ID: 925427348

View in Genome Browser
Species Human (GRCh38)
Location 2:3761581-3761603
Sequence AACCTGGCTGTTGCATCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 174}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925427348_925427351 20 Left 925427348 2:3761581-3761603 CCTGAGGATGCAACAGCCAGGTT 0: 1
1: 0
2: 0
3: 22
4: 174
Right 925427351 2:3761624-3761646 CTTTAATAAATGTTCAAAGCAGG 0: 1
1: 0
2: 3
3: 31
4: 314
925427348_925427352 25 Left 925427348 2:3761581-3761603 CCTGAGGATGCAACAGCCAGGTT 0: 1
1: 0
2: 0
3: 22
4: 174
Right 925427352 2:3761629-3761651 ATAAATGTTCAAAGCAGGCCTGG 0: 1
1: 2
2: 6
3: 59
4: 507

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925427348 Original CRISPR AACCTGGCTGTTGCATCCTC AGG (reversed) Intronic
901355475 1:8643835-8643857 ACTCTGGCTGTTGCATCAGCAGG - Intronic
904550344 1:31311606-31311628 CACCTTCCTGCTGCATCCTCTGG + Intronic
905898584 1:41565717-41565739 AACGAGGATGTAGCATCCTCTGG - Intronic
906477265 1:46178054-46178076 AACCTTTCTGTTTCATTCTCAGG - Intronic
907572047 1:55492443-55492465 AACCTGTTTGTAGCATCCTCAGG - Intergenic
907632318 1:56095203-56095225 AACAGGGCTGTTACATCCCCTGG - Intergenic
907805102 1:57810949-57810971 AATCTGGCTTTTGCCTCTTCCGG + Intronic
908537560 1:65092329-65092351 ATACTGGGTGTTGCATCCACAGG + Intergenic
910382729 1:86645955-86645977 AACCTGGCTTTTTCATTATCAGG + Intergenic
910800024 1:91136073-91136095 AACCTGCTTGCTGCATCTTCTGG + Intergenic
912572565 1:110635234-110635256 AACCTGGCTGTAGCCACCTGTGG - Intergenic
916962638 1:169904711-169904733 AGCATGGCTGGGGCATCCTCAGG - Intergenic
918822081 1:189268810-189268832 AACCTGGATGGTGCTGCCTCAGG - Intergenic
921235767 1:213127239-213127261 ACCATGGCTTTTGCATCATCAGG - Intronic
921607473 1:217172827-217172849 GACCTGGCTGTAGCACCTTCTGG - Intergenic
922474828 1:225899513-225899535 CAATGGGCTGTTGCATCCTCAGG - Intronic
1063069590 10:2647999-2648021 AACCTTCCTGTTGCAGCCGCTGG + Intergenic
1066449824 10:35518621-35518643 AATCTGGCTGAGGCATTCTCTGG + Intronic
1066449845 10:35518881-35518903 AATCTGGCTGAGGCATTCTCTGG + Intronic
1066449877 10:35519297-35519319 AATCTGGCTGAGGCATTCTCTGG + Intronic
1066449887 10:35519401-35519423 AATCTGGCTGAGGCATTCTCTGG + Intronic
1067542313 10:47164978-47165000 AACGTGGCTGCTGCCTCTTCTGG - Intergenic
1068008838 10:51422326-51422348 CACCTAGCTGTGGCATCCTATGG - Intronic
1069635706 10:69923604-69923626 AGCCTGGGTCTTGCTTCCTCTGG - Intronic
1070445484 10:76496728-76496750 TACCTGGCTGATGCTTCCTTTGG + Intronic
1073951434 10:108813883-108813905 TACCTAGCTTTTGCATTCTCAGG - Intergenic
1076556802 10:131329077-131329099 AAGCTTGCTTTTTCATCCTCTGG + Intergenic
1078637573 11:13066217-13066239 AACCTGGCAGTTCCCTCCCCTGG - Intergenic
1079938224 11:26643906-26643928 CACCTTGCTGCTGTATCCTCTGG - Intronic
1082260303 11:50072846-50072868 TGCCTCGCTGTGGCATCCTCGGG - Intergenic
1083418747 11:62541890-62541912 AGCCTGGCAGCTGCATCCTCGGG - Intronic
