ID: 925428289

View in Genome Browser
Species Human (GRCh38)
Location 2:3769439-3769461
Sequence CTGATGGAATGGAGTGAAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 458
Summary {0: 1, 1: 0, 2: 1, 3: 41, 4: 415}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925428289_925428299 30 Left 925428289 2:3769439-3769461 CCGTCTTCACTCCATTCCATCAG 0: 1
1: 0
2: 1
3: 41
4: 415
Right 925428299 2:3769492-3769514 CTCTCCCTGCAAATTCTCTCTGG 0: 1
1: 0
2: 1
3: 25
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925428289 Original CRISPR CTGATGGAATGGAGTGAAGA CGG (reversed) Intronic
901574961 1:10193290-10193312 CTTAGGGAATGGAGAGAAGGGGG + Intergenic
902121455 1:14169491-14169513 CAACTGGAGTGGAGTGAAGAGGG + Intergenic
906290702 1:44617672-44617694 CTGATGGTGAGGAGTGGAGAGGG - Intronic
907948615 1:59158941-59158963 CTTAGGGATTGGAGTGAAAAGGG + Intergenic
908658914 1:66417606-66417628 CTGATGGATAGGGGTGAAGAAGG + Intergenic
909358997 1:74740985-74741007 CTGCTGGATAGGGGTGAAGAAGG + Intronic
910396866 1:86802386-86802408 CTGCTGGATAGGGGTGAAGAAGG + Intergenic
911013554 1:93307496-93307518 CTGATGGATTGGTTTGAAGGTGG - Intergenic
911723517 1:101217274-101217296 CTGAGGAGATGGAGTGTAGAGGG + Intergenic
912565940 1:110587468-110587490 CTGATGGGGAGGAATGAAGAAGG + Intergenic
912571393 1:110626486-110626508 ATTATGGAATGGAGTGGACAGGG + Intronic
912616326 1:111103333-111103355 TTGAAGAAGTGGAGTGAAGAAGG - Intergenic
912977144 1:114341159-114341181 ATGGAGGAAGGGAGTGAAGATGG - Intergenic
913432014 1:118805635-118805657 ATCAAGGAATGGAGTGAAGAAGG - Intergenic
913501783 1:119478401-119478423 CTGTTAGAATGGAGCGAAGAAGG + Intergenic
913509678 1:119550316-119550338 CTGTTAGAATGGAGAGAGGAAGG + Intergenic
913539209 1:119802922-119802944 CTGGTGAAATGGAGAGAAGAGGG - Intronic
913713825 1:121513552-121513574 CTGCTGGATAGGGGTGAAGAAGG - Intergenic
914096623 1:144549757-144549779 CTAATGGCATGGAATGATGAAGG - Intergenic
914267800 1:146052864-146052886 CTAATGGCATGGAATGATGAAGG - Intergenic
914301985 1:146385036-146385058 CTAATGGCATGGAATGATGAAGG + Intergenic
915267392 1:154728815-154728837 CTGATGGGATTGAGAGAGGAAGG + Intronic
916816317 1:168356622-168356644 CTCAAGGAAGGGAGGGAAGAAGG - Intergenic
917563690 1:176188004-176188026 CTGATCTCATGGAGGGAAGAGGG - Intronic
917777957 1:178358605-178358627 CTCATGGAATGAAGATAAGATGG - Intronic
920006638 1:202838086-202838108 CTCATGAAAGGGAGTCAAGAAGG - Intergenic
920043488 1:203118699-203118721 CTGAGGGAATGGGCTGAAGCCGG + Intronic
920234523 1:204494121-204494143 CTGCTGGAGTGGAGTGGAGTGGG + Intronic
920950130 1:210564801-210564823 CTGATGGAATGGGGAGGGGAGGG + Intronic
