ID: 925427940

View in Genome Browser
Species Human (GRCh38)
Location 2:3766412-3766434
Sequence GGGTTGGGATTCTGAAAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 192}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925427940 Original CRISPR GGGTTGGGATTCTGAAAGTC TGG (reversed) Intronic
900815621 1:4841554-4841576 GGGTTGGGAGTCTAAACATCAGG - Intergenic
900819658 1:4876819-4876841 GGGTTGTGGTTCTGCAAGGCAGG + Intergenic
901763185 1:11483930-11483952 GGCCTGGGATTCTGAGACTCAGG - Intronic
904085853 1:27907452-27907474 GGGTTTGGATTCTAAAAGTGTGG - Intronic
904647528 1:31979024-31979046 AGGTTGGAATTCTGAGAATCTGG + Intergenic
905335950 1:37244646-37244668 GCTATGAGATTCTGAAAGTCTGG + Intergenic
906638376 1:47425566-47425588 GGGTTGGAGTTCTGAAAGGAGGG + Intergenic
909174903 1:72344966-72344988 GTGTTGGGATGAAGAAAGTCAGG + Intergenic
911109776 1:94170480-94170502 GGATTGGGATGCTGAAACACAGG + Intronic
911704473 1:100994833-100994855 GCGTTGGGATTCTGAAAACATGG - Intronic
912721181 1:112021583-112021605 GGGCCAGGATTCAGAAAGTCTGG - Intergenic
913142066 1:115951420-115951442 GGGATGGGATTCTGGAAATCTGG - Intergenic
913327710 1:117641504-117641526 GGCGTGGAATTCTTAAAGTCTGG - Intergenic
915308983 1:154997886-154997908 GAGTTGGGGATCTGAAAATCTGG - Intergenic
915586450 1:156846324-156846346 GGGCTGGGATTGGGACAGTCCGG - Intronic
916194268 1:162209003-162209025 GTGTTGGCATTCTGAAAGTAAGG - Intronic
917196127 1:172467570-172467592 GGGTTAGGATTAAGAATGTCTGG + Intronic
918029154 1:180786781-180786803 TGGTTGGGATTCTGACAAGCTGG - Intronic
919618718 1:199840027-199840049 GGGTGGCCATTCTGAAAGACTGG - Intergenic
919832529 1:201552186-201552208 GGGCTGGCATGCTGATAGTCTGG + Intergenic
920332666 1:205221680-205221702 GGGTAGTGTTTCTGAAAGTATGG - Intergenic
920442555 1:205990614-205990636 GGGTGGGGATGCTGAAAGCCAGG + Intronic
920819885 1:209370396-209370418 GGGTTGAGACTCTGAAAGCCTGG - Intergenic
921921918 1:220679316-220679338 AGGCTGGGATTCTGAAAGCCAGG - Intergenic
924140936 1:241022641-241022663 GGGTAGGGTGTCAGAAAGTCGGG - Intronic
1064405161 10:15055341-15055363 GGGTGGGGGTTCTGTAATTCTGG + Intronic
1066573125 10:36794776-36794798 GAGTTTGGATTCTGAAATTAGGG - Intergenic
1067054483 10:43042948-43042970 GGGCTGGGATTGTGAGAGCCAGG - Intergenic
1067469252 10:46524081-46524103 GGGTAGGGAGTCGGAAAGTGGGG + Intergenic
1067568056 10:47352197-47352219 GGGTTGGGAAGCTGACAGGCAGG + Intronic
1067673093 10:48343950-48343972 GGGTTGGTATTTTGCAAGACAGG + Intronic
1070544967 10:77445069-77445091 CCGTTGGGATTCTGGAATTCTGG - Intronic