1084302564 11:68261130-68261152 ATGCTGGCTGTGGCCTCCTCTGG + Intergenic
1084306776 11:68290685-68290707 CGCCTTGCTGCTGCATCCTCTGG - Intergenic
1084486407 11:69450700-69450722 ATCCTGGCTGTTGCTTCCTGCGG + Intergenic
1088318108 11:108527810-108527832 AACGTGGCTGTGGCTGCCTCTGG + Intronic
1090755867 11:129791144-129791166 AACCTTGTTGCTGCATCCTTTGG - Intergenic
1090859714 11:130642048-130642070 AAGCTGGCTTTTGTGTCCTCTGG + Intergenic
1091775616 12:3182869-3182891 TGACTGGCTGTTGCAGCCTCAGG - Intronic
1092906053 12:13101424-13101446 ACCCGGGCTGTTTCTTCCTCTGG + Intronic
1097235739 12:57538250-57538272 TACCTGGCGCTGGCATCCTCTGG + Intronic
1100105895 12:91171651-91171673 AGCTTGGCTGTTGTATCCTCTGG - Intronic
1101732536 12:107438507-107438529 AACCTGTGTGCTGCAGCCTCAGG + Intronic
1101901235 12:108792593-108792615 AAGCTGCCAGTTTCATCCTCAGG + Exonic
1102462110 12:113106257-113106279 AACCTGGCTGTGGCATGGTGGGG - Intronic
1102535209 12:113576009-113576031 AACCTGGATGGTGGATCTTCAGG + Intergenic
1103870196 12:124085754-124085776 AACCTGGCTGGTGCTTCCTGGGG + Intronic
1106125661 13:26898232-26898254 ACCCTGGCTGTTGCATGCCCAGG + Intergenic
1109362113 13:61307186-61307208 AAGCTGTCTGTTTCATTCTCAGG + Intergenic
1112184951 13:97118720-97118742 AACCTGACTGTTGCTGCCACAGG - Intergenic
1120506193 14:85355763-85355785 AACCAGGTTGTTGCTTTCTCTGG - Intergenic
1120820401 14:88906945-88906967 TGCCTTGTTGTTGCATCCTCTGG + Intergenic
1124577883 15:30925711-30925733 AACCTGCCTGTAGCATCGTGAGG - Intronic
1126232089 15:46339009-46339031 AACCTGGCTGTGGAGGCCTCAGG - Intergenic
1127196472 15:56591387-56591409 AACATGGCTGTGGAAGCCTCAGG + Intergenic
1127237783 15:57074132-57074154 AACCTGTCTGATTCATCCTATGG - Intronic
1134565364 16:15247169-15247191 TACCTGGATGTTGCATCCGTAGG - Intergenic
1134737132 16:16509529-16509551 TACCTGGATGTTGCATCCGTAGG + Intergenic
1134930388 16:18202635-18202657 TACCTGGATGTTGCATCCGTAGG - Intergenic
1135325763 16:21524570-21524592 AACCAGGCTGATGCATGCTACGG + Intergenic
1135519789 16:23166929-23166951 AACCTAGCAATTGCATTCTCAGG - Intergenic
1137839528 16:51627150-51627172 AGCATGGCTGGTGCAGCCTCAGG - Intergenic
1139132909 16:64168005-64168027 AGCCTCGCAGCTGCATCCTCCGG + Intergenic
1141100374 16:81193364-81193386 AACCTGCCTCTTTCCTCCTCTGG - Intergenic
1141825694 16:86478242-86478264 ACCCTGGCTGTTACATCCTGTGG - Intergenic
1141870954 16:86785166-86785188 AACATGTTTGTTACATCCTCAGG + Intergenic
1143954110 17:10655549-10655571 AACCTGCCTTTTGCTTCCTTGGG + Intronic
1151608260 17:75153994-75154016 ATCCCGGCTGGTGCATCCCCAGG - Intronic
1154059489 18:11046411-11046433 AACCTGGCTGTTGAATGAGCCGG + Intronic
1155022853 18:21912515-21912537 ACCCTGGCTGCTGCAGCCTGTGG + Intergenic
1156446446 18:37240563-37240585 AACCTTGCTGTGGCAGCCGCTGG - Intergenic
1160479200 18:79222522-79222544 AACCAGGAAGTTGCGTCCTCAGG - Intronic
1161601742 19:5188366-5188388 GACCTGGTTGCCGCATCCTCTGG - Intronic