921429800 1:215052361-215052383 CTGATGGAATGCAATGGAAAAGG + Intronic
921947139 1:220894075-220894097 GTTAGGGAATGGAGTAAAGAGGG - Intergenic
922008621 1:221557787-221557809 ATGACAGAAAGGAGTGAAGACGG + Intergenic
922202225 1:223414972-223414994 CTTATGGCATGAAGTGAAAAAGG + Intergenic
923020562 1:230160111-230160133 TTCATGGAAGGGAGTGAGGAAGG - Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923512866 1:234667729-234667751 CTGATGGAAAGAAGAGAAGAGGG - Intergenic
923552780 1:234977511-234977533 CTGAGGACATGGGGTGAAGATGG - Intergenic
923844431 1:237713165-237713187 CTGATGGAAAAGAGGGAAAAGGG - Intronic
924840231 1:247702141-247702163 CTGTTTGAAAGGAGAGAAGAAGG + Intergenic
1063459337 10:6205283-6205305 TTACTGGAATGGAGGGAAGAAGG + Intronic
1063584163 10:7336071-7336093 CTGTTGGAACTGAGTTAAGATGG - Intronic
1063689052 10:8266267-8266289 CGGAGGGGATGGAGAGAAGAGGG + Intergenic
1063780757 10:9320614-9320636 CTGTTGGAATGCAGTGAACAAGG - Intergenic
1064160257 10:12939261-12939283 CTGATGGACTGGACAGAAGTTGG - Intronic
1064852059 10:19719341-19719363 CTTGTGAAGTGGAGTGAAGACGG + Intronic
1065083019 10:22145815-22145837 CTGCTGGATAGGGGTGAAGAAGG - Intergenic
1065100619 10:22327739-22327761 CAGATGAAATGAAGAGAAGAAGG + Exonic
1065941726 10:30570855-30570877 ATGTTGAAATGGAGTGATGAGGG + Intergenic
1066190008 10:33047479-33047501 GTTATGGAAGGGAGAGAAGAGGG + Intergenic
1066358971 10:34712241-34712263 CTGAGGGAAGGTAGTGAATATGG + Intronic
1068404602 10:56573410-56573432 CTGCTGGAAAGGGGTCAAGAAGG + Intergenic
1068717650 10:60205913-60205935 TTGATGGAATGTAGTCAAGCAGG - Intronic
1070224139 10:74483001-74483023 CTATTGGAATGGTGAGAAGAGGG - Intronic
1070637072 10:78137591-78137613 CTGATGGGCTGGAGTGATGCTGG + Intergenic
1071499570 10:86193759-86193781 CTGGTGGAATGGAGACAAGCTGG - Intronic
1072101223 10:92231267-92231289 CTGATGGCATGTAGTGGAGGGGG - Intronic
1072128659 10:92470817-92470839 CTGATAGAATGCAGTGAGAAAGG - Intronic
1072370756 10:94764592-94764614 CTGCTGGAGAGGGGTGAAGAAGG + Intronic
1072401289 10:95104779-95104801 CAGATGGAATGAAGTAAAGGTGG - Intergenic
1072535145 10:96356631-96356653 CTGATGGATTGGAATTCAGATGG + Intronic
1073037690 10:100575723-100575745 CTGATGGCATGGAGAGAGGGCGG - Intergenic
1073125743 10:101147747-101147769 TTGAGGGAGTGAAGTGAAGATGG - Intergenic
1073808634 10:107127808-107127830 CTGAGAGAATGGAGTGAATGTGG + Intronic
1073971317 10:109047742-109047764 CTGCTGGATAGGGGTGAAGAAGG - Intergenic
1074613374 10:115042046-115042068 CTGCTGGATAGGGGTGAAGAAGG - Intergenic
1076082898 10:127599653-127599675 CTGATGGGAAGTAGTGAGGAAGG + Intergenic