1070591830 10:77807063-77807085 GGGTGGTGATTCTCAAAGTGGGG + Intronic
1072531352 10:96322391-96322413 GGTTTGGGATTCTGTAGATCTGG + Intronic
1073147385 10:101289747-101289769 GGGCTGAGCTTCTGAAAGGCAGG - Intergenic
1075434832 10:122429634-122429656 GTGTTTGGATTCTGAAGGACCGG - Exonic
1078938438 11:15973735-15973757 GGGTTGGGATTAAGAGAGTTGGG + Intronic
1080007994 11:27429866-27429888 GGGCTGGGATCCTGAGAGACAGG + Intronic
1080913453 11:36629234-36629256 GGTTGGGTACTCTGAAAGTCAGG - Intronic
1082955473 11:58865548-58865570 GGCTTGGGATTCAGAACGTCTGG + Intronic
1082962934 11:58936339-58936361 GGCTTGGGATTCTGAGCATCTGG + Intronic
1082976568 11:59078410-59078432 GGCTTGGGATTTAGAACGTCTGG + Intergenic
1083582666 11:63835105-63835127 GGGTTGGGGTTATGAAAGAGGGG - Intergenic
1084873288 11:72112167-72112189 GGGTTGGGAATCTGAGATACAGG - Intronic
1086020846 11:82227600-82227622 GGGCTGGGAATTTGAAAGGCGGG + Intergenic
1086933369 11:92718076-92718098 GGGCTGAGCTTCTGAAAGTTCGG - Intronic
1090664263 11:128904606-128904628 GGGTTCTGATTCTGTAGGTCTGG - Exonic
1091909735 12:4219923-4219945 GTGTTGGAATTCTGAAAGAGAGG + Intergenic
1092083882 12:5739914-5739936 GGGTTGGAAGGCTGAAAGTCTGG - Intronic
1095416217 12:41979602-41979624 GGATTGTGATTCTGAAAGTTTGG - Intergenic
1098417569 12:70253191-70253213 GGGTTAGGATTCAGACAGACTGG + Intronic
1100970351 12:100063380-100063402 GGGTGTGGATTCTGAGAGCCAGG - Intronic
1104601397 12:130156291-130156313 GGGGTCCCATTCTGAAAGTCAGG + Intergenic
1111372366 13:87334768-87334790 GAGGAGGGATTCTGAAAGTTTGG - Intergenic
1111937032 13:94568253-94568275 GGCTTCTGATTCTGTAAGTCTGG + Intergenic
1112243025 13:97701372-97701394 GGGTTGGGATTCAGAAGGAGGGG - Intergenic
1113386897 13:109857319-109857341 GGGTTGGGTTTCTGAAAGGAGGG + Intergenic
1114263945 14:21060204-21060226 GGGCTGGGATTTTGAATTTCTGG - Intronic
1114703872 14:24706345-24706367 GTGCTGGGGTTCTGAAAGTTAGG + Intergenic
1115025795 14:28744644-28744666 ATGTTGGAACTCTGAAAGTCAGG - Intergenic
1115234713 14:31197649-31197671 GGGTAAGGATTCTGAAAAACTGG - Intronic
1116141974 14:41008041-41008063 GGGTTGGGAGTTAGAAAGTATGG + Intergenic
1116356236 14:43935497-43935519 GTGTTGGAAGTCTGAAAGTCAGG + Intergenic
1117439857 14:55749342-55749364 TGCCTGGGATTCTGAAAGACAGG + Intergenic
1117945816 14:61019074-61019096 GGACTGGGATGCTCAAAGTCTGG + Intronic
1118903699 14:70007647-70007669 GGCTGGGGATCCTGACAGTCAGG - Intronic
1120385632 14:83841974-83841996 GGGGTGAGAATATGAAAGTCAGG + Intergenic
1123960593 15:25395608-25395630 GGTTTGGGATGATGAAAATCAGG + Intronic
1126198218 15:45955266-45955288 GTGTTCCTATTCTGAAAGTCTGG - Intergenic