1164916291 19:32054870-32054892 TGCCTTGCTGCTGCATCCTCTGG + Intergenic
1165302203 19:34977264-34977286 AACTTGGCTTTTCCATTCTCAGG + Intergenic
1168371055 19:55834993-55835015 AGCATGCCCGTTGCATCCTCAGG - Intronic
925427348 2:3761581-3761603 AACCTGGCTGTTGCATCCTCAGG - Intronic
929494175 2:42425063-42425085 AGCATGGCGGTTGCATCCCCAGG - Intronic
930010736 2:46936598-46936620 AACCTGTCTATGGCTTCCTCGGG + Intronic
930051207 2:47217602-47217624 AACCTGCCTGATGCAGCCACTGG + Intergenic
931026949 2:58120855-58120877 AGCCTTGCTGTAACATCCTCTGG + Intronic
931763278 2:65434534-65434556 AACCAAGCTGTTCCATCCCCTGG - Intergenic
932451924 2:71816595-71816617 AACCAGGCTGTTACATGATCAGG + Intergenic
933608496 2:84409352-84409374 AACATGGCTGTGGCATCTTCTGG - Intergenic
933919240 2:87027901-87027923 AACTTGGATGTTACTTCCTCTGG - Intergenic
934003754 2:87742006-87742028 AACTTGGATGTTACTTCCTCTGG + Intergenic
934602488 2:95668193-95668215 ATCCTGGCTGTTCCATCTTGAGG - Intergenic
935874477 2:107491726-107491748 AATCTGAATGTTGCCTCCTCTGG - Intergenic
936376155 2:111943059-111943081 AACCAGGCTGTGCTATCCTCTGG + Intronic
936918227 2:117661615-117661637 CACCTGCCTGTTGGATCCTATGG - Intergenic
937401044 2:121583996-121584018 TACCTTGTTGCTGCATCCTCTGG - Intronic
937589537 2:123596439-123596461 AACCTGACTGTTGTAGCCTTGGG - Intergenic
937614288 2:123902425-123902447 ACCCTGGCTCTTGCTTCCTTGGG + Intergenic
937662283 2:124444797-124444819 AACCTGGCTGCTGCTTCTCCTGG + Intronic
940049887 2:149451183-149451205 CACCTTGCTGCTGCATCCTCTGG + Intronic
940053873 2:149493130-149493152 ATCCTGGCTGTTTCCTCTTCTGG + Intergenic
940823519 2:158384584-158384606 AACATGGCTGGGGCAGCCTCAGG - Intronic
941197220 2:162467889-162467911 CACCTTCTTGTTGCATCCTCAGG + Intronic
941957381 2:171218659-171218681 CACCTTGTTGCTGCATCCTCTGG + Intronic
942870725 2:180731419-180731441 CACCTTGTTGTTGCATTCTCTGG - Intergenic
946969433 2:225075264-225075286 CACCTGGCTGTTTCCTACTCAGG + Intergenic
947337378 2:229101410-229101432 ACACTGGCTTTTGCATTCTCTGG - Intronic
947545795 2:231009360-231009382 ATCCTGGCAGTTGGATCCCCCGG + Intronic
947995610 2:234524709-234524731 CACCTTGCTGCTGCATCCTCTGG - Intergenic
949039424 2:241840718-241840740 ACCCTGCCTGGTGCAGCCTCAGG + Intergenic
1168835209 20:873214-873236 ATCGGGGCTGTTGCCTCCTCTGG + Intronic
1169041693 20:2500742-2500764 ACACTGCCTGTTTCATCCTCAGG - Exonic
1170701230 20:18705504-18705526 AACCTGGCGGTAGCTTCCTGGGG - Intronic
1171018375 20:21562059-21562081 CACCTGCCTGCTCCATCCTCAGG + Intergenic
1173438305 20:43052901-43052923 AACCTGGCAGTTACATTCTTAGG + Intronic
1177504766 21:22006200-22006222 CACCTTGTTGTTGCATCCTTTGG + Intergenic
1178620139 21:34166971-34166993 CACCTGGCTGTCTCATCATCAGG + Intergenic
1183017047 22:34997307-34997329 ACCATGGCTGTTGCATCCCTAGG - Intergenic
949317326 3:2771189-2771211 TACTTGTCTGTTCCATCCTCGGG - Intronic
950170751 3:10837686-10837708 AAGCAGGCTGTTCCACCCTCAGG - Intronic
