ID: 925426681

View in Genome Browser
Species Human (GRCh38)
Location 2:3754451-3754473
Sequence GCCATGAGCCGTGTCCTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 143}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925426676_925426681 18 Left 925426676 2:3754410-3754432 CCTGGGGCGTTTTCTGCTCCCAA 0: 1
1: 0
2: 0
3: 3
4: 135
Right 925426681 2:3754451-3754473 GCCATGAGCCGTGTCCTCTGTGG 0: 1
1: 0
2: 1
3: 12
4: 143
925426679_925426681 0 Left 925426679 2:3754428-3754450 CCCAAAGCTGGGAAATCATTGTT 0: 1
1: 0
2: 2
3: 19
4: 271
Right 925426681 2:3754451-3754473 GCCATGAGCCGTGTCCTCTGTGG 0: 1
1: 0
2: 1
3: 12
4: 143
925426680_925426681 -1 Left 925426680 2:3754429-3754451 CCAAAGCTGGGAAATCATTGTTG 0: 1
1: 0
2: 1
3: 11
4: 170
Right 925426681 2:3754451-3754473 GCCATGAGCCGTGTCCTCTGTGG 0: 1
1: 0
2: 1
3: 12
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925426681 Original CRISPR GCCATGAGCCGTGTCCTCTG TGG Intronic
900297343 1:1958476-1958498 GCCAGGAGCCGTTTGCTGTGTGG + Intronic
901936471 1:12630433-12630455 GGCAGGAGCCCTGCCCTCTGGGG + Intergenic
902937825 1:19777242-19777264 GCCTTGGGCCTTGTCCTGTGAGG + Intronic
902979693 1:20113915-20113937 GGCAGTAGCTGTGTCCTCTGAGG - Exonic
903019685 1:20385379-20385401 GCCATGTTCCCTGCCCTCTGGGG - Intergenic
903456428 1:23490400-23490422 GCCAAGAGGAGAGTCCTCTGGGG + Intergenic
905764296 1:40587321-40587343 TCCATGAACCTTGTCCTTTGGGG + Intergenic
907815193 1:57911642-57911664 GCCATGAGCCATGACGTCTGAGG - Intronic
910553018 1:88498163-88498185 AGCAGGAGCCCTGTCCTCTGGGG + Intergenic
912482228 1:109992041-109992063 GCCATGACCTGTTTCCTTTGTGG + Intronic
914959690 1:152195748-152195770 GGCATGTGCGGTGTCCACTGAGG - Intergenic
916533604 1:165681950-165681972 GGAACGAGCCATGTCCTCTGAGG + Intronic
917061773 1:171049089-171049111 GCCATGAGCTGTGTAGTCTGGGG + Intronic
919991312 1:202710017-202710039 GCGAGGAGCCGGCTCCTCTGAGG - Intronic
920372246 1:205486318-205486340 CCCATGACCCTTATCCTCTGAGG + Intergenic
920415833 1:205798897-205798919 GCCAGGTGCAGTGTTCTCTGGGG + Intronic
920577459 1:207072058-207072080 GCCATGGGCCATGCCCTGTGAGG + Intronic
922483492 1:225955792-225955814 GCCAGGAGGAGTGGCCTCTGTGG + Intergenic
1063140360 10:3251260-3251282 CCCAAGAACCGTGTCTTCTGAGG - Intergenic
1066654677 10:37686898-37686920 GCCATGTGTCTTGCCCTCTGTGG - Intergenic
1067733125 10:48828179-48828201 CCCATGAACCATGTGCTCTGGGG - Intronic
1067835006 10:49632982-49633004 GCCACTACCAGTGTCCTCTGGGG + Intronic
1069382273 10:67853108-67853130 GCCCTAGGCCTTGTCCTCTGTGG - Intergenic
1072273319 10:93798957-93798979 GGCATGAACCTTGCCCTCTGAGG + Intergenic
1074723405 10:116283657-116283679 TCCATGAGCCCTTTCCTCTGCGG + Intergenic
1076457461 10:130610515-130610537 GCCATCAGCCTGGTCCTCTCTGG + Intergenic
1081665793 11:44916432-44916454 GCCACGAGCAGGATCCTCTGTGG - Intronic
1083183519 11:61004043-61004065 GCCATGGGCCCTGCCCTCTAGGG + Intronic
1083212212 11:61195233-61195255 GCCATGAGTTTTGTCCTCAGTGG - Intergenic