1128105990 15:65045274-65045296 GCTTTCGGATTGTGAAAGTCAGG + Intergenic
1128466275 15:67915151-67915173 GGGTGGGGCTTCTGAGAGGCTGG - Intergenic
1130232079 15:82104757-82104779 GGATGGCCATTCTGAAAGTCTGG - Intergenic
1130960843 15:88657759-88657781 GGGCTGGGAGTCAGAAAGCCTGG - Intergenic
1132017908 15:98335267-98335289 GGGTTTGGACGCTGGAAGTCTGG + Intergenic
1132900214 16:2249915-2249937 GAGTTTGGAGTCAGAAAGTCAGG + Intronic
1133107165 16:3519486-3519508 GTGTGGGTATTCTGTAAGTCGGG + Intronic
1134669998 16:16047793-16047815 TGTTTTGGATTCTGCAAGTCTGG - Intronic
1136294952 16:29296239-29296261 GGGCTGGGAGGCTGAAGGTCAGG - Intergenic
1140924610 16:79570341-79570363 GGCTTTGGAATCTGAAAGACTGG - Intergenic
1142911003 17:3090914-3090936 TGGTTAGCATCCTGAAAGTCAGG + Intergenic
1142947353 17:3442576-3442598 GGGTAGTGGTTCTGAAAGTGGGG - Intronic
1143579969 17:7819706-7819728 CGGTTGGGATTCTGCAGGTCTGG + Intronic
1143894109 17:10123379-10123401 GGGTAGGGCTTCTTAAAGTGTGG - Intronic
1144258200 17:13490741-13490763 GGGTTGGGGTACTGGAAGCCAGG + Intergenic
1144534959 17:16079166-16079188 GGGTTGGGTTTCAGTAAATCTGG + Intronic
1145988281 17:29062107-29062129 GGGGTGGGATTCTAACAGGCAGG + Intergenic
1147607856 17:41784615-41784637 GGGATGGGATTCTGCACCTCTGG - Intronic
1148126431 17:45239613-45239635 GGGTTGGATTTTTGAAAGCCAGG + Intronic
1149043925 17:52222397-52222419 GGGTTGGGATTCTGGAGATGAGG + Intergenic
1150290803 17:63980482-63980504 GGGTTGGGAATCAGAGAGCCAGG + Intergenic
1150817290 17:68402487-68402509 GGATTGGGAGGCTGAAAGGCGGG - Intronic
1152512572 17:80800208-80800230 GGGTTGGATTTCTGACCGTCTGG - Intronic
1153687639 18:7562504-7562526 ATGTTGGGATTATGAAAGTGTGG - Intergenic
1153813820 18:8775970-8775992 GGGCTGGCATTCTGAGAGTGAGG + Intronic
1155986933 18:32239660-32239682 AGGATGGGATTCTGATAGTCAGG - Intronic
1156120498 18:33836863-33836885 GGGTAGCCATTCTGACAGTCGGG - Intergenic
1157008918 18:43622316-43622338 ATGTTGTGACTCTGAAAGTCAGG + Intergenic
1157438983 18:47695917-47695939 GCATTCAGATTCTGAAAGTCTGG - Intergenic
1158899297 18:61947947-61947969 GTGTTGGCATTGTGAAAGTCAGG - Intergenic
1159056186 18:63466681-63466703 AGCTTGTGATTCTGAAAGTGTGG + Intergenic
1159622466 18:70654415-70654437 GGGTGGCGGTTCTGAGAGTCAGG + Intergenic
1163229456 19:15990415-15990437 GGCTTGGGATTCTGGAAGGAGGG - Intergenic
1166351526 19:42200911-42200933 GGGTGGGAATTCAGAAATTCTGG - Intronic
925187490 2:1859122-1859144 GGCTTGGTTTCCTGAAAGTCAGG + Intronic
925427940 2:3766412-3766434 GGGTTGGGATTCTGAAAGTCTGG - Intronic
926080872 2:9985142-9985164 GGGTTGAGAAGCTCAAAGTCTGG + Intronic