951012229 3:17693879-17693901 AACCTGCCTGATCCTTCCTCTGG - Intronic
951024419 3:17814745-17814767 CACCTTGCTGCTGCATCCACTGG + Intronic
951636468 3:24783989-24784011 TGCCTTGATGTTGCATCCTCTGG + Intergenic
951929235 3:27945174-27945196 AACCAGGGTGAAGCATCCTCTGG - Intergenic
952071138 3:29637357-29637379 AACTTGGCTGCTGCATCTTTCGG - Intronic
955950601 3:64239026-64239048 AGCCCTGCTGGTGCATCCTCAGG + Intronic
956728809 3:72178025-72178047 AACCTGGCTGTGCCAACCACTGG + Intergenic
958471965 3:94532444-94532466 ACCCTAGCTATAGCATCCTCAGG - Intergenic
958745242 3:98126366-98126388 ATCCTTCTTGTTGCATCCTCTGG + Intergenic
958832488 3:99106508-99106530 AACCTTGTTGATGCATCCTCTGG + Intergenic
959154782 3:102653536-102653558 TGCCTTGTTGTTGCATCCTCTGG - Intergenic
959351648 3:105272383-105272405 CACCTCGTTGCTGCATCCTCCGG - Intergenic
960127009 3:114010797-114010819 ACCATGGCTGTTGCCTCCTCAGG + Exonic
963046383 3:141105530-141105552 GACAGGGCTGCTGCATCCTCGGG - Intronic
964674023 3:159257612-159257634 AACCTGCCTGTTGCATGCAGTGG + Intronic
967315944 3:188152655-188152677 CACCCGGCTATTGCATCTTCAGG - Intergenic
968445261 4:649301-649323 GAGCTGGTTGTTGAATCCTCAGG - Intronic
970621924 4:17831036-17831058 AACCTGGCTGTTTTATGCTTGGG + Exonic
970871636 4:20822965-20822987 TACCTTGTTGCTGCATCCTCCGG - Intronic
972739543 4:41877493-41877515 AAGCTGGCTCTGGCATCCCCAGG + Intergenic
974164135 4:58178541-58178563 AGCATGGCTGTGGCGTCCTCAGG - Intergenic
975241575 4:72066155-72066177 CACCTTGTTGCTGCATCCTCTGG + Intronic
975241835 4:72068297-72068319 CACCTTGTTGCTGCATCCTCTGG + Intronic
976929804 4:90551972-90551994 CACCTTGATGTTGCATCCTCTGG + Intronic
979019157 4:115472986-115473008 AACCTTACTGTTGAATCCACTGG - Intergenic
982043810 4:151421688-151421710 AGGCTTCCTGTTGCATCCTCTGG + Intronic
982157734 4:152537691-152537713 AACCTGGCTCTTGGAACTTCAGG - Intergenic
982629581 4:157815021-157815043 AACCTGGCTGTTGTCTCCGTAGG - Intergenic
983062568 4:163175577-163175599 AACCTGGATGGTGCTGCCTCAGG + Intergenic
985274156 4:188221329-188221351 AACCTGGCAGTTTCACTCTCAGG + Intergenic
985821870 5:2166117-2166139 AACCTGGCAGATTCATGCTCTGG - Intergenic
987129798 5:14849941-14849963 AACCTGGAGGGTGCATCCTAGGG - Intronic
987725995 5:21700311-21700333 AATATGCCTGTTGCATCATCTGG + Intergenic
989954256 5:50338262-50338284 CACCTTGTTGCTGCATCCTCTGG + Intergenic
992760983 5:79950756-79950778 AAACTGGGTGTTGCAACCCCAGG - Intergenic
997633862 5:135390231-135390253 GATCTGGCTGTTTCATCCTCAGG + Intronic
998380164 5:141718773-141718795 ACCCAGGCTGTAACATCCTCTGG - Intergenic
998398382 5:141834542-141834564 CACCTGGCTTTTGCATCCTAGGG - Intergenic
998559633 5:143159254-143159276 AACAGGGCTTTTGCAACCTCGGG - Intronic
998640703 5:144007305-144007327 AACCTGGATGCTGGATCTTCTGG - Intergenic
999441027 5:151600955-151600977 CAGCTTGTTGTTGCATCCTCCGG - Intergenic
1001170307 5:169413271-169413293 AATCTGGCTGTTGAATTCTCAGG + Intergenic