1076138557 10:128062148-128062170 CTGGTGGAACGGAGTGATGCTGG - Intronic
1076642928 10:131931115-131931137 CTGATGGAGGGGAGAGGAGAGGG - Intronic
1078493829 11:11796310-11796332 CAGGTGGAATGGAGAGGAGAGGG - Intergenic
1078763902 11:14275167-14275189 CTGATGGAAGGGAAAGAAGTTGG + Intergenic
1081554447 11:44145040-44145062 AAGATGGAATGGAATCAAGAAGG - Intronic
1084714055 11:70862583-70862605 CTGATGGACTGGACTGCTGATGG + Intronic
1086022842 11:82252750-82252772 ATGATGGAATGGGGAGAATATGG - Intergenic
1086124900 11:83340382-83340404 GTGAGGGCAAGGAGTGAAGAGGG - Intergenic
1086572901 11:88305712-88305734 GAGATGGAATTGAGTGAAGTAGG - Intronic
1087458668 11:98420065-98420087 CTGCTGGATAGGGGTGAAGAAGG + Intergenic
1087779926 11:102291050-102291072 CGGCTGGAGTGGAGTGAATAAGG - Intergenic
1088695171 11:112360274-112360296 ATGATGGGATGGAGAGAACATGG + Intergenic
1088817574 11:113432182-113432204 CTGATGGAGTGGGGTGAAAAGGG + Intronic
1089069553 11:115688933-115688955 CTGCTGAAATGGACTGAAGAAGG + Intergenic
1089830986 11:121328029-121328051 CAGATGCAATTGAGTGATGAGGG + Intergenic
1090333089 11:125946216-125946238 TTCATGGAATGGAGTGCAAAAGG - Intergenic
1090360236 11:126167146-126167168 CAGATGGAATGGTGTGTAAAAGG - Intergenic
1090639267 11:128716651-128716673 CTGATGGAATGGAGTGCTCTGGG + Intronic
1090900533 11:131026943-131026965 CTCCTGGGATGGAGTGAAGTGGG + Intergenic
1092152824 12:6262817-6262839 CTGATGGTCTGGAGAGATGAAGG - Intergenic
1093233974 12:16583703-16583725 CTGTAGGAATGGATTGAAAAAGG + Intronic
1093367556 12:18322747-18322769 ATGATTTTATGGAGTGAAGATGG - Intronic
1093518153 12:20015757-20015779 CAGAGAGAATGGTGTGAAGATGG - Intergenic
1096753235 12:53776678-53776700 CAGATAGAAAGGAGTGAGGAGGG + Intergenic
1097806695 12:63972469-63972491 CTGATTGCAGGGAGTGGAGAAGG + Intronic
1098243256 12:68489064-68489086 CTGGTGGGAGGGAGTGAAGGGGG - Intergenic
1099414456 12:82370114-82370136 CTGCTGGATAGGGGTGAAGAAGG + Intronic
1099492971 12:83308504-83308526 CTGAGGGAATGCAGTGAAAAGGG - Intergenic
1099671479 12:85699798-85699820 CAAAGGGAATGGAGTTAAGAGGG - Intergenic
1100210477 12:92393661-92393683 CTGCTGGATGGGTGTGAAGAAGG - Intergenic
1100390089 12:94140408-94140430 CTCAGGGAATGGGGTGAAGTTGG - Intergenic
1101549355 12:105747705-105747727 GGGATGCAATGGAGTGAAGTAGG - Intergenic
1101911310 12:108862062-108862084 CTGATGGGGTGGAGTGGACAAGG + Intronic
1102534357 12:113569780-113569802 CTGAGGACATGGAGTCAAGAGGG + Intergenic
1103615489 12:122149116-122149138 CTGAAGGAAAAGAGTGGAGATGG - Intergenic
1103725337 12:122994929-122994951 CTGCTGGAATGGCGTGAGCAGGG + Exonic
1103855477 12:123966468-123966490 CTGATGGAAAGCACTGATGAGGG + Intronic