926780843 2:16470543-16470565 GGGTTGGGAGTGGGAAAGTTGGG + Intergenic
927421379 2:22934975-22934997 GGGTGGTGATTCTCAAAGTGTGG - Intergenic
927517687 2:23681732-23681754 GGGCTGGGATTCTGAAGACCTGG - Intronic
928290912 2:30036644-30036666 GGGTTTGGCTTCAGAAGGTCTGG - Intergenic
928777761 2:34787551-34787573 GGGAAGTGATTCTGAAAGGCAGG - Intergenic
932807908 2:74798655-74798677 GGGTTGAGGTTCTGCAAGGCTGG - Intergenic
934063473 2:88318633-88318655 TGGTTGGGATTGTGACAGTTGGG - Intergenic
939047122 2:137262839-137262861 GGTTTGGGTTTCTGAGAGTAGGG + Intronic
939875484 2:147572806-147572828 GGGTTGGGATTTCGCAAGGCAGG - Intergenic
942752124 2:179299846-179299868 GAGTTGGGATTCTGCATGTGAGG - Intergenic
945005726 2:205403646-205403668 AGGTTCTGATTCTGTAAGTCTGG - Intronic
946522549 2:220482357-220482379 GGGATGGGCTTCTGGAAATCAGG - Intergenic
948056377 2:235011923-235011945 GGGATGGGATTCTGAGAGACAGG + Intronic
948500734 2:238391575-238391597 GGGCTGGGATTGTGATAGTCAGG - Intronic
1169138554 20:3213008-3213030 GGGGTGGGACCCTGAAAGCCGGG + Intronic
1169491651 20:6076331-6076353 GGGTTGGGATTCAGGAAGACAGG - Exonic
1170156168 20:13271614-13271636 GGGTTGGGAGTCTGAGAGCCTGG - Intronic
1174285352 20:49468905-49468927 GGGTTGGGATGTCGAAAGCCAGG + Intronic
1174978210 20:55359599-55359621 GAATTGTGATTCTGAAAGTGGGG - Intergenic
1175015013 20:55780709-55780731 GGGTTGTGCTTCTCAAAGTATGG - Intergenic
1176013272 20:62912169-62912191 TGGTTGGGGAGCTGAAAGTCGGG - Intronic
1178561848 21:33645286-33645308 TGGTTGGGTTTCTTAAAGTGTGG + Intronic
1178779669 21:35589765-35589787 GGGCTAGGATTCTGAAAACCTGG - Intronic
1180682526 22:17638518-17638540 GGGTTGGGATTCTGACCGGCTGG - Intronic
1182232118 22:28846222-28846244 GGGTTGGGAAGCTGAAGCTCTGG + Intergenic
1182575967 22:31273057-31273079 TGGTTGGGATTCTTGAAATCAGG + Intronic
1183589998 22:38774470-38774492 GGCTTGGGAGTCTGGAAGGCTGG - Intronic
1184167071 22:42735892-42735914 GGGTTAGGATGCTGAAACTTGGG + Intergenic
949670659 3:6396112-6396134 GGAGTGGGATTCTGAAAATTGGG - Intergenic
950539220 3:13599970-13599992 GGGTTGAGACTCCAAAAGTCTGG + Intronic
951776537 3:26316570-26316592 GGGTGGCCATTCTGAAAGGCTGG + Intergenic
952209716 3:31217538-31217560 GGATTAGGATTCAGAAAATCTGG - Intergenic
953365189 3:42338287-42338309 GGGTTGGGATTTTATAAGACAGG + Intergenic
954522577 3:51242591-51242613 GGGTTGGGACACTGAAGGTCTGG + Intronic
955936603 3:64108640-64108662 GGATTTGAATTCTGCAAGTCCGG - Intronic
958468338 3:94485677-94485699 CTGTTGGTATTCTGACAGTCTGG - Intergenic
958572783 3:95910499-95910521 GGGTTGCCATTCTGATAGGCTGG + Intergenic