1001534812 5:172490982-172491004 CACCTCTCTGTTGCCTCCTCAGG + Intergenic
1002901649 6:1414973-1414995 AATCTGGCTGTTTCCTCCCCGGG + Intergenic
1003018051 6:2484059-2484081 AATCTTGCTGTTGCTTACTCTGG - Intergenic
1003735612 6:8874723-8874745 AGCCTGGCTGTTCCGTCCACAGG - Intergenic
1004145888 6:13065700-13065722 AACATGGCTGTGGCATTCTCAGG + Intronic
1006330484 6:33386792-33386814 AGCCTTGTTGTTGCATCCTCCGG - Intergenic
1011776697 6:90739105-90739127 TTGCTGGCTGTTCCATCCTCTGG + Intergenic
1013198954 6:107872985-107873007 AACCTGGCTGTTAAATACTGTGG - Intronic
1016445514 6:144127932-144127954 AACCTGGCAGTTGCAATCTTAGG - Intergenic
1017192552 6:151669450-151669472 AATCAGGCTTTTGCCTCCTCAGG - Intronic
1019884088 7:3889054-3889076 ACCGTGGCTCTTGCTTCCTCTGG + Intronic
1020806978 7:12802199-12802221 CACCTGGCTCCTGCACCCTCTGG + Intergenic
1027571557 7:79874705-79874727 AACCTGGCTGTTGTATGTGCTGG + Intergenic
1028444704 7:90908296-90908318 AACATGTCTTTTGCATCCTCAGG + Intronic
1030504388 7:110400858-110400880 AAGCTCTCTGTTGCATCCTATGG - Intergenic
1032421773 7:131786154-131786176 AAAGTGGCTGTTCCATCCGCAGG + Intergenic
1034378037 7:150664018-150664040 AAAATGGCTGTTGCAGCCACAGG + Intergenic
1035240692 7:157527399-157527421 AACGTGGCTGGTGCTTCCCCAGG + Intergenic
1035779409 8:2216175-2216197 GACCTGGCTATTGCATGCTGGGG - Intergenic
1039958030 8:42222043-42222065 AGCCAGGCTTTTGCATCCCCAGG - Intergenic
1040113229 8:43583742-43583764 AACCTTTCTTTTGAATCCTCAGG + Intergenic
1040394007 8:46977073-46977095 AACCTGGATGTTTCATCATCAGG + Intergenic
1044966425 8:97578532-97578554 AAGCTGGCTTCTGCATCCTTTGG + Intergenic
1045348362 8:101315473-101315495 AACCTGGCTGATGGAGCCTCAGG - Intergenic
1051922875 9:22288272-22288294 CACCTTGATGCTGCATCCTCTGG + Intergenic
1057704694 9:97388410-97388432 AACCTGTGTGTTTCCTCCTCTGG + Intergenic
1059880870 9:118687392-118687414 TACCTGCCTGTTGCATTCTAAGG - Intergenic
1061657873 9:132106741-132106763 CACCTTATTGTTGCATCCTCCGG + Intergenic
1062653088 9:137588463-137588485 AACCTGGCTGTTGCTGCCACTGG - Intronic
1186818599 X:13262998-13263020 AACCTGGATTTTCCAGCCTCAGG + Intergenic
1188765721 X:34088679-34088701 AACCTGGATGTTGTTACCTCAGG + Intergenic
1189380098 X:40496502-40496524 CACCTTGTTGCTGCATCCTCTGG - Intergenic
1189866094 X:45328862-45328884 AACCTAGCTATTGCATTCTTGGG - Intergenic
1191681907 X:63849462-63849484 ACACTGGCTATTTCATCCTCAGG - Intergenic
1192940227 X:75903983-75904005 AAGCTCTATGTTGCATCCTCAGG - Intergenic
1195860041 X:109373820-109373842 AACCTGGTTTTTGTATCATCTGG - Intronic
1196194081 X:112822252-112822274 TACCTGGCTGCTCCATACTCAGG + Exonic
1197705570 X:129632209-129632231 CACCTTGTTGCTGCATCCTCTGG - Intergenic
1198194316 X:134344686-134344708 TGCCTTGTTGTTGCATCCTCTGG - Intergenic
1200153199 X:153961526-153961548 AACCTGGGTATGGCCTCCTCGGG - Exonic
1200737148 Y:6812272-6812294 AACCTGGAAGTTTAATCCTCTGG - Intergenic