61284734-61284756 AGGATTATACAACTTGATGAAGG - Intergenic
1068963441 10:62888001-62888023 GAGGTTAAGCAATTTGACCAAGG - Intronic
1069127246 10:64651561-64651583 GAGGTTACAAAACTTGTCCAAGG - Intergenic
1069242864 10:66163779-66163801 GAGGCTAAATAACTTGAACATGG - Intronic
1069448464 10:68495874-68495896 CAGGTTAAGTAACTTGATCAGGG - Intronic
1069552607 10:69375076-69375098 AAGGTTATATAACTTGCCCATGG - Intronic
1069628994 10:69886343-69886365 GAGGTTAGACAACTTGCTGAGGG + Intronic
1069814521 10:71185243-71185265 GAGGTTAAGCAACTTGCCCAAGG - Intergenic
1069830161 10:71278074-71278096 GAGGTTAAGCAACTTGTCCAAGG - Intronic
1069854980 10:71435173-71435195 GAGGCTAAACAACTTGCTCAAGG - Intronic
1069899457 10:71698914-71698936 GAGGTTAAGCAACTTGCCCAAGG - Intronic
1069914426 10:71778610-71778632 GAGGTTAAGCAACTTGCTCAGGG - Intronic
1069944294 10:71975290-71975312 GAGGTTAGGCAACTTGTCCAAGG + Intronic
1069995223 10:72337648-72337670 AAGGTTATATAACTTGTTTAGGG + Intronic
1070718910 10:78743092-78743114 GAGGTTAAATAACTTGTCCAAGG + Intergenic
1070790657 10:79187405-79187427 GAGGTTACACAACTCGCCCAAGG - Intronic
1071462640 10:85913351-85913373 GAGGTTAAATCACTTGTTCAAGG - Intronic
1071711594 10:88055142-88055164 GAGGTTAAGCAATTTGTTCAAGG + Intergenic
1071777318 10:88803810-88803832 GAGGTTAAACAAGTTGAACAAGG + Intronic
1072205672 10:93203347-93203369 GAGGTTATGCAACTTCTCCAAGG - Intergenic
1072720684 10:97779064-97779086 GAGGTTAAATAACTTGCCCAAGG - Intergenic
1072767011 10:98103347-98103369 GAGGTTAAAAGACTTGTTCAAGG - Intergenic
1072925901 10:99616791-99616813 GAAGTTATATAACTTGTCCAAGG - Intronic
1073066854 10:100766079-100766101 GAAGTTAAATAACTTGCTCAAGG + Intronic
1073246033 10:102090854-102090876 GAGGTTAAATAACTTGCTCAGGG + Intergenic
1073341947 10:102751782-102751804 GAGGTTATGTAACTTGCTCAAGG - Intronic
1073560489 10:104492265-104492287 GAAGTTAAATAACTTGTTCAAGG + Intergenic
1073811442 10:107156327-107156349 AAGCTTAAACAACTTGCTCAAGG - Intronic
1073989811 10:109249928-109249950 GAGTTTATACAACTAAATAAAGG + Intergenic
1074438582 10:113455249-113455271 GAGGTTAAGCAACTTCACCAGGG - Intergenic
1074840909 10:117350163-117350185 GAGGTTAAGTAACTTGCTCAGGG + Intronic
1074876204 10:117615334-117615356 GAAGTTAAACAACTTGCCCAGGG - Intergenic
1074959237 10:118424495-118424517 GAGGTTATTTAACTTGTGCAAGG - Intergenic
1075275926 10:121092384-121092406 GAGGTTATATAACTTGCTCAAGG + Intergenic
1076108254 10:127841721-127841743 GAGGTTACATAACTTGCACAGGG - Intergenic
1077497493 11:2893208-2893230 GAGGTTAAGCAACTTGCCCAAGG - Intronic
1077975964 11:7249494-7249516 GTGGTTAAACAATTTGTTCAAGG - Intronic
1078409099 11:11096867-11096889 GTGGTTAAACAACTTGCCCAAGG - Intergenic
1078440478 11:11361324-11361346 GAGGTGATATAACTTGCTCAAGG - Intronic
1078571308 11:12460317-12460339 GAGGTTATATAATCTGAACAAGG - Intronic
1078594042 11:12671665-12671687 GAGGCTATATAACTTGTCCATGG - Intergenic
1078671263 11:13367790-13367812 GAGGTTAAGTAACTTGCTCAAGG - Intronic
1078952923 11:16155518-16155540 GAGGTTAAACAACTTGCCCAAGG - Intronic
1079299309 11:19263483-19263505 GAGATTATGCAACTTAATTAAGG - Intergenic
1079338833 11:19595496-19595518 GGGGTTTTACAACTTGATCAAGG + Intronic
1079391264 11:20023980-20024002 GAGGTTAAATAACTTGATTAAGG + Intronic
1079525979 11:21388296-21388318 GAAGTTATATAACTTGATCAAGG - Intronic
1079638746 11:22778197-22778219 GATTTTAAATAACTTGATCAAGG - Intronic
1080217523 11:29862189-29862211 GAGGTCAAATAACTTGCTCAAGG + Intergenic
1080495872 11:32818336-32818358 GATGTTAAACAACTTGCTCAAGG - Intergenic
1080544846 11:33306603-33306625 AAGGTCAAACAACTTGCTCAGGG - Intronic
1080686135 11:34516439-34516461 GAGGTTAAGTAACTTGTTCACGG + Intergenic
1080889427 11:36396723-36396745 GAGGTCAAGTAACTTGATCAAGG + Intronic
1080892402 11:36420422-36420444 GAGGTAAAGCAACTTGCTCAAGG - Intronic
1081250652 11:40828700-40828722 GAGGGTAAACAGCTTGATCTAGG - Intronic
1081385097 11:42462705-42462727 AAGGTTATACAATTTGCTCAAGG + Intergenic
1081670094 11:44937894-44937916 GAGGTTAGGCAACTTGCCCAAGG - Intronic
1081744141 11:45461301-45461323 GGGGTTAAATAACTTGCTCAAGG + Intergenic
1082230339 11:49757725-49757747 GAGATTAAACAACTTACTCAAGG - Intergenic
1082873103 11:57961765-57961787 GAGGTTAAATAACTTGCTCAGGG - Intergenic
1083735865 11:64680561-64680583 AAGGTTAAAGAACTTGCTCAAGG - Intronic
1083775464 11:64892532-64892554 GAGGTTACGCTACTTGCTCAAGG - Intergenic
1083941465 11:65898534-65898556 GAGGTTAAATAACTTGCCCATGG - Intronic
1084353605 11:68622303-68622325 GTGGTTATACAACATCATTAGGG + Intergenic
1085084411 11:73657255-73657277 GAGGTTACCTAACTTGATCAGGG + Intronic
1085187303 11:74586825-74586847 GAGGTTAAATAACTTGCCCAAGG - Intronic
1085308732 11:75503443-75503465 GAGGCTAAGCAACTTGTTCAAGG + Intronic
1085587720 11:77726871-77726893 GAGGATATACAACTTGTCCAGGG - Intronic
1085740395 11:79073682-79073704 GAGGTTAAATAACTTGCCCAAGG - Intronic
1085800426 11:79584493-79584515 TATATTATACAACTTGATAAAGG + Intergenic
1085803761 11:79615709-79615731 GAGGTTTAAGAACTTGCTCAGGG - Intergenic
1085943273 11:81232434-81232456 GATGTTAAACAACATGCTCAAGG + Intergenic
1086051618 11:82598612-82598634 GAGGTTATGTAACTTGTCCAAGG - Intergenic
1086181840 11:83961485-83961507 GAGGTTATGGAACTTGCTTATGG - Intronic
1086189163 11:84057833-84057855 GAGGTTAAGCAATTTGCTCAAGG + Intronic
1086367009 11:86117384-86117406 GAGGTGAAGCAACTTGATTAAGG + Intergenic
1086619712 11:88871237-88871259 GAGATTAAACAACTTACTCAAGG + Intronic
1086836831 11:91635383-91635405 GAGTTTATGTAACTTGCTCATGG + Intergenic
1086928667 11:92668579-92668601 AAAGTTAAATAACTTGATCAAGG - Intronic
1087017524 11:93568386-93568408 GAGGTTATATAACTTACTCTAGG - Intergenic
1087040827 11:93798180-93798202 GAAGTTATGCACCTTGCTCAAGG + Intronic
1087263395 11:96035873-96035895 GAGGTTATGTAACTTGCCCACGG - Intronic
1088152675 11:106764885-106764907 AAGTTTATATAATTTGATCAAGG - Intronic
1088343331 11:108794519-108794541 GAACTTATTCAACTTGATAAAGG - Intronic
1088506134 11:110529338-110529360 AAGGTTAAACAACCTGCTCAAGG - Intergenic
1088702005 11:112421830-112421852 GAGGTTAAGTAACTTGCTCAAGG + Intergenic
1088822449 11:113468196-113468218 GAGGTTAATTAACTTGCTCATGG + Intronic
1089272813 11:117313979-117314001 GAGGTTATGCAATTTGCCCAAGG + Intronic
1089529549 11:119117475-119117497 GAGGTTACATAACTTGCCCAAGG - Exonic
1090203469 11:124872122-124872144 CAGGTTAAACAGCTTGTTCAGGG + Intronic
1090298962 11:125617338-125617360 GAGGTTAAATAACTTGCCCAAGG + Intronic
1090411863 11:126514704-126514726 GTGGTTAAATAACTTGCTCACGG + Intronic
1090833084 11:130433178-130433200 GAGGTTAGAGAACTTGCTTATGG + Intergenic
1090848390 11:130549043-130549065 GAAGTGAAACAACTTGTTCAAGG + Intergenic
1091068535 11:132541333-132541355 GAAGTCACACAACTTGCTCAAGG - Intronic
1091227356 11:133965516-133965538 GAGGTTACGCAACTTGCTTAAGG - Intergenic
1091433549 12:456180-456202 GATGTTAAATAACTTGCTCAAGG - Intergenic
1091612259 12:2021242-2021264 GAGCTTAAATAACTTGCTCAGGG + Intronic
1091639667 12:2226363-2226385 GAGGTTAAATAACTTGGCCAAGG + Intronic
1091648589 12:2292549-2292571 GAGGTTTGATAACTTGACCAAGG - Intronic
1091747403 12:3001123-3001145 GAGGTTAAATAACTTGCCCAAGG - Intronic
1092042187 12:5394794-5394816 GAGGCTATACAGCTTGCCCAAGG - Intergenic
1092103654 12:5905300-5905322 AAAGTTACATAACTTGATCAGGG - Intronic
1092199263 12:6569836-6569858 AAAGTTAAACAACTTGCTCAAGG + Intergenic
1092844327 12:12569981-12570003 GAGGTTAAACGACTTGCCCAAGG + Intergenic
1092885029 12:12917427-12917449 GAGTTAATGCAACTAGATCAGGG + Exonic
1093078450 12:14781684-14781706 GACGTTTTACAACATGATTAAGG + Intergenic