959355181 3:105317868-105317890 GAGTTGGGATTCAGAAATTTGGG - Intergenic
960471931 3:118076221-118076243 TGGTGGGGATTCTGGAACTCAGG + Intergenic
960588448 3:119343256-119343278 GGGTTGGGAGTCAGAGAGACTGG + Intronic
961038024 3:123656539-123656561 GGGATAGGATTCTAAAAGGCAGG - Intronic
968128712 3:196179346-196179368 GGGTTGGTATTCTGCCTGTCAGG + Intergenic
969126266 4:4950665-4950687 GGGTAGTGATTCTCAAAGTGTGG + Intergenic
971159244 4:24116803-24116825 GGGTTAGGAGTTTGAAGGTCTGG - Intergenic
971503377 4:27340792-27340814 GGTTTGGGAACCAGAAAGTCTGG - Intergenic
971503422 4:27341117-27341139 GGGTGAGGAGACTGAAAGTCAGG + Intergenic
972416076 4:38842098-38842120 GGGTTGGGGATCAGAAAGTCGGG - Intronic
978035345 4:103986160-103986182 GGGTTGGGCTTCCCAAAGACAGG - Intergenic
979707548 4:123738578-123738600 GGGTTTGGATTCTGACTGCCTGG + Intergenic
980845572 4:138320323-138320345 GGGTTGTGAATCTGAAAGTGTGG + Intergenic
982373026 4:154655145-154655167 GGGTTGTGATTCAGAAGCTCCGG - Intronic
982553622 4:156832943-156832965 GGGTTGGTATTTTGAGAGTTTGG + Intronic
985935673 5:3096045-3096067 GGGTTGATGTTCTGAGAGTCAGG + Intergenic
988673498 5:33407325-33407347 GGGATGGGGTTCTGAAAATAAGG + Intergenic
990355969 5:54966469-54966491 AGGTTGTAATTCTGAAATTCTGG - Intergenic
993653737 5:90553216-90553238 GGTTTGAGAGTCTGAGAGTCAGG + Intronic
999123266 5:149226582-149226604 GGGCTGGGAGTCAGAAAGTAGGG + Intronic
999286507 5:150397374-150397396 GGATGAGGATTCTGACAGTCTGG - Intronic
1000924088 5:167172480-167172502 GGCTTTGGAGTCAGAAAGTCTGG - Intergenic
1002422475 5:179155808-179155830 AGGTTGGGGTTCTGAAAGTCAGG - Intronic
1003076227 6:2985824-2985846 GGGTTGGGATTCTCTACTTCAGG - Intergenic
1003141699 6:3477338-3477360 GGATTCTGATTCTGTAAGTCTGG - Intergenic
1004344971 6:14840730-14840752 GAGTTGTGATTCAGTAAGTCTGG + Intergenic
1005806378 6:29477598-29477620 GGGTTGGAATTCTGAGATTAAGG - Intergenic
1005887590 6:30108610-30108632 GAGCTGGGAGTCAGAAAGTCAGG + Intronic
1005941686 6:30565162-30565184 TGGTTGTGAATCTGAAAGTTGGG - Intergenic
1007121466 6:39385549-39385571 GGGTTTGGATTCCTAAAATCAGG + Intronic
1008524629 6:52395931-52395953 GGTTTGGGAGTCAGGAAGTCTGG - Intronic
1009534511 6:64862953-64862975 GTGTTGGGATTTTGGAATTCTGG + Intronic
1009795364 6:68459025-68459047 GGGTGGCCATTCTGACAGTCTGG - Intergenic
1009857271 6:69280972-69280994 AGGAGGGGATTCTGAAAGACTGG - Intronic
1010305626 6:74318227-74318249 GTGTTGGCATTCTGGAAGTTGGG + Intergenic
1011562274 6:88632359-88632381 GGACTGGGATGCTGCAAGTCTGG - Intronic
1011725934 6:90210892-90210914 GTGCTGGGATTCTGTAATTCTGG - Intronic