1104440196 12:128787922-128787944 CAGATGGAATCAAGTTAAGATGG - Intergenic
1104480331 12:129102013-129102035 TTCATGGAATGGAATGAAAATGG + Intronic
1105209122 13:18247515-18247537 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1105309013 13:19189883-19189905 CTGATGGAAGGGAATGAGAAGGG - Intergenic
1105326950 13:19379338-19379360 CTGATGAAATAGTTTGAAGATGG - Intergenic
1106780642 13:33056132-33056154 ATGATGCAATGGAGTGAAGCGGG + Intronic
1107381561 13:39862179-39862201 GTGATAGAAAGGAGAGAAGAGGG - Intergenic
1107896624 13:44971257-44971279 ATGAGGAAATGGGGTGAAGATGG - Intronic
1111006388 13:82255346-82255368 CTGATGGAAGGAAGGCAAGAAGG + Intergenic
1112932692 13:104761751-104761773 CTGCTGGAATGGTGTGGTGAAGG - Intergenic
1115087560 14:29535627-29535649 CGGAAGGAAGGGAGTGAGGAAGG - Intergenic
1116019862 14:39447262-39447284 TTGAAGGAATTGAGTGAGGAAGG + Intergenic
1116915712 14:50523599-50523621 ATGCCTGAATGGAGTGAAGAAGG - Intronic
1117925568 14:60775693-60775715 CTGAAGGAATGCAGTTAATATGG + Intronic
1118811895 14:69281244-69281266 CTGATTTAATGCAGTGAACAAGG + Intronic
1118976671 14:70683850-70683872 CTGTTAGGATGCAGTGAAGAGGG + Intergenic
1119197551 14:72728408-72728430 CCAATGGCATGGAGGGAAGAAGG + Intronic
1121022343 14:90587913-90587935 CCTATGGAATGGGGTGAATACGG + Intronic
1121743338 14:96269098-96269120 ATGATGGATTGGGGTGATGATGG - Intergenic
1121947561 14:98137385-98137407 CTGATGGAAGGGGGTGGAGGGGG + Intergenic
1121953094 14:98189292-98189314 CTGATGGAATGGAGACAGAAGGG + Intergenic
1125517878 15:40332975-40332997 GGGATGGGATGGAGTGAAGGGGG - Intronic
1126148891 15:45504034-45504056 CAAATGGTCTGGAGTGAAGAAGG - Intronic
1127232693 15:57014352-57014374 CTGATGGTAGGGAATGAGGAAGG - Intronic
1127300860 15:57652159-57652181 ATGAAGGAATGGAGGGAAAAAGG - Intronic
1127359441 15:58232027-58232049 ATGATGGAAAGGAGGGAACAAGG + Intronic
1127828904 15:62732404-62732426 ATGATGGAAGGAACTGAAGATGG + Intronic
1129384015 15:75185776-75185798 CTGAGGGAAGGGAGTGGGGATGG + Intergenic
1129652310 15:77499738-77499760 CTGGTGGAGGGGAGTTAAGAGGG - Intergenic
1130060834 15:80568858-80568880 CTGATGGAAGGCAGGGGAGATGG - Intronic
1131409415 15:92194306-92194328 CTGATGGAATGAAGTGTAGTGGG + Intergenic
1132857592 16:2053798-2053820 CAGATGGAATGCAGTGAGCAGGG - Intronic
1134348156 16:13411046-13411068 CTAATGGAATTGAATGAAAAGGG + Intergenic
1134634813 16:15784242-15784264 ATGATGGCAGGGAGAGAAGAGGG + Intronic
1134833140 16:17339854-17339876 CAGATGGAAGGGAGAAAAGACGG - Intronic
1137364369 16:47848097-47848119 CCTATGGAATGGAGTGGAGGTGG + Intergenic