1093408235 12:18832676-18832698 AAGCTTATCCAACATGATCAAGG + Intergenic
1093423979 12:19007121-19007143 GAGTTTAAATAACTTGTTCAAGG - Intergenic
1093842006 12:23915082-23915104 GAGGTTAAGTAACATGATCAAGG - Intronic
1094004184 12:25729891-25729913 GAGGTTAAATAACTTGTCCAAGG + Intergenic
1094384067 12:29874348-29874370 GAGGTTATATAACTTTCTTAAGG - Intergenic
1094489663 12:30951684-30951706 GAGGTTAAATAACTTGCCCAAGG + Intronic
1095454593 12:42369651-42369673 GAGATTAAATAACTTGGTCAAGG + Intronic
1096073098 12:48786856-48786878 GAGGTTAAATAACTTGCCCAAGG - Intronic
1096571238 12:52524510-52524532 GAGGTTAGGCAACTTGCTCAGGG - Intergenic
1097287779 12:57890839-57890861 GAGATTAAATAACTTGTTCAAGG + Intergenic
1097329223 12:58315060-58315082 GAGGTTAAGCAACTTACTCAAGG + Intergenic
1097388358 12:58978450-58978472 GAGGTCAGAAAACTTGGTCAAGG - Intergenic
1097404277 12:59170249-59170271 GAGGTTAAGCAACTTGACCAAGG - Intergenic
1097812981 12:64038082-64038104 GAGGTTATGTAACTTGTCCAAGG - Intronic
1097904365 12:64904862-64904884 GAGGTTAAATAATTTGACCAGGG - Intergenic
1097913626 12:64996724-64996746 GTGGTTAAATAACTTGACCAAGG - Intergenic
1098089302 12:66883824-66883846 GAAGTTGAACAACTTGACCAAGG - Intergenic
1098099509 12:66999303-66999325 GAAGTTATGCAACTTGCCCAAGG + Intergenic
1098131654 12:67357599-67357621 GAGGTTAAGCAATTTGCTCACGG - Intergenic
1098179522 12:67831363-67831385 GAGGTTAAATAACTTGTCCAAGG - Intergenic
1098357149 12:69622603-69622625 GAAGTTAAACTACTTGCTCAAGG - Intergenic
1098460352 12:70726393-70726415 GAGGTTATGTCACTTGCTCAAGG - Intronic
1098602000 12:72343023-72343045 GAGGTTATATAACTTGCACAAGG + Intronic
1098868974 12:75795220-75795242 GATGTTAAATAACTTGCTCAAGG - Intergenic
1100860213 12:98797359-98797381 GAGGTTGAATAACTTGCTCAAGG - Intronic
1100891207 12:99128027-99128049 GAAGTTAAACAACTTGCCCAAGG - Intronic
1101019172 12:100534697-100534719 GAGGTTAAACTACTTGTTCAAGG + Intronic
1101081222 12:101186819-101186841 GAGGTTATATAACTTACCCAAGG - Intronic
1101385126 12:104250533-104250555 GAGGTTATGCAACTTCCTCAGGG - Intronic
1101819395 12:108172188-108172210 GAGGTTAGGTAACTTGTTCAAGG + Intronic
1101993628 12:109508303-109508325 GAGGTTAAGAAACTTGCTCAGGG - Intronic
1102453780 12:113058652-113058674 GAGATGATGCAACTTGCTCAAGG - Intronic
1102557975 12:113741395-113741417 GAGGTTAAATGAGTTGATCAAGG - Intergenic
1102769827 12:115465881-115465903 GAGGTCATGTAACTTGTTCAAGG - Intergenic
1102776068 12:115520133-115520155 GAGGTTAATCAACTTGTCCAAGG - Intergenic
1102794545 12:115677166-115677188 GAGGTTAGAGCACTTGACCAAGG + Intergenic
1103125735 12:118420849-118420871 GAGGTTAAGTAACTTGCTCAAGG + Intergenic
1103224887 12:119278308-119278330 GAGGTTGAACAACTTGCTCAAGG - Intergenic
1103605762 12:122084982-122085004 GAGGTTACACAACTTGTCCACGG + Intronic
1103967856 12:124651690-124651712 GAGGTTAGGCAACTTGCGCAAGG + Intergenic
1103978648 12:124721181-124721203 GAGGTTAGGTAACTTGCTCAAGG - Intergenic
1104948951 12:132430129-132430151 GAGGTTAGATAACTTGCTCCAGG - Intergenic
1105669990 13:22602763-22602785 GAGGTTACATAACTTACTCAAGG - Intergenic
1105865124 13:24452186-24452208 GAGGTTAAGGAACTTGCTCAAGG + Intronic
1106141851 13:27018461-27018483 GAGGTTAAATAACTTGCCCAAGG - Intergenic
1106425845 13:29628551-29628573 GAGCTTATCCACCATGATCAAGG + Intergenic
1106496098 13:30277379-30277401 GAGGTTAAATAGCTTGCTCAAGG + Intronic
1106719312 13:32422389-32422411 GAAGCTAAACATCTTGATCAGGG - Intronic
1106752538 13:32790017-32790039 GAGGTTATACAACTTGCTCAAGG - Intergenic
1107103238 13:36616879-36616901 GTAGTTAAACAACTGGATCAAGG + Intergenic
1107242914 13:38259233-38259255 GAGGTTAAGTAACTTGCTCAAGG + Intergenic
1107370966 13:39747081-39747103 GAGGTTAAATTACTTGTTCAAGG + Intronic
1107552734 13:41492491-41492513 GAGGTTAAAGAGCTTGCTCAAGG - Intergenic
1107578250 13:41750972-41750994 GAGGTTAAACAATTTGGCCAAGG - Intronic
1107591833 13:41916061-41916083 GAGGTTAAATAACTTGATTAAGG - Intronic
1108065465 13:46572951-46572973 GAGGTTATGGAACTTGCCCAAGG - Intronic
1108110543 13:47066873-47066895 GAGGCTAAAAAACTTGTTCAAGG + Intergenic
1108117398 13:47144545-47144567 GAGGTTACAGAACTTGCTCCAGG - Intergenic
1108375135 13:49807245-49807267 GAGGTTAAACAATTTGCCCAGGG + Intergenic
1110183174 13:72641720-72641742 GAGGTTATAAAACTTCCTCAAGG - Intergenic
1110255848 13:73433142-73433164 GTGGTGAAACAACTTGCTCAAGG - Intergenic
1110963105 13:81656338-81656360 GAGGTCACTCAACATGATCAAGG - Intergenic
1111580327 13:90214202-90214224 GAACTTATACAACTTGCTCTAGG + Intergenic
1112016278 13:95334036-95334058 GAAGTTAGACAACTTGCCCAAGG + Intergenic
1112153810 13:96795433-96795455 GAGGTTATATAACTTTCCCAAGG + Intronic
1112310845 13:98316427-98316449 GAGGTTAAAGAACTTGTTCCAGG + Intronic
1112362985 13:98733754-98733776 GAGGGTAAGCACCTTGATCAAGG - Intronic
1112632161 13:101173448-101173470 GAGGTTAAGTAACTTGCTCAAGG - Intronic
1113374057 13:109747538-109747560 AAGGTTAAACACCTTGCTCAGGG - Intergenic
1114368332 14:22054960-22054982 GAAATTAAACAACTTGCTCATGG + Intergenic
1114740984 14:25096774-25096796 GAAATTAAACAACTTGCTCAAGG - Intergenic
1115175888 14:30560982-30561004 GAGGTTAAACAGCTTGCCCAGGG - Intronic
1115284138 14:31699490-31699512 GAGGTTAAATAACTTGGGCAGGG + Intronic
1115448211 14:33516576-33516598 GAGGTTATAGAACTTGCCCTAGG - Intronic
1115762702 14:36591122-36591144 GAAATTACAAAACTTGATCAAGG - Intergenic
1117034495 14:51714126-51714148 GAGTTTATGTAACTTGCTCAAGG - Intronic
1117991473 14:61438125-61438147 GATGTTAAACAACTTGCCCAGGG + Intronic
1118152789 14:63207748-63207770 GAGGTTAAGTAACTTGCTCAAGG - Intronic
1118270696 14:64339483-64339505 GAGGTGACAAGACTTGATCAAGG + Intergenic
1118377466 14:65189736-65189758 GAGGTTACATAACTTGCTCAGGG + Intergenic
1118604706 14:67494368-67494390 GAGGTTATGCAGCTTTCTCAAGG + Intronic
1118617330 14:67583299-67583321 GAGTTTAAGTAACTTGATCAGGG + Intronic
1119058456 14:71448416-71448438 GAGGTTAAGCAACTTGCCCAAGG + Intronic
1119583026 14:75804735-75804757 GAGGTTAAACAACTTGTCCAAGG - Intronic
1119688046 14:76648626-76648648 GAGGTTAAACAACTTGCTGGAGG - Intergenic
1119769458 14:77211320-77211342 GAGGTTAAACAACTGGCTCAAGG - Intronic
1120385286 14:83838190-83838212 GAGGTTGAACACCTTGTTCAAGG - Intergenic
1120633971 14:86928377-86928399 GAGGTTATAAAACTTGCCCATGG - Intergenic
1120951405 14:90045303-90045325 GAAGTTATATAACCTGATCTAGG - Intergenic
1121228507 14:92339506-92339528 GAGGTTCAATAACTTGCTCAAGG + Intronic
1121555448 14:94833038-94833060 AATGTTCTACACCTTGATCATGG + Intergenic
1122453663 14:101833156-101833178 GAGAGTAAACAACTTGATCAAGG - Intronic
1122541618 14:102500909-102500931 GAGGTTAGGTAACTTGCTCAAGG + Exonic
1122665207 14:103324956-103324978 GGGGTTATACAGCTTGACCGAGG - Intergenic
1126069299 15:44851792-44851814 GAAGTTAAATAACTTGGTCAAGG + Intergenic
1126089512 15:45039004-45039026 GAAGTTAAATAACTTGGTCAAGG - Intronic
1126269399 15:46796514-46796536 GAGATAATTCCACTTGATCATGG - Intergenic
1126953372 15:53907549-53907571 GAGGTTAAGTGACTTGATCAAGG - Intergenic
1127185285 15:56473025-56473047 GAGGTTAAATGACTTGTTCAAGG - Intergenic
1127654320 15:61041952-61041974 GAGGTTAAATAACTTGCCCAAGG + Intronic
1128019600 15:64378974-64378996 CTGGTTATATAACTTGATAAAGG - Intronic
1128145437 15:65330131-65330153 GAGGTTAAGTAACTTGACCAAGG + Intronic
1128241362 15:66103375-66103397 GAGGTTATGTAACTTGCCCAAGG - Intronic
1128462815 15:67884193-67884215 AAGGTTAAACAACTTGCCCAAGG - Intergenic
1128711454 15:69875349-69875371 GAGGGGACATAACTTGATCAAGG + Intergenic
1129229733 15:74190553-74190575 GAGGTTATATAACTTGCCCAAGG + Intronic
1129257321 15:74341090-74341112 GAGGTTAAATAACTTGGTCGAGG - Intronic