1018453442 6:163930303-163930325 GGATTCGGATTCTGTAGGTCTGG + Intergenic
1019166393 6:170100332-170100354 GGGCGGGGGTTCTCAAAGTCAGG - Intergenic
1019300465 7:300592-300614 GGGATGGGAATCTGAAGGGCTGG - Intergenic
1020136671 7:5591862-5591884 GGGTTGGGATTCTGAGGATGGGG + Intergenic
1022537569 7:31107349-31107371 GGGTGGGGAGTCTGCAGGTCAGG + Exonic
1029287564 7:99476408-99476430 GGGGTGGGATCCTGGACGTCTGG - Exonic
1030694857 7:112573860-112573882 GGCCTGGGATTCAGAAGGTCTGG - Intergenic
1031007958 7:116496033-116496055 GGGTTGAGATTGAGAAACTCTGG + Intronic
1032439859 7:131934336-131934358 GGGATGTGATTCTCAAAGTGGGG + Intergenic
1034427310 7:151020844-151020866 GGGTTGGGCTTCGGAAGGGCAGG - Intronic
1040460987 8:47647974-47647996 GGGTTGGGACTCTGATCGTGAGG + Intronic
1042267329 8:66922842-66922864 GGTTTGGGAGTCTGAAAGGTAGG - Intergenic
1042423580 8:68620340-68620362 GGGTTGGCATTCAGAGGGTCTGG + Intronic
1042520689 8:69708196-69708218 GGCTTTGGATTCAGAAAGACTGG + Intronic
1044216883 8:89622816-89622838 GGGTTGGCATCCTGAAAGGTGGG + Intergenic
1047173622 8:122519284-122519306 AGGTGGGTATTCTCAAAGTCTGG - Intergenic
1048307951 8:133296856-133296878 GGATTGGGGTTCTGGAGGTCGGG - Exonic
1049002320 8:139833880-139833902 GGGTATGGCTACTGAAAGTCAGG + Intronic
1051612146 9:18971312-18971334 CTGTTGGAATTCTGAAAGTTTGG - Intronic
1052862757 9:33447055-33447077 GGGCTGGGATTCTGGGAATCTGG + Intronic
1052934926 9:34085116-34085138 GGGTGGCCATTCTGACAGTCTGG - Intergenic
1053535947 9:38926227-38926249 GAGTTGGGAGACTGGAAGTCTGG + Intergenic
1054630186 9:67437725-67437747 GAGTTGGGAGACTGGAAGTCTGG - Intergenic
1054988162 9:71286799-71286821 GGGTTGGCATTTTGAAAAACAGG - Intronic
1056250750 9:84745680-84745702 GGGTTGGGATTTTGACATACAGG + Intronic
1056765258 9:89441217-89441239 GGGTTGGTATTCGTAAGGTCTGG - Intronic
1056854382 9:90113247-90113269 GGGATGGTATTCTGTAAGACTGG - Intergenic
1057083006 9:92186900-92186922 GGGTGGAGCTTCTCAAAGTCTGG + Intergenic
1061224320 9:129271898-129271920 GGGAAGGGAGGCTGAAAGTCAGG - Intergenic
1189024385 X:37376487-37376509 TGGATGGGCTGCTGAAAGTCTGG + Intronic
1191669932 X:63739550-63739572 GGGTTGGGAATCTGAAAGCATGG + Intronic
1192220564 X:69195018-69195040 GGGCTGGGAGTCTGGAGGTCTGG - Intergenic
1192789515 X:74367671-74367693 GAGTGGGGCTTATGAAAGTCAGG - Intergenic
1194910901 X:99643394-99643416 GGGTAGTGATACTCAAAGTCTGG + Intergenic
1195091390 X:101463036-101463058 GAGTTGCAATTATGAAAGTCAGG - Intronic
1197910315 X:131476007-131476029 GGATTGGGAGCCAGAAAGTCTGG + Intergenic
1199165962 X:144675580-144675602 GGGTAGGAATTCTGAATTTCAGG + Intergenic