1083485218 11:62979321-62979343 GCCATGAGGTGTGTACTCAGTGG + Intronic
1084369994 11:68734981-68735003 GCCATGAGCTGTTTCCCATGGGG - Intronic
1089397088 11:118143283-118143305 GACATGGCCCTTGTCCTCTGGGG - Intronic
1095957346 12:47814239-47814261 CCCTTGAGCCCTGTCCTCTCTGG + Intronic
1095960582 12:47832290-47832312 GCAGTCAGCCCTGTCCTCTGGGG - Intronic
1096238713 12:49947823-49947845 GGCATGAGCCGTGTCATCGTTGG + Intergenic
1097246750 12:57611391-57611413 GCCACGAGGCGGGGCCTCTGCGG - Intronic
1098667389 12:73180800-73180822 GCCATGAGCTGTGCTCCCTGTGG + Intergenic
1100360887 12:93878428-93878450 GCCATGAGCTGTGTAGCCTGGGG + Intronic
1103482766 12:121261590-121261612 GCCCTGAGCCATGCCCTGTGGGG + Intronic
1106769365 13:32946714-32946736 CCCACGAGCCATTTCCTCTGAGG - Intergenic
1107204107 13:37761193-37761215 GCCATGTGCCATGCCCTGTGTGG + Intronic
1108156755 13:47592813-47592835 GCCCTGAGCAGTGAGCTCTGAGG + Intergenic
1110393807 13:75006918-75006940 TCCAGGAGCAGTCTCCTCTGTGG - Intergenic
1112638402 13:101243876-101243898 GCCCTGAGCAGTGGCCTCAGGGG + Intronic
1113484725 13:110645681-110645703 GACATGAGATGTGTCCCCTGAGG + Intronic
1118263319 14:64268734-64268756 GCTAAAAGCCCTGTCCTCTGAGG - Intronic
1119937276 14:78603394-78603416 GCCAACTGCCTTGTCCTCTGAGG + Intronic
1122315768 14:100825369-100825391 GACAGGAGCCGTGCCCTCTAAGG - Intergenic
1124693577 15:31845528-31845550 GCCCAGAGCCGGATCCTCTGTGG - Intronic
1127461785 15:59205904-59205926 GCAATGAGCCATGTCATCTGAGG + Intronic
1128145189 15:65329026-65329048 GCAGGGAGCCGTGGCCTCTGTGG + Exonic
1128650713 15:69410795-69410817 GCCCTGAGACGCTTCCTCTGGGG - Intergenic
1130328885 15:82904275-82904297 GCCATAAGCAGAGACCTCTGTGG + Intronic
1130847748 15:87763105-87763127 GGCATGATCCCTGCCCTCTGAGG + Intergenic
1132587994 16:714637-714659 GTCATGACCCCTCTCCTCTGGGG + Intronic
1132737618 16:1394725-1394747 GCCAGGTGCCGTGTCCTTTACGG - Intronic
1136374087 16:29854846-29854868 GCCAAGGGCTCTGTCCTCTGGGG + Intergenic
1137672925 16:50290070-50290092 GCCAGGCGCAGTGTCCTCTTTGG + Intronic
1140026944 16:71299316-71299338 GCCATCAGCTGTGTCAACTGTGG - Intergenic
1141469392 16:84228412-84228434 GCCCTGAGCTGTTTCCTCTGAGG + Intronic
1141556230 16:84838493-84838515 GCCATGAGCTGCGTCCTGGGTGG + Exonic
1142315450 16:89341860-89341882 GCCGTGGGCCGTGGCCGCTGTGG - Intronic
1142315461 16:89341902-89341924 GCCGTGGGCCGTGGCCGCTGTGG - Intronic
1142315493 16:89342034-89342056 GCCGTGGGCCGTGGCCGCTGTGG - Intronic
1142519483 17:494814-494836 GCCAGAAGCCGAGTCCTCTGAGG - Intergenic
1144630969 17:16872318-16872340 GACACCAGCTGTGTCCTCTGCGG - Intergenic
1144650344 17:17003158-17003180 GACACCAGCTGTGTCCTCTGCGG + Intergenic
1145011390 17:19370336-19370358 GCCAGGGGCCATCTCCTCTGAGG - Intronic
1145018335 17:19412933-19412955 CCCAGGAGACGTGTCCTGTGAGG + Exonic
1145094020 17:20009373-20009395 GCCCGGAGCCGTGGCCGCTGGGG + Intronic
1151468489 17:74302914-74302936 GCCCAGTGCCTTGTCCTCTGGGG - Intronic
1152293832 17:79455290-79455312 GCCCTGAGCAGTGGCATCTGGGG + Intronic