1130821870 15:87504518-87504540 GAGGTTAAATAACTTGCTCAAGG - Intergenic
1130895447 15:88166787-88166809 GAGGTTATGTAACGTGCTCAAGG - Intronic
1131030937 15:89185460-89185482 GCGGTTCTACAACTTCCTCATGG + Exonic
1131066422 15:89437446-89437468 GAGGGTATGCAACTTGCCCAAGG + Intergenic
1131082410 15:89547663-89547685 GAGGTCACATAACTTGTTCAAGG - Intergenic
1131249937 15:90823657-90823679 GAAGTTAAATAACTTGCTCAAGG - Intergenic
1132389177 15:101426321-101426343 GAGGTTATGTAAGTTGTTCAAGG + Intronic
1133703417 16:8330893-8330915 GAGGTTAAATAACTTTCTCAAGG + Intergenic
1133849836 16:9492382-9492404 AAGGTTAGAAAAATTGATCAGGG + Intergenic
1133852493 16:9518577-9518599 GAGGTTAAGCAACTTGACCAAGG + Intergenic
1134008988 16:10837271-10837293 GAGATTAAGCAACTTGACCAAGG + Intergenic
1134067214 16:11236542-11236564 GAGGTGAAACAACTTGCTCAAGG - Intergenic
1134071753 16:11264592-11264614 GAGGTGAAACAACTTGGTCAAGG - Intronic
1134199767 16:12188314-12188336 GAGGTTAAGCAACTTGCCCAAGG + Intronic
1134282414 16:12829364-12829386 AAGGTTATAGAACTTGGCCAAGG - Intergenic
1134333257 16:13269802-13269824 GAGGTGATATAACTTGCCCAAGG + Intergenic
1134401971 16:13918601-13918623 GAGGTTATATAACTTGGGCAAGG - Intergenic
1134577080 16:15341573-15341595 GAGGTTAAATAACTTGCTCAAGG - Intergenic
1134725360 16:16414920-16414942 GAGGTTAAATAACTTGCTCAAGG + Intergenic
1134823374 16:17264771-17264793 GAGGTTAAATAACTTGACCGAGG + Intronic
1134942072 16:18296938-18296960 GAGGTTAAATAACTTGCTCAAGG - Intergenic
1135130514 16:19850301-19850323 CAGGTCATGCAACTTGCTCAAGG - Intronic
1135167397 16:20151647-20151669 GAGGTGAAAGAACTTGCTCAAGG + Intergenic
1135172985 16:20202962-20202984 GAGGTTATATCACTTGCCCAAGG + Intergenic
1135471506 16:22735658-22735680 GAGGTTACATAACTTGCCCAAGG - Intergenic
1135581230 16:23628331-23628353 GAGGTTACACAATTTGTCCAAGG + Intronic
1136237362 16:28922965-28922987 GAGGTTAAATAACTTGCCCAAGG - Intronic
1136555927 16:31007913-31007935 GAGGTTAAGCAACTTGCCCAAGG + Intronic
1137261656 16:46835296-46835318 GGGATTATACATCATGATCAAGG + Intergenic
1138038849 16:53639657-53639679 GAGGTTAAGTAACTTGTTCATGG - Intronic
1138052222 16:53791287-53791309 GAGGTTAAGTAACTTGCTCAAGG + Intronic
1138782120 16:59801274-59801296 GAAGTTATGTAACTTGCTCAAGG + Intergenic
1138835196 16:60426143-60426165 GAGGTTAAGCAACTTGCTCAAGG - Intergenic
1139173032 16:64653641-64653663 GAAGTAAGACTACTTGATCATGG - Intergenic
1139588109 16:67917216-67917238 GAGGTTACATAACTTGGCCATGG + Intronic
1139597639 16:67967731-67967753 GCGGTTATATAACTTGCCCAGGG - Intronic
1139672169 16:68499343-68499365 GAGGTTAAGCAACTTGCCCAGGG - Intergenic
1139937447 16:70581780-70581802 GAGGTTATAAAACTTGTTAGGGG + Intronic
1140033598 16:71357156-71357178 CAGGTTATATAATTTGCTCAAGG + Intergenic
1140197411 16:72866520-72866542 CAGGTTATATAACTTGACCAAGG + Intronic
1140251426 16:73297743-73297765 GAGGTTCTATAACTTGCCCAAGG - Intergenic
1140324622 16:73989768-73989790 GAGTTTATTCAACCTGATAAAGG + Intergenic
1140873490 16:79128491-79128513 GAGGTTAAATAACTTGGCCAAGG + Intronic
1141283152 16:82647117-82647139 GAGGTTAAGCAACTTGCCCATGG - Intronic
1141496995 16:84417092-84417114 GAGGTTAACTAACTTGCTCAAGG - Intronic
1141517434 16:84555171-84555193 GAGGTTTTATAACTTGCCCAAGG + Intergenic
1141564962 16:84895195-84895217 GAGGTTAAACGACTTGCCCAAGG + Intronic
1141609998 16:85175873-85175895 GAGGTTAAGCAACTTGTCCAAGG + Intronic
1143505128 17:7359807-7359829 GAGGTTAAATAACTTGCCCACGG - Intergenic
1143589255 17:7871238-7871260 GAGGTTAAATATCTTGCTCAAGG - Intronic
1144105940 17:11985393-11985415 AAGGTTAAATAACTTGCTCAAGG - Intronic
1144175685 17:12704700-12704722 GAGGTTAAGCAACTTGCTTAGGG + Intronic
1144317923 17:14081608-14081630 GAGATTATAAAACTTGCACAAGG - Intronic
1144447950 17:15348635-15348657 GAGGTTAGGTAACTTGACCAAGG + Intergenic
1145840861 17:27993244-27993266 GAACTTAAACAACTTGTTCAAGG + Intergenic
1145900528 17:28488021-28488043 GAGGGTAAACAGCTTGCTCAGGG - Intronic
1146423954 17:32718239-32718261 GAGATGATATATCTTGATCAGGG - Intronic
1146496373 17:33326047-33326069 GAGGTTAAGAAACTTGGTCAAGG + Intronic
1146602118 17:34226757-34226779 GAGATTAAATAACTTGCTCAAGG - Intergenic
1146650772 17:34604918-34604940 AAGGTTAAACAACTTTCTCAAGG + Intronic
1146794060 17:35769156-35769178 GAGGTTAGGTAACTTGCTCAGGG - Intronic
1146912244 17:36656369-36656391 GAGGTCATGCAACTTGTTCAAGG + Intergenic
1146979706 17:37148959-37148981 GAGGTTATATAAGTTGCACAAGG + Intronic
1147008661 17:37425483-37425505 GAGGTTAAGTAACTTGTTCAGGG + Intronic
1147215123 17:38894450-38894472 GAGGTTAAGCAACTTGCCCAAGG - Intronic
1147267820 17:39245394-39245416 GAGGTTAAATAACTTGCCCAAGG + Intergenic
1147552816 17:41456625-41456647 GAGGTTTTATGACTTGACCAGGG + Intergenic
1147657089 17:42097211-42097233 GAGGTTAAGAAACTTGTTCAAGG + Intergenic
1147774006 17:42887682-42887704 GAAGTTAAATAACTTGTTCAAGG - Intergenic
1147887351 17:43693120-43693142 GAAGTTATGCAACTTGCCCAAGG + Intergenic
1147995590 17:44358640-44358662 GAGGTTATACCACTTCAGCCTGG + Intronic
1148171594 17:45525599-45525621 GAGGTTATATAACTTGTCCTAGG + Intergenic
1148364427 17:47042950-47042972 GAGGTTATATAACTTGTCCTGGG - Intronic
1148759479 17:49992089-49992111 GAGGTTAAACAACTTGCCCAAGG - Intronic
1148885078 17:50766530-50766552 GAGGTTATGTAACTTGCCCAAGG - Intergenic
1149456639 17:56793634-56793656 GAGGTTAGGCAACTTGCCCAAGG + Intronic
1149552353 17:57549689-57549711 GAGGTTAAGTAACTTGACCAAGG + Intronic
1150227728 17:63533009-63533031 GAGGTTACAAAACTTGCCCAAGG + Intronic
1150298048 17:64025161-64025183 GAGGTTACACAACTTGCTCAAGG - Intergenic
1150402520 17:64870635-64870657 GAGGTTATATAACTTGTCCTAGG + Intronic
1150845478 17:68653384-68653406 GAGGTTAAATAACTTGTTCAAGG - Intergenic
1151323775 17:73366671-73366693 GAAGTTATACTACTTGTCCAGGG - Intronic
1151400211 17:73850962-73850984 GAGGTTAAACAACCTGCTCAAGG - Intergenic
1152963101 18:92049-92071 GAGGTTCTGCAACTTGACCAGGG + Intergenic
1155082308 18:22422939-22422961 GAGGTGAAGCAACTTGCTCAAGG + Intergenic
1155208150 18:23578280-23578302 GAGGCTAAACAACTTGTCCAAGG + Intronic
1155256304 18:24000925-24000947 GATGTTAAGCAACTTGATCAAGG + Intronic
1155335989 18:24765891-24765913 GAGGTTATACAAATTTCCCAAGG + Intergenic
1155456518 18:26021246-26021268 GAGGTTAAGCAACTTGCCCAAGG - Intronic
1155813111 18:30264037-30264059 GAGGTTAGTTAACTTGCTCAAGG + Intergenic
1155971482 18:32087654-32087676 GAGGTTAAAGAACTCCATCATGG + Intergenic
1156218095 18:35022614-35022636 GAGGTAATACCACTTGATTCTGG + Intronic
1156569521 18:38237458-38237480 GAGGTTAGGCAACATGCTCAAGG + Intergenic
1157190885 18:45580723-45580745 GAGGTCATATAACCTGCTCAAGG + Intronic
1157493652 18:48140421-48140443 GAAGTTTTACAACTTGTTTAAGG + Intronic
1157564367 18:48670017-48670039 GAGGTTAAACAACTTGTACAGGG + Intronic
1157588680 18:48821396-48821418 GAGGTCAGGCAACTTGCTCAGGG + Intronic
1157676136 18:49569927-49569949 GAGGTGAGACAACTTGCCCAGGG + Intronic
1157970875 18:52267299-52267321 GAAGTTTTACATCTTCATCAGGG + Intergenic
1158118372 18:54022430-54022452 GAAGTTAAACAACCTGTTCATGG - Intergenic
1158132415 18:54167363-54167385 GAGGTTATAGACCTTGTCCAAGG - Intronic
1158253383 18:55516205-55516227 GAGGTTAAATGACTTGTTCAAGG - Intronic
1158349866 18:56554228-56554250 AAGGTTATGTAACTTGATCAAGG - Intergenic
1158507535 18:58059993-58060015 GAGGTTAAATAACTTGCCCAGGG + Intronic
1159638259 18:70832513-70832535 AAGATTATACACCATGATCAAGG - Intergenic
1160555899 18:79724969-79724991 CAGGAAATCCAACTTGATCAAGG - Intronic
1161602854 19:5195423-5195445 GAGGTTAAATAACTTGCCCAAGG - Intronic
1161606714 19:5219159-5219181 GAGGTTAAGCCACTTGATCAAGG - Intronic