1137379712 16:47986138-47986160 CTGATGGGATGGAGCCAAGGGGG + Intergenic
1137710354 16:50562715-50562737 CTGAAGGAAAGGAGAGAGGAGGG + Intronic
1138082632 16:54105428-54105450 AAGATGGAACGGAGTGAAAAGGG + Intronic
1138202555 16:55100972-55100994 AGGAAGGAATGGAGGGAAGAAGG + Intergenic
1138267906 16:55673254-55673276 CTGATGGAATGCACTGAGGAGGG - Intronic
1139516280 16:67454169-67454191 CTGTGGGAGTGGAGTGGAGAGGG + Intronic
1140810913 16:78576958-78576980 CTAATTACATGGAGTGAAGATGG - Intronic
1141190655 16:81822378-81822400 CAGATGAAATTAAGTGAAGAAGG + Intronic
1142859408 17:2751824-2751846 CTCATGAAATGGAGGGAATATGG - Intergenic
1142912129 17:3103131-3103153 CTGATGGGAGGGAGGGTAGAGGG + Intergenic
1143356664 17:6334793-6334815 TTGATGGAAGGGAGAGAGGAAGG + Intergenic
1143619772 17:8074136-8074158 GTGATGGGAGGGAGTGGAGAGGG - Intronic
1143904769 17:10199255-10199277 GGGACGGAATGGAGAGAAGACGG + Intergenic
1144094384 17:11886709-11886731 CTTAGGGGATGGAGTGAAGAGGG - Intronic
1145957386 17:28863974-28863996 CTGAGGGAATGGGGTGAGGTGGG - Intergenic
1146151328 17:30475258-30475280 TTGATGGCAAGGAGTGAAGATGG - Intergenic
1148731073 17:49836983-49837005 ATGATGGTAAGGTGTGAAGATGG + Intergenic
1149074625 17:52580655-52580677 CTGCTGGATAGGAGTGAAGAAGG - Intergenic
1149186218 17:54000933-54000955 GTGATGTAATGGATTGAAGTAGG + Intergenic
1150245423 17:63671108-63671130 CTGATGAAGTGGAGAGAGGAAGG + Intronic
1150379066 17:64706488-64706510 TGGCTGGAATGGAGTGAGGACGG - Intergenic
1150615450 17:66767349-66767371 CTGCTGGTACGGAGTGAAGACGG + Intronic
1203213955 17_KI270730v1_random:105610-105632 GTAATGGAATGGAGTGGAGTGGG + Intergenic
1153763105 18:8350578-8350600 CACATGGAATGGATAGAAGATGG - Intronic
1154340874 18:13501071-13501093 ATGATGGAAGGGATTGCAGAAGG + Intronic
1156997839 18:43489424-43489446 CTATTGGAAGGGAGGGAAGAAGG + Intergenic
1157029403 18:43887142-43887164 CTGATGGGATGGAATGAGGCTGG - Intergenic
1157213487 18:45763301-45763323 CAGAGAGAATGGAGGGAAGAGGG + Intergenic
1157241471 18:46014005-46014027 CTGAAGGAGAGGAGTAAAGAAGG + Intronic
1157298890 18:46465581-46465603 CTTATGAACTGGAGGGAAGATGG - Intergenic
1158013497 18:52756442-52756464 CTGCTGAAATCCAGTGAAGAAGG - Intronic
1158047878 18:53178093-53178115 CTGATTGAACTGAGTGAAGAAGG - Intronic
1158257750 18:55572407-55572429 CTGAGAAAATGGAGTGAGGAGGG + Intronic
1158621832 18:59039701-59039723 CTGGTGGAGTGGGGTGAGGATGG + Intergenic
1159548675 18:69872109-69872131 CTGAAGGAGAGGAGTGCAGATGG + Intronic
1161202063 19:3020527-3020549 CTGATGGCAGGGAGTGTAGGGGG - Intronic
1163383748 19:16986249-16986271 CTCAGGGCATGGAGGGAAGATGG - Intronic