1152545506 17:80998279-80998301 GACAGGATCCGTGTCCTCTCGGG + Intronic
1153405495 18:4734208-4734230 GCCATGTTCCCTGTCCCCTGTGG - Intergenic
1154269447 18:12906800-12906822 GCCACATGCTGTGTCCTCTGAGG - Intronic
1155172215 18:23275408-23275430 ACCATGAACCGTGCCCTCCGGGG + Intronic
1158408978 18:57187515-57187537 GCCATGTGCCATGCCATCTGGGG - Intergenic
1161105730 19:2443175-2443197 GCCATGAGCCGGGGACCCTGGGG - Intronic
1161537727 19:4830710-4830732 GCCATGAGCCGGGGGCTGTGTGG + Intronic
1163490385 19:17614387-17614409 GCCACCAGCCGTGTCCTCCATGG + Intronic
1164231691 19:23294547-23294569 GCGATGAGCCCTGGCCTATGAGG + Intergenic
1164557681 19:29266237-29266259 GCCATGCTCTGTGTCATCTGGGG - Intergenic
1164684608 19:30158541-30158563 GCCAAGAGCCGTGCCCTGGGTGG - Intergenic
1165395492 19:35561455-35561477 GTCATGGTCTGTGTCCTCTGTGG + Intronic
1166856390 19:45784426-45784448 GCCTAGAGCAGTGGCCTCTGGGG - Intronic
925417630 2:3682272-3682294 GCCATGCTCCATGACCTCTGGGG - Intronic
925426681 2:3754451-3754473 GCCATGAGCCGTGTCCTCTGTGG + Intronic
926715653 2:15921713-15921735 GCCAGGGGCCGCCTCCTCTGAGG + Intergenic
928783540 2:34854122-34854144 GCCATGAGCTGTGCACCCTGAGG - Intergenic
931094032 2:58919519-58919541 GCCTTGACCTGTGTCCTCAGAGG - Intergenic
933253213 2:80051702-80051724 GGCATGAGCAATGGCCTCTGTGG - Intronic
933738850 2:85517202-85517224 GCCATCATCCCTGCCCTCTGGGG + Intergenic
934961840 2:98682692-98682714 CACATGAGGGGTGTCCTCTGGGG - Intronic
938249226 2:129800884-129800906 GCACTGGGCCGAGTCCTCTGGGG + Intergenic
941504828 2:166329654-166329676 GCCTTGATCCTTGTCCTCTAGGG + Intronic
942135121 2:172917657-172917679 GCCATGAAACGTGTTCTCCGGGG - Intronic
944679599 2:202065051-202065073 GACATGAGCAGTGCCCTCTGCGG - Intergenic
946008219 2:216543454-216543476 GCCATGAGGGGAGTCCACTGAGG - Intronic
946137914 2:217663428-217663450 GACATCAGCTGTGTCCTCAGAGG + Intronic
948906881 2:240983884-240983906 ACCATGAGCAGGGGCCTCTGGGG - Intronic
1169266903 20:4172474-4172496 GCCCTGATCCGTGTCCTCTCGGG + Intronic
1172165096 20:32894066-32894088 GCCCTGAGCCGTATCCTCTGGGG - Intronic
1172213132 20:33214850-33214872 GTCAGGAGCCGTGGGCTCTGGGG - Intergenic
1175415176 20:58796273-58796295 GCCATAAGCTGTGTCCTCCTGGG - Intergenic
1179817167 21:43914062-43914084 GACGTCAGCCGTGGCCTCTGAGG - Intronic
1180095253 21:45553373-45553395 CCACTGAGCCGTGTCCCCTGTGG - Intergenic
1181142377 22:20815847-20815869 GCCATCATCTGTGTCCTCTGTGG - Intronic
1181213783 22:21309013-21309035 GCCATGGGCGGCGTCCTCTTTGG + Intergenic
1182541742 22:31046838-31046860 CCCTGGAGCAGTGTCCTCTGGGG - Intergenic
1184034269 22:41911091-41911113 GAAATGAGCCGCGGCCTCTGCGG - Intronic
1185402095 22:50624498-50624520 GCCCTGAGACGGCTCCTCTGGGG - Intronic
951423060 3:22510463-22510485 GCCATGAGCTGTGTAGCCTGAGG - Intergenic
953862048 3:46552780-46552802 GCCTGGAGACATGTCCTCTGAGG + Intronic
961622001 3:128231629-128231651 GCCCTGAGCCCTTTCCTGTGGGG + Intronic