1161632318 19:5364318-5364340 GAGGTCACACAGCTTGTTCAAGG - Intergenic
1162204770 19:9047416-9047438 GAGATTAAGCAACTTGCTCAAGG - Intergenic
1165217154 19:34283601-34283623 GAGGTTAAGGAACTTGCTCAAGG + Intronic
1165709506 19:37999966-37999988 GAGGTTACGCAACTTTCTCAAGG - Intronic
1168147555 19:54428565-54428587 GAGGTTGGACCACTTGCTCAGGG + Intronic
925422240 2:3722154-3722176 GAGGTTATACAACTTGATCAAGG + Intronic
925912924 2:8584714-8584736 GAAGTTAGACAACTTTCTCAGGG - Intergenic
926048564 2:9728264-9728286 GAGGTTAGGCAACTTGTCCATGG + Intergenic
926575737 2:14578789-14578811 GAGGTTCAATAACTTGCTCATGG - Intergenic
926591275 2:14742741-14742763 GAGGCAAAACAACTTGTTCAAGG - Intergenic
926607461 2:14911794-14911816 GAAGTTAAGCAACTTGTTCAGGG - Intergenic
926809007 2:16739971-16739993 GAGGTTAAGTAACTTGCTCAAGG + Intergenic
927043698 2:19255693-19255715 GAGGTTACACCAGTTGTTCAAGG - Intergenic
927956258 2:27209484-27209506 GAGATTAAATAACTTGCTCAAGG + Intronic
928214600 2:29350798-29350820 GAGGTTAAGCAACTTGTCCAAGG + Intronic
929634674 2:43505876-43505898 GAGGTTAAACCACTTGCCCACGG - Intronic
930406082 2:50957271-50957293 GAGATTAAATAACTTGCTCAAGG - Intronic
931171808 2:59811388-59811410 GAGGTTATATGACTTGATCAAGG - Intergenic
931180610 2:59896629-59896651 GAGGTTAGATGACTTGATCAAGG + Intergenic
931265887 2:60660240-60660262 GAGGTTACACTACTTGCTCAAGG + Intergenic
931585236 2:63819197-63819219 CAGGTTAAATAACTTGTTCAAGG - Intronic
931665289 2:64606185-64606207 GAGGTTGAACAACTTGCCCAAGG + Intergenic
931874609 2:66498352-66498374 GAGGTTAAATAACTTGCCCAGGG + Intronic
932028824 2:68162275-68162297 GAGGTCATCCAACCTGATGAGGG - Exonic
932721330 2:74140862-74140884 GAGGTTGAAAAACTTGCTCAAGG + Intronic
933884544 2:86705859-86705881 GAGGTTAAATAACTTGCTCATGG + Intronic
933998114 2:87684869-87684891 GAGGTTAAACAACTTTCCCACGG + Intergenic
934792200 2:97070781-97070803 GAGGTTAAACAACTTTCCCACGG - Intergenic
934814417 2:97312928-97312950 GAGGTTAAACAACTTTCCCACGG + Intergenic
934823276 2:97395555-97395577 GAGGTTAAACAACTTTCCCACGG - Intergenic
935985384 2:108667357-108667379 GAGGTTAAGCAACTTGCCCAAGG + Intronic
936295738 2:111266004-111266026 GAGGTTAAACAACTTTCCCACGG - Intergenic
936952092 2:117987965-117987987 GAGGTTAAAAAACTTGCTGATGG + Intronic
937459460 2:122073302-122073324 GAGTTTAGCCAACTTGATCTGGG - Intergenic
937492731 2:122386834-122386856 GAGGTTAAATAACTTGTCCAAGG + Intergenic
937968037 2:127529030-127529052 GAGGTTCAGCAACTTGCTCAAGG - Intergenic
938590831 2:132734732-132734754 GAGGTTAAGCAACTTGTCCAAGG + Intronic
938685014 2:133729678-133729700 AAAGTTATGCAACTTGTTCAAGG - Intergenic
938802280 2:134774296-134774318 GAAGTTAAAGAACTTGCTCAAGG - Intergenic
938871092 2:135477411-135477433 GAGGTTATACAACAGGAAGAAGG + Intronic
938927155 2:136054651-136054673 GAGGTTATGCAGCTTGCTCAAGG + Intergenic
939297906 2:140293866-140293888 GAGGTTAAATAACTTGCTCAAGG - Intronic
939965412 2:148605800-148605822 GAGGTTACACAAGTTGCCCAAGG + Intergenic
940148517 2:150573835-150573857 GAGTTGATGCAACTTGCTCAGGG - Intergenic
940527331 2:154833291-154833313 GAGGTTACATAACTTGCTTAAGG - Intronic
940823692 2:158386242-158386264 GAGGTTAAACAACTTGTTCAAGG + Intronic
941260083 2:163286614-163286636 GAAGTTAAAAAACTTGATTAAGG - Intergenic
941579113 2:167273172-167273194 GAGGTTAAACTACTTTACCAAGG + Intergenic
941728053 2:168885804-168885826 GAGGTTAAGCAACTTTCTCAAGG - Intronic
942120934 2:172776225-172776247 GAGGTTAAGCAACTTGTTCAGGG + Intronic
942505863 2:176640932-176640954 GAGGTTATATAACTTGTCCAGGG - Intergenic
942547893 2:177083723-177083745 GAGGTTAAATAACTTGTTCAGGG + Intergenic
942848270 2:180452739-180452761 GAGGTTACATAACATGCTCAAGG - Intergenic
942853086 2:180513612-180513634 GAGGTTAAGTAACTTGCTCAAGG + Intergenic
942877629 2:180820593-180820615 GAGGTTAAATAAATTGTTCAAGG - Intergenic
942886056 2:180925454-180925476 TAGATTATACAAATTGATCCAGG - Intergenic
943750508 2:191504900-191504922 GAGGTTAAGCAACTTGTTTAAGG + Intergenic
944045694 2:195409003-195409025 GAGATTACACAACTTGTTCAAGG + Intergenic
944994375 2:205277297-205277319 GAGGTTAAATATCTTGTTCAAGG - Intronic
945176326 2:207047464-207047486 GAGTTTAAGTAACTTGATCATGG + Intergenic
945584402 2:211640545-211640567 TAGGTTATACAACTTGTCCAAGG + Intronic
945806121 2:214491764-214491786 GAGGTTAAGTAACTTGACCAAGG - Intronic
946049562 2:216850610-216850632 GAAGCTAGACAACTTGTTCAAGG + Intergenic
946070176 2:217028099-217028121 GAGGTTAAAGAACTTGCTCAAGG + Intergenic
946102378 2:217337107-217337129 GAGGTTAAGCAACTTCCTCAAGG + Intronic
946227122 2:218269980-218270002 GAGGTGGTAGAACTTGATCCCGG - Exonic
946403005 2:219478427-219478449 GAGGTTAAATAACTTGCCCAAGG + Intronic
946601494 2:221364809-221364831 GAGATTACATAACTTGTTCAAGG - Intergenic
946828539 2:223704314-223704336 GAGTTTAAGCAACTTGATCAAGG + Intergenic
947082437 2:226413482-226413504 GAGGTTAAACAACTTGCCCAAGG + Intergenic
948295029 2:236854250-236854272 GAGGTTAAGCAACTTGTCCAAGG + Intergenic
949086336 2:242158956-242158978 GAGGTTAGGTAACTTGTTCAAGG + Intergenic
1168793819 20:597871-597893 GAGGTTAAAGAACTTGGCCAAGG - Intergenic
1168798873 20:631140-631162 GTGGTTAAACAACTTGCTCAAGG - Intergenic
1168834361 20:868102-868124 GAGGTTGTGCAACTTGTTTAAGG + Intergenic
1168840600 20:907663-907685 GAGGTTAAACAACTTGTCCAAGG + Intronic
1168913084 20:1465851-1465873 GAGGTTAAGTAACTTGCTCAAGG - Intronic
1168970357 20:1926712-1926734 AAAGTTATAAAACTTGTTCAGGG + Intronic
1169699910 20:8434682-8434704 GAGGTTATGCAATTTGCTTATGG + Intronic
1169853978 20:10083415-10083437 GAGATTAAACAACTTTTTCAAGG - Intergenic
1170441636 20:16385498-16385520 AAGGTTAAATAACTTGTTCATGG - Intronic
1170963209 20:21043832-21043854 GAGGTTAAGGAACTTGCTCAGGG + Intergenic
1171166140 20:22973512-22973534 GAGTAAATACCACTTGATCATGG + Intergenic
1172157949 20:32842491-32842513 GAGGTTAAATAACTTGAGCTAGG + Intronic
1172204100 20:33150030-33150052 GAGGTTATATAAATTGGACAAGG + Intergenic
1172320534 20:33992957-33992979 GATGTTTTATAACTTGATCCAGG - Intergenic
1172457402 20:35088682-35088704 GAGGTTAAATAACTTAATCTTGG + Intronic
1172749763 20:37242594-37242616 GAGGTTAAACTACTTGCCCAAGG - Intergenic
1172999568 20:39095896-39095918 GAGGTCAGGCAACTTGCTCAGGG + Intergenic
1173027220 20:39319577-39319599 GAGGTTAAGCAACTTGCCCAGGG + Intergenic
1173322754 20:42003490-42003512 GAGGTCAGACAAGTTGATAAAGG + Intergenic
1173343918 20:42180932-42180954 GAGATTAAATAACTTGCTCAAGG - Intronic
1173583428 20:44163637-44163659 GAGGTTAAGCAATTTGACCAAGG + Intronic
1173841022 20:46157395-46157417 GAGGTTAAGTAACTTGCTCAAGG + Intergenic
1173969469 20:47140667-47140689 AAGGTTAGGCAACTTGTTCAAGG - Intronic
1174146117 20:48453799-48453821 CAGGTTAAAAAACTTGCTCAAGG - Intergenic
1174257911 20:49272139-49272161 GAAATTATACAACTTGGCCAAGG - Intronic
1174356056 20:49998645-49998667 GAGGTTGAACAACTTGCTCTAGG - Intergenic
1174595628 20:51681122-51681144 CAGGTTAAGCAACTTGTTCAAGG - Intronic
1174857133 20:54056964-54056986 GAGGTTATGTAACTTGCTCAAGG + Intronic
1174904121 20:54532245-54532267 GAGGTTAAACAACCTGCCCAAGG + Intronic
1175119279 20:56705876-56705898 AAGATCACACAACTTGATCATGG - Intergenic
1175409210 20:58754910-58754932 GAGGTCACACAACTTGCTCAAGG - Intergenic
1177710413 21:24766607-24766629 GAGATTATAAAACTTTCTCAAGG + Intergenic
1178105802 21:29317896-29317918 GAGGTTAAGCAACTTGGCCAAGG + Intronic
1178217579 21:30617660-30617682 CAAGTTATACAACTAGATAATGG + Intergenic
1178462074 21:32811470-32811492 GAGGTTAAATAACTTGTCCAAGG + Intronic
1178709815 21:34906551-34906573 GAAGTTAGACAACTTGCCCAAGG + Intronic
1179594740 21:42435102-42435124 GAGGTTAAGCAACTTGCCCAAGG + Intronic
1180743802 22:18072955-18072977 GAGGTTAAATAACTTGTCCAAGG - Intergenic
1181791204 22:25268091-25268113 GAGGTCAAGCAACTTGCTCAAGG - Intergenic
1181983197 22:26781246-26781268 GAGGTTAAGCAACTTGCCCATGG + Intergenic
1182041375 22:27241349-27241371 GAGGTTAAGTAACTTGCTCAAGG - Intergenic
1182081756 22:27534195-27534217 GAGGTTAAGTAACTTGCTCAAGG - Intergenic
1182227793 22:28813089-28813111 GAGGTTAAGCAACTTGTCCAAGG - Intergenic
1182311422 22:29411299-29411321 AAGGTTATATAACTTGCCCAAGG + Intronic
1182469134 22:30536607-30536629 AAGGTTAAACCACTTGACCAAGG - Intronic
1182566067 22:31200431-31200453 GAGGTGAAATAACTTGACCAAGG - Intronic
1182713251 22:32335600-32335622 GAGGTGATGCAACTTGCCCAAGG + Intergenic
1182769939 22:32787460-32787482 GAGGTTAAATCACTTGCTCAAGG - Intronic
1182770474 22:32792197-32792219 GAGGTTAAGGAACTTGTTCAAGG + Intronic
1182871227 22:33649590-33649612 GAAGTTATGCAACTGGATCAAGG + Intronic
1183016178 22:34989503-34989525 GAGGTTAAGTAACTTGCTCAAGG - Intergenic
1183383390 22:37501688-37501710 GAGGTTAAGCAACTTGCCCAGGG - Intronic
1183945207 22:41321738-41321760 GAGGTTAAGCAACTTGTTTAAGG + Intronic
1184001382 22:41676421-41676443 GAAGTTAAACACCTTGCTCAAGG - Intronic
1184043219 22:41956749-41956771 GAGGTTAGGCAACTTGCCCAAGG + Intergenic
1184272870 22:43394797-43394819 GAGGTTAAACAGCATGACCAAGG + Intergenic
1184400514 22:44271180-44271202 GAGGTGATGCAACTTGCCCAAGG + Intronic
1184410706 22:44324640-44324662 GGGGTTATATAACTTGCCCAAGG + Intergenic
1184446274 22:44548907-44548929 GAGGTTAATGAACTTGGTCAAGG + Intergenic
1184825135 22:46945475-46945497 GAGATTGAATAACTTGATCAAGG + Intronic
949473031 3:4416616-4416638 GAGGTTAACTAACTTGCTCAAGG - Intronic
949644952 3:6082702-6082724 GAAGTTAAATAACTTGTTCAGGG + Intergenic
949801849 3:7912804-7912826 CAGGTTAAAAAACTTGTTCAAGG - Intergenic
949857778 3:8477746-8477768 GAGGTTAAGGAACTTGGTCAAGG + Intergenic
950148476 3:10668277-10668299 GAGGTTAAGCGACTTGGTCATGG + Intronic
950673844 3:14542844-14542866 GAGGTTAAGCAACTTGCCCAAGG + Intergenic
951064633 3:18249574-18249596 GAAGCTAAACAACTTGCTCAAGG + Intronic
951106329 3:18747568-18747590 GAGGTTAGGCAACTTGCCCAAGG + Intergenic
951127310 3:18998720-18998742 GAGGTTGAGCAACTTGTTCAAGG - Intergenic
951484681 3:23198897-23198919 GAAGTTAAACCACTTGCTCATGG + Intergenic
951808223 3:26670699-26670721 GAGGTTAAGGAACTTGTTCAAGG - Intronic
952148113 3:30555843-30555865 GAATTTATATAACTTGACCAAGG + Intergenic
952535089 3:34300839-34300861 GAGGTATGAAAACTTGATCAGGG + Intergenic
952597875 3:35041242-35041264 GAGGTTATTAAAATTGCTCAAGG - Intergenic
952825382 3:37520422-37520444 GAGGTTATTTAACTTGCCCAAGG + Intronic
952842954 3:37663801-37663823 GATGTTAAGCAACTTGCTCAAGG - Intronic
952934241 3:38383226-38383248 GTGGTTAAATAACTTGGTCAGGG + Intronic
952979810 3:38725537-38725559 GAGGTTAAACAACTTGCCTAAGG - Intronic
953258476 3:41313217-41313239 GAGGTTAAATAACTTGCTCATGG - Intronic
953414301 3:42706883-42706905 GAGGTTAAATAACTTGCCCAAGG + Intronic
953440837 3:42915667-42915689 GAGGTTATAAAACTCATTCAGGG + Exonic
953475215 3:43200222-43200244 GAGGTTAAACAACTTGCTCCAGG - Intergenic
954766471 3:52922073-52922095 GAGGTTATACAGCTTGAGCAAGG - Intronic
954851330 3:53603367-53603389 GAGGTTACAAAACTTGCCCAAGG - Intronic
954977838 3:54713462-54713484 CAGGCTATACAACGTGATCCAGG - Intronic
955071096 3:55572991-55573013 GAAGTTAAGCAACTTGTTCAAGG - Intronic
955128000 3:56133601-56133623 GAGGATGTATAACTTGCTCAAGG - Intronic
955408552 3:58641347-58641369 GAGGTTAAGCAACTTGCCCAAGG - Intronic
955496112 3:59534440-59534462 GAGGTTAAGTAACTTGACCAAGG - Intergenic
955515175 3:59719305-59719327 GATGTTAAATAACTTGTTCAAGG - Intergenic
955592853 3:60556582-60556604 GAAGTCAAGCAACTTGATCAAGG + Intronic
955928501 3:64031713-64031735 GAGGTTAAGCAATTTGACCAAGG + Intergenic
955983025 3:64546481-64546503 AAGGTTATGCAACTTGCCCAAGG + Intronic
956240372 3:67123379-67123401 GAGGTTAAATAACTTACTCAAGG - Intergenic
956309990 3:67868572-67868594 GAGATTAAATAGCTTGATCAAGG + Intergenic
956366751 3:68512065-68512087 GAAGTTAAATCACTTGATCAAGG + Intronic
956433570 3:69211282-69211304 GAGATTAAACAACATGCTCAAGG + Intronic
956567419 3:70654650-70654672 GAGGTTAGATAACTTGCCCAAGG + Intergenic
956892105 3:73623494-73623516 GAGGTTAAGCAGCTTGCTCAAGG + Intronic
957924014 3:86785318-86785340 GAAGTTAAACAACTTGTACAAGG + Intergenic
958818382 3:98943945-98943967 GAGGTTAGATGACTTGCTCAAGG + Intergenic
959086332 3:101854234-101854256 GAGGTTAAATAACTTGCCCAAGG - Intronic
959400239 3:105892033-105892055 GAATTAAAACAACTTGATCAAGG - Intergenic
959559203 3:107760097-107760119 GAAGTTATATAACTTGTTTAAGG + Intronic
959695264 3:109242749-109242771 GAGGTTATCAAAATTGATCCAGG + Intergenic
959855026 3:111143002-111143024 AAGGTTATGCAATTTGACCAAGG - Intronic
960151243 3:114251054-114251076 AAGGTTAGACAACTTGCTCTAGG - Intergenic
960610531 3:119551225-119551247 GAGGTTACCCAGCTTGCTCAAGG - Intronic
961222022 3:125208607-125208629 GAGGTTACGAAACTTGTTCAAGG + Intronic
961326857 3:126113963-126113985 GAGGTTAGGTAACTTGCTCAAGG + Intronic
961905173 3:130255663-130255685 GAAGTTAAATAACTTGCTCAAGG + Intergenic
962145748 3:132837809-132837831 GAGGTTAAGCAACTTGCCCAAGG - Intergenic
962459797 3:135599787-135599809 GAGGTTAATGAACTTGCTCAAGG - Intergenic
962877706 3:139548503-139548525 GAGGTTTTATAACTAGCTCAAGG + Intergenic
963038737 3:141053074-141053096 GAGGTTAGAGAACTTGCCCAAGG - Intronic
963599322 3:147364277-147364299 GAGATTCTCCAATTTGATCAAGG - Intergenic
963713327 3:148773191-148773213 GAGGTTAAGTGACTTGATCAAGG - Intergenic
963930100 3:150995105-150995127 GAAGTTAAGCAACTTGTTCAAGG - Intergenic
963940171 3:151089448-151089470 GAGGCTATGCAACTTGCCCAAGG - Intronic
964121844 3:153193467-153193489 GAGGTTAAATAACTTGCCCAAGG + Intergenic
964760363 3:160129925-160129947 GAGGTTAAATGACTTGCTCAAGG - Intergenic
964841568 3:160999235-160999257 GAGGTTAAGTAACTTGCTCAAGG + Intronic
964980949 3:162678118-162678140 GAGGCTAAACAACTTGCTAAAGG + Intergenic
965629138 3:170712771-170712793 GGGGTTACATAACTTGTTCAAGG + Intronic
965638491 3:170808697-170808719 GAGGTTAAATAACTTGCCCAAGG - Intronic
965972165 3:174572955-174572977 GAAGTTAAGTAACTTGATCAAGG + Intronic
966623508 3:181991766-181991788 GTGGGCATACAAGTTGATCAGGG + Intergenic
966949325 3:184802032-184802054 GAGGTTAAACGACTTCACCAAGG + Intergenic
966966227 3:184997308-184997330 GAGGTTAAATAACTTGTCCAAGG - Intronic
967341212 3:188400342-188400364 GAGGTTGAATAACTTGCTCAAGG - Intronic
967355615 3:188567242-188567264 GAGGTTAAGGAACTTGTTCAAGG - Intronic
967536675 3:190612644-190612666 AAGATTTTTCAACTTGATCATGG + Intronic
967775085 3:193377911-193377933 GAGGTTAAATAACTTGCCCAAGG - Intronic
968324036 3:197796711-197796733 GAGATTAAATAATTTGATCAAGG + Intronic
969090003 4:4686568-4686590 GAGGTTAAGCAACTTGTTCAAGG + Intergenic
969201119 4:5606894-5606916 AAGGTTAAATAACTTGCTCAAGG + Intronic
969608793 4:8215858-8215880 GAGGTCAGATAACTTGACCACGG + Intronic
970050689 4:11911596-11911618 GGGGTTATATCACTTGCTCAAGG + Intergenic
970065234 4:12086094-12086116 GAGATTATATGACTTGTTCAAGG + Intergenic
970498258 4:16650172-16650194 GAGGTTAGAAAATTTGCTCAAGG - Intronic
970603407 4:17658165-17658187 GAGATTTTGCAACTTGCTCAGGG - Intronic
971263784 4:25080311-25080333 GAGGTTAAAGAACTTACTCAAGG + Intergenic
971340147 4:25760920-25760942 GTGGTTAAACAACTTGCCCAAGG + Intronic
972294899 4:37728285-37728307 GAGGTTAAGCAACTTGCCCAAGG - Intergenic
972333736 4:38086989-38087011 GAGGTTTTATAACTTGGCCAAGG - Intronic