973053859 4:45630048-45630070 GCCATGAGCTGTGTTGCCTGGGG - Intergenic
974356124 4:60814786-60814808 ACCATGGGCCGTTTGCTCTGTGG + Intergenic
992120577 5:73587942-73587964 GCCATAAGCTGTGTGCCCTGAGG + Intergenic
994450042 5:99929908-99929930 GGCAGGAGCCCTGCCCTCTGGGG - Intergenic
996923968 5:128800535-128800557 GCCAGGAGCCCTGTCCTCCTGGG - Intronic
997253201 5:132407294-132407316 GCTATCAACCATGTCCTCTGTGG - Intergenic
999268257 5:150280890-150280912 GCCATTAGCTGTGATCTCTGGGG + Intronic
1000838201 5:166182160-166182182 GGCATGAGCTGTGCCCTCTTTGG - Intergenic
1002297670 5:178240415-178240437 GCCGTGTGCCGTGTGCTGTGTGG - Intronic
1003173602 6:3738683-3738705 GGCATGAGTCGTGTCCACTTTGG - Intronic
1006316630 6:33295530-33295552 TCCAGGAGCCGGGCCCTCTGTGG + Exonic
1007628535 6:43259896-43259918 GGCATGAGCCGGGACCTCTCTGG - Intronic
1008312106 6:49989419-49989441 GCCATGAGCTGTGTAGCCTGAGG - Intergenic
1009623054 6:66100422-66100444 TCCCTGAGCCCTGTCCTCTTGGG + Intergenic
1015897514 6:138031626-138031648 GCCAAGAGCAGTGCTCTCTGGGG + Intergenic
1017775254 6:157675578-157675600 GCCCACAGCCCTGTCCTCTGTGG + Exonic
1018244209 6:161806263-161806285 TCCAGGAGCGGTGGCCTCTGTGG - Intronic
1018629420 6:165809459-165809481 GCCCTGTGCTGTGTCCTCTGAGG + Intronic
1018924021 6:168194286-168194308 GCCGTGAGTGGTGTCCTCAGAGG + Intergenic
1019266434 7:119841-119863 GCCTGGAGCCTTGTCCCCTGCGG + Intergenic
1020031001 7:4932598-4932620 GCCCTGTCCCCTGTCCTCTGTGG + Intronic
1021860068 7:24897203-24897225 GCCATGAGCCTTTACATCTGTGG - Intronic
1024225729 7:47325431-47325453 TCCTTGAGCAGTGTTCTCTGTGG - Intronic
1027996103 7:85427122-85427144 GCCATGGGCCTTGTGCTCTAAGG + Intergenic
1037890874 8:22623162-22623184 GCCATCAGCAGGGTCCTGTGTGG + Intronic
1038472527 8:27837588-27837610 GCCCGGAGCCGAGGCCTCTGCGG - Intronic
1040511572 8:48100575-48100597 GCCATGAGCCGTGCAGCCTGGGG + Intergenic
1040581677 8:48703777-48703799 GCCATGTGCAGTCCCCTCTGTGG + Intergenic
1044413988 8:91915426-91915448 GCCATGAGCCATGTAGTCTATGG - Intergenic
1048356420 8:133657468-133657490 GCCATGAGTTGAATCCTCTGAGG + Intergenic
1049513621 8:143042444-143042466 GCCATGAGCCTGGCACTCTGTGG + Intronic
1049798735 8:144508165-144508187 GCCCAGAGCTGTGCCCTCTGGGG - Intergenic
1049844165 8:144792110-144792132 GCCATGGGCCGTGTGATCCGTGG - Exonic
1051549754 9:18315471-18315493 GTCCTGAGCCCTGTCCTGTGGGG + Intergenic
1059020144 9:110567777-110567799 GCCATCAGCAGGGTCCTCTGTGG - Intronic
1060053134 9:120391225-120391247 GCCATGAGCTTTGTTCTCTAGGG - Intronic
1060784143 9:126435839-126435861 GCCATGAGACGGGACATCTGAGG - Intronic
1061321599 9:129834513-129834535 GCCCTGAGCTGTGTCGTCTCGGG - Intronic
1062264570 9:135681160-135681182 GCCAGGACCAGTGTGCTCTGTGG + Intergenic
1062501724 9:136854684-136854706 GGCCTGGGCCGGGTCCTCTGTGG - Intronic
1192237088 X:69302831-69302853 GCCATGAGCCTTGTCCGCTAAGG - Intergenic
1195849205 X:109264746-109264768 ACCATGAGCCGTGTAGCCTGGGG + Intergenic
1198293009 X:135257046-135257068 GCCATGGGCCTTGGGCTCTGAGG + Intronic