972366553 4:38380996-38381018 GAGGTTAAGTAACTTGTTCAAGG + Intergenic
972388490 4:38590567-38590589 GAGATTAAATAACTTGCTCATGG - Intergenic
972428522 4:38958251-38958273 GAGGTTAAGAAACTTGTTCAAGG - Intergenic
972658632 4:41091879-41091901 GTGGTTAGAAAACTTGCTCAAGG - Intronic
973197967 4:47467212-47467234 GAGTTTATCCAACTTGTCCAAGG - Intergenic
973264344 4:48196364-48196386 GAGGTTAAGTAACTTGTTCAAGG - Intronic
973541900 4:51943140-51943162 GAGGATAAATAACTTGATGAAGG + Intergenic
973798269 4:54450731-54450753 GAGATTATCTAACTTGCTCAAGG - Intergenic
973832370 4:54774454-54774476 GGAGTTAAACAACTTGCTCAAGG + Intergenic
974047775 4:56911664-56911686 GAGGTTAAACAACTTGTGCAAGG - Intronic
974103683 4:57444018-57444040 GAGGTTAAACAATTTGCTCCAGG + Intergenic
974828278 4:67156792-67156814 GAGGTTAAGCTACTTGTTCAAGG - Intergenic
975106873 4:70577483-70577505 GAGCTTTTACAACTTGCTCCAGG - Intergenic
975211560 4:71706553-71706575 GAGGTCATATAACTTGTTCAAGG - Intergenic
975278843 4:72536633-72536655 AAGGTTAAATAACTTGCTCAAGG + Intronic
975382795 4:73721746-73721768 GAGGATATGCAGCTTGTTCAAGG - Intergenic
975619120 4:76277774-76277796 GAATTTATGTAACTTGATCATGG + Intronic
975811000 4:78169428-78169450 GAGGTTAAGCAACTTGACAAAGG - Intronic
975822487 4:78286105-78286127 GAGATTAAACAACTTGCCCATGG - Intronic
976158578 4:82174120-82174142 GAGATTAAGAAACTTGATCAAGG + Intergenic
976644776 4:87375956-87375978 GAGGTTAAGTAACTTGGTCAAGG - Intronic
976659943 4:87530192-87530214 GAGGTTATATAACTTGTCCCGGG - Intronic
976804492 4:89031435-89031457 GAGGTTATATGACTTGTGCAAGG - Intronic
977094626 4:92724666-92724688 GAGGTTAAGTAACTTGTTCAAGG - Intronic
977568326 4:98604872-98604894 GATGTTATGCAGCTTGCTCAGGG + Intronic
977961531 4:103090585-103090607 GAGTTCAGACAACTTGCTCAAGG - Intronic
978215596 4:106198187-106198209 GAGGTTAACTAACTTGACCAAGG - Intronic
978612907 4:110564219-110564241 GAAGTTATAGAACTTGCACAAGG + Exonic
979238058 4:118423935-118423957 GAGGTTAGGTAACTTGTTCAAGG + Intergenic
979319997 4:119312077-119312099 GAGGTTATATAACTTGCCCAAGG - Intergenic
980866429 4:138558524-138558546 GAGGTTATGGACCTTGATTAAGG + Intergenic
980946537 4:139326265-139326287 GAGGTTATATAATTTGGCCAAGG - Intronic
981312562 4:143311509-143311531 GAAGTTAGATAACTTGCTCAGGG + Intergenic
981431517 4:144666825-144666847 GAGGTTAAACAACTTGCCCAAGG - Intronic
981714921 4:147743430-147743452 GAAGTTAAACAACTTGCCCAAGG - Intronic
981887814 4:149698845-149698867 GATGTGATACAACTTGTTGAGGG - Intergenic
981909438 4:149961842-149961864 GAGATTGTACAACTTCATTATGG - Intergenic
982057460 4:151566873-151566895 GAGGTTAAATAACTTGCTTAAGG + Intronic
982156148 4:152522832-152522854 GAGGTTAAACAACTTGCCAAAGG + Intronic
982165167 4:152607611-152607633 GAGGTTAAGCAACTTGCTGAGGG - Intergenic
982394801 4:154904626-154904648 GAGGGTATATAACTTGCTTAAGG + Intergenic
982803338 4:159731839-159731861 GAGGTTAAATAACTTGTCCAGGG + Intergenic
983573615 4:169236526-169236548 GAGGTTACATAACTTGTTTAAGG - Intronic
983861517 4:172712923-172712945 GAGGTTATATAATCTGCTCAAGG - Intronic
984370244 4:178855021-178855043 GATGTTATGCAACTTGCCCAAGG + Intergenic
984539055 4:181014300-181014322 GAGTTTAAACAACTTGTCCAAGG - Intergenic
984908689 4:184652033-184652055 GAGGTGACAGAACTTGATCTGGG + Exonic
985031264 4:185792911-185792933 GAAGTTAAACAACTTGCACAGGG - Intronic
986056221 5:4139507-4139529 GAGGTTAAATAACATGAGCAAGG + Intergenic
987135524 5:14896390-14896412 GAGGTTAGGTAACTTGCTCAAGG - Intergenic
988302683 5:29451346-29451368 GAGATTAAACAACTTGTTGAGGG + Intergenic
988901153 5:35733859-35733881 GAGGTTAAACAGCTTGTACAAGG - Intronic
988964745 5:36404584-36404606 GAAGTTACACAACTTGACCAAGG - Intergenic
989128348 5:38078935-38078957 GAGGTTAAGTAACTTGTTCATGG + Intergenic
989162227 5:38402338-38402360 GAGATTAAATAACTTGCTCAAGG - Intronic
990020858 5:51125713-51125735 GAGGTTAAATAACTTGTCCAAGG - Intergenic
990481522 5:56215707-56215729 GAGGTTACATAACTTGCCCAAGG - Intronic
990672746 5:58151024-58151046 GAGGTTTTATATCTTGCTCATGG + Intergenic
990930119 5:61079695-61079717 GAAGTTCTGCAACTTGATAAAGG - Intronic
991254550 5:64599806-64599828 GAAGTTAAACAACTTGTTCCAGG - Intronic
991412789 5:66361544-66361566 GAGGTTAAACAACTGGCTCTGGG + Intergenic
991559603 5:67935616-67935638 CAGGTTATGTAACTTGTTCAAGG + Intergenic
991614117 5:68478333-68478355 GAGGTTAAATAACTTGTTCAGGG + Intergenic
992365962 5:76089799-76089821 GAGGTTAAGAAACTTGTTCATGG - Intronic
992578757 5:78149300-78149322 GAGGTTATGTAACTTGCCCAAGG - Intronic
993129667 5:83879621-83879643 GAGGCTACACAGCTTGACCAAGG - Intergenic
993225125 5:85159966-85159988 GAGGTTTAACAACTTGCCCAAGG + Intergenic
993564931 5:89462004-89462026 GAGACTCCACAACTTGATCAGGG + Intergenic
993650925 5:90521158-90521180 GAGGTTAAACAACTTGCCCCAGG - Intronic
993661211 5:90637160-90637182 GAGGTTAAGTAACTTGCTCAAGG + Intronic
993978964 5:94518565-94518587 GATTTCATACAACATGATCAGGG + Intronic
994176484 5:96717594-96717616 GAGGTTAAGCAACTTGCTCAAGG + Intronic
994686624 5:102962626-102962648 GAAGTTAGTCAAGTTGATCAAGG + Intronic
994759447 5:103834742-103834764 GAGGTTAAACAACTTGTCCATGG + Intergenic
994922334 5:106063702-106063724 GAGGGTATACAACATGACAATGG - Intergenic
995132010 5:108640785-108640807 GAGGTTAAGTAACTTGCTCAAGG + Intergenic
995487065 5:112650065-112650087 GCGGTTATGCAACTTGCCCAAGG + Intergenic
996045414 5:118867540-118867562 GAGGTTAGGTAACTTGCTCAAGG - Intronic
996607952 5:125346009-125346031 GAGGTTAGGCAACTTGCCCAGGG + Intergenic
997404801 5:133636936-133636958 GAGGTTAGGCAACTTATTCATGG + Intergenic
997593982 5:135094199-135094221 GAGGTTAAACAACTTGCTTAAGG - Intronic
997619168 5:135273532-135273554 GAGGTTAAGCAAGTTGCTCAGGG - Intronic
997767780 5:136522666-136522688 GAGGTTAATTAACTTGAGCAGGG + Intergenic
997803525 5:136890499-136890521 GAGGTTAAATAACTTGCCCAAGG - Intergenic
997859291 5:137401775-137401797 GAGGTTATATAATTTTCTCAAGG + Intronic
997883214 5:137609121-137609143 GAGGTTAAACAGCTTGCACAGGG - Intergenic
998371717 5:141666222-141666244 GAGGTTAAATAACTTGTCCAGGG + Intronic
998506487 5:142676497-142676519 GAGGTTGTGTAACTTGACCAGGG + Intronic
998693014 5:144608354-144608376 GAGGTTAAAGGACTTGCTCAAGG - Intergenic
998769661 5:145527720-145527742 GAAGTTAAACAACTTGCTGAAGG - Intronic
998785889 5:145708349-145708371 GAGGTTAAGCAACTTGCTTAAGG - Intronic
998901327 5:146858160-146858182 GAGGTTAAATAACTTGCCCAAGG + Intronic
999060941 5:148634427-148634449 GAGGTTGAATAACTTGTTCAAGG - Intronic
999197132 5:149790040-149790062 GAGGTTAGGCAACTTGCCCAAGG - Intronic
999828223 5:155294427-155294449 GAGGTTAAGTAACTTGTTCAAGG + Intergenic
1000039008 5:157471226-157471248 GAGGTTAAGCAACTTGGCCAGGG - Intronic
1000126975 5:158255033-158255055 GAGGTTAAGCAACTTGCCCAAGG + Intergenic
1000298886 5:159937339-159937361 GAGTTTAAACAACTTGCCCAGGG + Intronic
1000322009 5:160141953-160141975 GAGGTTAAATAACTTGCTCAAGG + Intergenic
1001028248 5:168242516-168242538 GTGGTTACAAAACTTGCTCAAGG - Intronic
1001143698 5:169166040-169166062 GAGGTTAAATAACTTGCCCAAGG + Intronic
1001971036 5:175955141-175955163 GAGGTTAGAGAACTTGTCCAGGG - Intronic
1002202775 5:177539836-177539858 GAAGTTAAATAACTTGCTCAAGG - Intronic
1002246406 5:177888636-177888658 GAGGTTAGAGAACTTGTCCAGGG + Intergenic
1002738486 5:181415911-181415933 GAGGTTAGGTAACTTGTTCAAGG + Intergenic
1004211127 6:13645615-13645637 AAGGTTAAATAACTTGCTCATGG + Intronic
1004596559 6:17104833-17104855 GAGGTTAAATAACTTGAAAAAGG - Intronic
1006643313 6:35499388-35499410 GAGGTTAAGCAACTTGCCCACGG - Intronic
1006864644 6:37199578-37199600 GAGGTTAAGCAACTTATTCAAGG - Intergenic
1006901635 6:37506341-37506363 GAGGTTAAATAACTTGCCCAAGG - Intergenic
1006928850 6:37675249-37675271 GAGGTTAAACAACTTTCCCAAGG - Intronic
1007096673 6:39217577-39217599 GAGGTTATGTAACTTGCCCAAGG - Intronic
1007508360 6:42355905-42355927 AAGGTTATAGAAGGTGATCATGG + Intronic
1007758748 6:44119060-44119082 GAGGTTAAATAACTTGCCCAAGG + Intronic
1007766458 6:44163195-44163217 GAGGTCAAACAACTTGCCCAAGG + Intronic
1008206894 6:48671152-48671174 GAGGAGATAATACTTGATCAAGG - Intergenic
1008515824 6:52318393-52318415 AAGGTTATACAGCTTCTTCAAGG + Intergenic
1008937351 6:57006122-57006144 GTGGTTAAACAACTTGCACAAGG - Intronic
1008967022 6:57323001-57323023 GAAGTTATGTAACTTGTTCAGGG - Intronic
1011561786 6:88626099-88626121 GGAGTTATATAATTTGATCAGGG + Intronic
1011563027 6:88642685-88642707 GAGGTTAAATAACTTGCCCATGG - Intronic
1011718416 6:90130543-90130565 GAGGTTAGATAACTTGCTTATGG + Intronic
1011759950 6:90552909-90552931 GAGGTTAAATAACTTGCTTAAGG - Intronic
1012050726 6:94340489-94340511 GAGATTAAACAACTTGATGAAGG + Intergenic
1012303890 6:97626095-97626117 GAAGTTAAATAACTTGCTCAAGG + Intergenic
1012332938 6:98016694-98016716 GAGGTTATGTAACCTGATCAAGG - Intergenic
1012522475 6:100137417-100137439 AATGTTATACTATTTGATCAAGG - Intergenic
1012592708 6:101002214-101002236 GAGGTTAATTAACTTGCTCAAGG + Intergenic
1013599127 6:111687855-111687877 CAGGTTAAGCAACTTGTTCAAGG + Intronic
1013959345 6:115880327-115880349 GAGGTTAAGCAACTGGACCAAGG + Intergenic
1014541315 6:122679594-122679616 GAGTTTATATGACTTGATCATGG + Intronic
1015117511 6:129665763-129665785 GAGGTTAAGCAATTTAATCAAGG - Intronic
1015166259 6:130203331-130203353 AAGGTTATATAACTTGTCCAAGG + Intronic
1015788226 6:136940122-136940144 GAGATTGTACAAATTGATCGAGG + Intergenic
1015937264 6:138416161-138416183 GGGTTTATACAACTAGATAAAGG + Exonic
1016806478 6:148217245-148217267 GAGGTTAAGCAACTTGCCCAAGG - Intergenic
1017398426 6:154030273-154030295 GAGGTTCTAAAACTTGATTAAGG + Intronic
1017452975 6:154571655-154571677 GAGGTTAAATGACTTGCTCAAGG - Intergenic
1019243589 6:170691463-170691485 GAGGTTAGGTAACTTGTTCAAGG + Intergenic
1019559584 7:1649296-1649318 GAGGTCATATAACTTGCTGATGG - Intergenic
1020437721 7:8183610-8183632 AAGGTTAAATAACTTGCTCAGGG - Intronic
1020701999 7:11496451-11496473 AAGGTTACACAAGTTGATGATGG + Intronic
1021210518 7:17846798-17846820 GAGGTGATACAATTTGAAGAAGG - Intronic
1021512086 7:21444480-21444502 GAGGTTAAATAATTTGCTCATGG + Intronic
1021554248 7:21903657-21903679 GAGGTTATACACCTATTTCATGG + Intronic
1021670789 7:23032994-23033016 GAAGTTAACCAACTTGATCAAGG + Intergenic
1022012277 7:26318930-26318952 GAGGTTAAGTAACTTGTTCAAGG + Intronic
1022194040 7:28046258-28046280 GAAGTTAAGCAACTTGCTCAAGG + Intronic
1022195207 7:28058542-28058564 TAGTTTAACCAACTTGATCAGGG + Intronic
1023064487 7:36363704-36363726 GAAGTTATGTAACTTGGTCAGGG - Intronic
1023356284 7:39370426-39370448 GAGGTTGTGGAACTTGAGCAGGG + Intronic
1023628049 7:42136367-42136389 GAGATTATACAGCCTGCTCATGG - Intronic
1023901511 7:44484489-44484511 AAGGTTATACTGCTTGTTCAAGG + Intronic
1026198282 7:68191992-68192014 GAGGTTAAACAAATTGATCAAGG - Intergenic
1026374532 7:69737394-69737416 GAGGTTAGATAACTTGCTCAAGG + Intronic
1027251745 7:76403058-76403080 GAGATTAGACAACTTACTCAGGG + Intronic
1027414832 7:77963850-77963872 GAGGTTAAATAACTTGCCCAAGG - Intergenic
1027422123 7:78027026-78027048 GAGGTTAAGGAACTTGTTCAAGG + Intronic
1027508327 7:79046619-79046641 GAGTTTACAAAACTTGTTCAAGG + Intronic
1027759470 7:82259821-82259843 GAGGTTAAGTAACTTGTTCAAGG - Intronic
1028016867 7:85726542-85726564 GAGGTTAAAAAACTTGAAGAAGG + Intergenic
1028104485 7:86861028-86861050 GAAATAATACAACTTGATCCTGG + Intronic
1028487470 7:91375646-91375668 GAGGTTAAAAGACTTGACCAAGG - Intergenic
1028551516 7:92072920-92072942 GAAGTTAAATAACTTGATCATGG + Intronic
1028845143 7:95471907-95471929 GAGGTTAAATAACTTGCCCAAGG + Intergenic
1028995817 7:97098759-97098781 GAGGTTAAACAACTAGCCCAAGG + Intergenic
1029063118 7:97819280-97819302 GAGGTTAAATAACTTGTTCAAGG - Intergenic
1029581790 7:101441179-101441201 GAGGTTAAGCAACTTTGTCAAGG - Intronic
1029940310 7:104473618-104473640 GTGGTTATGTAACTTGTTCAAGG - Intronic
1030665937 7:112278644-112278666 AAGGTTAAATAACTTGGTCAGGG + Intronic
1030916418 7:115319766-115319788 GAGGTTAAATAACTTGCCCAAGG - Intergenic
1031883585 7:127222772-127222794 GAAGTTAAATAACTTGATCAAGG + Intronic
1032822492 7:135537023-135537045 GAGGTTAGGCAAGTTGCTCAAGG - Intergenic
1033356000 7:140600966-140600988 GAGGTTAGATAACTTGTTTAAGG + Intronic
1033434492 7:141320797-141320819 GAGGTAAGATAACTTGCTCAAGG + Intronic
1033709189 7:143921976-143921998 AAAGTTATACAGCATGATCAAGG + Intergenic
1034007852 7:147493910-147493932 GAGGTGATGCAACTTCAGCATGG + Intronic
1034111921 7:148545373-148545395 GAGGTAAAGCAACTTGATCAAGG - Intergenic
1034213234 7:149383199-149383221 GAGGTTAGATAACTTGTTTAAGG + Intergenic
1034932605 7:155174312-155174334 GAGGTTAGGTAACTTGCTCAAGG - Intergenic
1035504533 8:116697-116719 GAGGTTAGGTAACTTGTTCAAGG - Intergenic
1036388050 8:8298743-8298765 GATGTTAGAGAACTTTATCATGG - Intergenic
1037438336 8:18888440-18888462 GAGGTTAAATAACTTGCTCAAGG - Intronic
1038534676 8:28345318-28345340 GAGGTTCAATAACTTGCTCAAGG - Intergenic
1038619718 8:29129924-29129946 GAGGTTATTGAACTTGCTCAGGG + Intronic
1038672026 8:29590380-29590402 GAGCTTAAATAACTTGCTCATGG + Intergenic
1038746529 8:30259782-30259804 GAGGTTATACACCTCGCCCAGGG - Intergenic
1039223954 8:35367140-35367162 GAGCATTTCCAACTTGATCATGG + Intronic
1039591096 8:38749539-38749561 AAGGTTATACACTATGATCAAGG + Intronic
1039904949 8:41779763-41779785 GAGGTTAAAAAACTTGCCCAAGG + Intronic
1041076387 8:54174069-54174091 GAGGTTAATAAACTTGCTCAAGG + Intergenic
1041694973 8:60726368-60726390 GAGGTTAAGTAACTGGATCAAGG + Intronic
1041808101 8:61876265-61876287 GAGGTCGTGCAACTTGCTCAAGG - Intergenic
1042092149 8:65170171-65170193 GATATTATACAACTCGCTCAAGG - Intergenic
1042228671 8:66535568-66535590 GAGGTTCAATAACTTGCTCAAGG + Intergenic
1042526192 8:69767448-69767470 GAGCTTAAGCAACTTGCTCAAGG - Intronic
1043029263 8:75111599-75111621 GAGATAATGCCACTTGATCATGG + Intergenic
1043129580 8:76444304-76444326 GAGTTTATATAACCTGTTCAGGG - Intergenic
1043337863 8:79199402-79199424 GAAGTTAAACAACTTTCTCAGGG + Intergenic
1043939529 8:86181087-86181109 GAGGTTAAGTAACTTGTTCAAGG - Intergenic
1044193467 8:89346826-89346848 GAGGTTAAACAACTTGTCCAAGG + Intergenic
1044399513 8:91754282-91754304 GAGGTTATTTAAATTGCTCAAGG + Intergenic
1044452062 8:92348114-92348136 GAGATTATATAACTTGCTCAAGG - Intergenic
1044613206 8:94114727-94114749 AAGGTTATGTAACTTGCTCAAGG - Intergenic
1044691018 8:94878522-94878544 GAGGTTATACTATTTGATGAAGG + Intronic
1044832536 8:96263436-96263458 AAGGTTATGCAACTTAATTAAGG - Intronic
1045008302 8:97935448-97935470 GAGGTTAAATAACTTGTCCAAGG + Intronic
1045234535 8:100339086-100339108 GAGGTTATGTGACTTGTTCAGGG + Intronic
1045421778 8:102023563-102023585 GAGTTTACACAATTTGGTCAAGG - Intronic
1045651233 8:104343228-104343250 GAGGTTAAACAACTTGGTCAAGG - Intronic
1046103483 8:109641478-109641500 GAGGTTAAGCAACTTGCTGAAGG + Intronic
1046477003 8:114758587-114758609 GAGGTTATACAATGTGTCCAAGG + Intergenic
1046743308 8:117851048-117851070 GAGATGTTTCAACTTGATCAAGG + Intronic
1047502624 8:125453996-125454018 GAGGTTAAATAACTTGCCCACGG + Intergenic
1047515037 8:125546644-125546666 GAGGTTAAGCAACTTGCTCTAGG + Intergenic
1047526267 8:125637006-125637028 GAGGTTAAGAAACTTGTTCAAGG - Intergenic
1047695617 8:127400921-127400943 GAGGTTAAGCAATTTGACCAGGG - Intergenic
1047720257 8:127632430-127632452 TATGTTATACAACTTCCTCAAGG - Intergenic
1047796736 8:128264592-128264614 GAGGTCATGTAACTTGCTCAAGG + Intergenic
1048344351 8:133565789-133565811 GAGGTTAAACAACGTGCCCAAGG + Intronic
1048395298 8:134008914-134008936 AAGGTTATATAACTTAACCAAGG + Intergenic
1048421030 8:134278536-134278558 GTGGTTAAATAACTTGCTCAAGG - Intergenic
1048556849 8:135486536-135486558 GAGGTTAAATAACTTGCCCAGGG + Intronic
1048660219 8:136591219-136591241 GAGGTTAAATAACTTTTTCAAGG - Intergenic
1049125584 8:140784388-140784410 AAGGTTTTACTGCTTGATCAAGG + Intronic
1050223464 9:3423671-3423693 AATGTTCTACAACTTGATTATGG + Intronic
1050707457 9:8418824-8418846 CAAGTTGTACAACTTGAACAAGG + Intronic
1051033790 9:12718173-12718195 GAAGTAATGCAACTTGCTCAAGG - Intergenic
1051328919 9:16003211-16003233 GAGGATATATGACTTGCTCAAGG - Intronic
1051347784 9:16168191-16168213 AAGGTGAAACAACTTGCTCAGGG + Intergenic
1051709899 9:19920912-19920934 GAGATTAAATAACTTGCTCAGGG - Intergenic
1051857365 9:21584194-21584216 GAGGTTAAGCAACTTGCTCAAGG - Intergenic
1052019932 9:23514174-23514196 GAGGTTTTGCAACTTGGCCAAGG - Intergenic
1052284913 9:26774205-26774227 GATGTTAAGTAACTTGATCAAGG - Intergenic
1053050371 9:34956987-34957009 GAGGTTAAACAACTCGCCCAAGG - Intergenic
1054704332 9:68447480-68447502 GAGGTTATATGACTTGTCCAAGG - Intronic
1054865332 9:69994485-69994507 GAGGCTAAACAACTTGATCATGG + Intergenic
1054924678 9:70577404-70577426 GAGGTTAAAGAACTTGTTGAAGG - Intronic
1055428207 9:76217531-76217553 GAGGTTATGGAACTTGCCCAAGG + Intronic
1055642141 9:78327548-78327570 GAGGTTAAGTAACTTGCTCAGGG + Intronic
1055772528 9:79732648-79732670 GAGGTTAAGTGACTTGATCAAGG + Intergenic
1055963391 9:81842235-81842257 GAGGTTAAGAAACTTGCTCAAGG + Intergenic
1056411762 9:86335185-86335207 GAGATTAAATAACTTGCTCAAGG + Intronic
1056453928 9:86742358-86742380 GAGGTTAAGTAACTTGCTCAAGG + Intergenic
1056718225 9:89051516-89051538 GAGTTTACAGAACTTGCTCAGGG + Intronic
1056786828 9:89598535-89598557 GAGGTTGAACAACTTGCTCAAGG - Intergenic
1057747000 9:97760360-97760382 GAGATTAAGCAACTTGACCAAGG - Intergenic
1057954818 9:99399169-99399191 GAGGTTCAATAACTTGCTCAAGG - Intergenic
1058048828 9:100386137-100386159 GAGGTTAAGTAACTTAATCAAGG + Intergenic
1058067116 9:100561988-100562010 GAGGTTATGTAACTTGTTCAAGG + Intronic
1058372328 9:104284307-104284329 GAGGTTCTAAAACTTGACCAAGG - Intergenic
1058430787 9:104917219-104917241 GAAGTTAAATAACTTGTTCATGG - Intronic
1058501311 9:105620592-105620614 GAGGTTAAATAACTTGCTCAAGG - Intronic
1059338690 9:113584930-113584952 GAGGTTATCTAACTTGCTCCAGG + Intronic
1059465805 9:114468105-114468127 GAGGTTAAGTAACTTGCTCAAGG - Intronic
1059522836 9:114959879-114959901 CAGGTTAAACAGCTTGACCAAGG - Intergenic
1059560089 9:115325858-115325880 GAGGTTAAACAACTTACTCAAGG - Intronic
1059695640 9:116727768-116727790 GAGGTTAAATAACTTGCCCAAGG - Intronic
1059813978 9:117891011-117891033 GAGGTGAGATAACTTGCTCAAGG + Intergenic
1059975659 9:119714028-119714050 GAGGTTAAATGACTTGACCAAGG - Intergenic
1060124653 9:121031578-121031600 GAGGTTGTTCTGCTTGATCAGGG + Intronic
1060264784 9:122105148-122105170 GAAGTTATAAAACTTGCCCAGGG - Intergenic
1060415141 9:123424722-123424744 GAGGTTAAGCACCTTGACCAAGG - Intronic
1060973250 9:127750983-127751005 GAGGTGAAGCAACTTGTTCAAGG + Intronic
1061282657 9:129606407-129606429 GAGGTTAAGTAACTTGACCAGGG - Intergenic
1061530405 9:131207532-131207554 AAGGTTATACAGCTTCAGCATGG - Intronic
1061674104 9:132206009-132206031 CAGGTTAGACAACTTGCCCAGGG - Intronic
1062735045 9:138132074-138132096 GAGGTTCTGCAACTTGACCAGGG - Intergenic
1203603778 Un_KI270748v1:40686-40708 GAGGTTAGGTAACTTGTTCAAGG + Intergenic
1186274884 X:7927956-7927978 GAGGTTATGCTACCTGCTCAAGG - Intergenic
1187089360 X:16078890-16078912 GAGGTTAAGTAACTTGCTCAAGG + Intergenic
1187095089 X:16139775-16139797 GAGGTTAAGTAACTTGTTCACGG - Intronic
1187254372 X:17628755-17628777 GAGGTTAAACAACTTGCCCAAGG - Intronic
1187317021 X:18205992-18206014 GAGGTTAAGTAACTTGCTCAGGG - Intronic
1187406057 X:19005047-19005069 GAGGTTAAGTAACTTGCTCAAGG + Intronic
1187456982 X:19450084-19450106 GAGGTTAAATTACTTGACCACGG + Intronic
1187662128 X:21560384-21560406 AAGGTTATATAACTTGCCCAAGG - Intronic
1187677266 X:21728764-21728786 GAGCTTATGCAACTTGACCGAGG - Intronic
1188072851 X:25738210-25738232 GGGGTTACATAACTTGGTCAAGG + Intergenic
1188786399 X:34352008-34352030 GAGGTTAAATAACTTGCGCATGG + Intergenic
1189027137 X:37407539-37407561 GAGGTTCTAGGATTTGATCAAGG - Intronic
1189752792 X:44239597-44239619 GAGGCCATACAACTTCCTCAAGG - Intronic
1190389650 X:49919639-49919661 GAAGTTAGATAACTTGAACAAGG + Intergenic
1191031899 X:55982648-55982670 GAGGTTAGGCAACTTATTCAAGG - Intergenic
1191964130 X:66738202-66738224 GGGTAAATACAACTTGATCATGG + Intergenic
1192149743 X:68704891-68704913 GAGGTTATGCAAGTTGCTCATGG + Intronic
1192185701 X:68945467-68945489 GAGGTTAAGCAACTTGCCCAGGG + Intergenic
1192190148 X:68986055-68986077 GAGGTTAAATAACTTGCCCACGG - Intergenic
1193085188 X:77442615-77442637 GAGGTTAAATAACTTGCTCAAGG - Intergenic
1193257887 X:79370937-79370959 GAGGTTAGATAACTTGCTTAAGG + Intergenic
1193285166 X:79705143-79705165 GAGTTTACACAACTTTTTCATGG + Intergenic
1193432789 X:81431525-81431547 AAGGTTATACAACCTTTTCAAGG + Intergenic
1194745127 X:97619999-97620021 GAGGTTAAATAACTTGCTCAAGG - Intergenic
1194754486 X:97721993-97722015 GAGATTAAATAACTTGCTCAAGG + Intergenic
1194914913 X:99694277-99694299 GGGGTTACAAAACTTGCTCAAGG - Intergenic
1194949058 X:100103288-100103310 GAGGTTAAAAAATTTGTTCAAGG - Intergenic
1195080841 X:101368504-101368526 GATGTTATGCAACTTGCTCATGG - Intronic
1195471076 X:105230803-105230825 GAGGTTAAACAATTTGTCCAAGG + Intronic
1195475826 X:105284207-105284229 GAAGTTACACAACTTGCCCAAGG + Intronic
1195724172 X:107896920-107896942 GAGGTTATGTAACTTGCCCAAGG - Intronic
1195797883 X:108671955-108671977 GAGGTTAAGAAACTTGCTCAGGG + Intronic
1195956869 X:110340579-110340601 GAGGTTATATGATTTGTTCATGG - Intronic
1195958376 X:110359097-110359119 GATGTTAAATAACTTGTTCAAGG + Intronic
1195966927 X:110437446-110437468 TAGGTTATACCACTTGCCCAAGG + Intronic
1196033078 X:111112525-111112547 GAGGATATAGCACTTGAACAGGG - Intronic
1196610563 X:117709792-117709814 AAGGTTAAACAACTTGCCCAAGG + Intergenic
1196677330 X:118433564-118433586 GAGGTTAAATAACTTGCCCAAGG - Intronic
1196828124 X:119757136-119757158 GAGGTTAGGCTACTTGCTCAAGG - Intergenic
1196851291 X:119941505-119941527 GAGGTTAAGTAACTTGACCAAGG + Intronic
1196903262 X:120407803-120407825 GAGGTTGAATAACATGATCAAGG + Intergenic
1197018984 X:121663394-121663416 GAGGTTAAATAACTTGTCCATGG + Intergenic
1197656939 X:129126894-129126916 GAGGTTAAGCAATTTGACCAAGG - Intergenic
1197690763 X:129498681-129498703 GAAGTTAAACAACTTACTCAGGG + Intronic
1197884359 X:131202933-131202955 GAGGTTAAACAACTTACCCAAGG + Intergenic
1197947009 X:131850359-131850381 GAGCTTCTTCAACCTGATCAAGG + Intergenic
1198427470 X:136534247-136534269 AAGGTTCTACATCTTGATGAGGG - Intronic
1198460882 X:136862072-136862094 GAGGTTAAGCAACTTGCCCAAGG + Intronic
1198668465 X:139051344-139051366 TAGGATACACAACCTGATCAAGG - Intronic
1198690023 X:139271557-139271579 GAGGTTAAGTAACTTGCTCATGG + Intergenic
1198762429 X:140046735-140046757 GAGGTTAAGCAACTTGCCCAAGG - Intergenic
1198912601 X:141631456-141631478 GAGGTTAAGGAACTTGCTCAGGG - Intronic
1199505591 X:148557921-148557943 GAGGTTAAATAACTTGTCCAAGG + Intronic
1199676263 X:150191782-150191804 GAAGTTAAGCAACTTGAGCAAGG + Intergenic
1199864166 X:151828033-151828055 GAGGTTAAATAACTTGTCCAAGG - Intergenic