1163741826 19:19019021-19019043 CTGATGGTATTGAGAGCAGAGGG - Intronic
1163803437 19:19382115-19382137 TTGAATGAAAGGAGTGAAGATGG - Intergenic
1165256153 19:34578234-34578256 CAGATGGCATAAAGTGAAGAAGG - Intergenic
1165487942 19:36106691-36106713 CGGCTGGAATGGAGTGAGCAAGG + Intergenic
1167909244 19:52688614-52688636 GAGAAGGAATAGAGTGAAGAAGG - Intronic
1167958804 19:53089891-53089913 GAGAAGGAATGGAGGGAAGAAGG - Intronic
1168419559 19:56192454-56192476 CTGATGGAACGTAGGGAAGGAGG - Intronic
1168421440 19:56206671-56206693 CTGATGGAATGTAGGGAAGGAGG + Intronic
1168424021 19:56224272-56224294 CTGATGGAATGTAGGGAAGGAGG - Intronic
1168426695 19:56244800-56244822 CTGATGGAATGTAGGGAAGGAGG + Intronic
1168481023 19:56719693-56719715 CTGCTGGGATGGAGGAAAGATGG + Intergenic
925428289 2:3769439-3769461 CTGATGGAATGGAGTGAAGACGG - Intronic
925472774 2:4180718-4180740 CTGAGGGCATCCAGTGAAGAAGG - Intergenic
925501759 2:4512747-4512769 CAGCTGGAATGGAGTGAAGGAGG - Intergenic
925592275 2:5521849-5521871 CTAATGCAATGGTGTGAAGCTGG - Intergenic
925949258 2:8895699-8895721 CTGCTGGATAGGAGCGAAGAAGG + Intronic
927282967 2:21326857-21326879 CTGAGGGGATGGTGTGTAGATGG - Intergenic
928766343 2:34651012-34651034 ATGATGCAATGGAAAGAAGAGGG + Intergenic
930426189 2:51216080-51216102 CTAATGGAACTTAGTGAAGAAGG + Intergenic
930864334 2:56107986-56108008 CTGATGGAACAGGGAGAAGATGG + Intergenic
931374553 2:61695517-61695539 GTGAAGGAATTCAGTGAAGAGGG - Intergenic
931902695 2:66807125-66807147 TTGATGGAATTGGGTTAAGATGG - Intergenic
933608998 2:84414837-84414859 GTGATGGGATGAAGTGAAGGAGG - Intergenic
933941527 2:87248865-87248887 CAGATGGAATGCATTGCAGAAGG - Intergenic
934192776 2:89814899-89814921 CTGATGGAATGGAATGAAATGGG - Intergenic
935125755 2:100221451-100221473 CTGATGCAATGGGGTGGGGAAGG - Intergenic
935626835 2:105178651-105178673 CTGATGTAATGAAGTTAAGATGG + Intergenic
935726022 2:106024629-106024651 CTGAGGGTGTGGAGTCAAGAGGG + Intergenic
935841254 2:107113569-107113591 CTGATGGAGAGGAGTGAATGAGG + Intergenic
936338698 2:111612726-111612748 CAGATGGAATGCATTGCAGAAGG + Intergenic
937050481 2:118884241-118884263 CTGCTGGATAGGGGTGAAGAAGG + Intergenic
937915343 2:127096163-127096185 CTGATAGAATGGGGAGGAGAGGG - Intronic
938913520 2:135909583-135909605 TTGTTGGAATGGGGAGAAGATGG - Intronic
939852549 2:147318620-147318642 CTGCTGGATAGGGGTGAAGAAGG - Intergenic
940153418 2:150628051-150628073 CTGATATAATGGAATGAAAAGGG + Intergenic
941124821 2:161571966-161571988 TTGATGAAATTGAGAGAAGATGG - Intronic
941610301 2:167653603-167653625 CTGAAGGAATGCAGTGCACAGGG - Intergenic
942050698 2:172137819-172137841 CTTAGGGAATGGAGTTTAGAAGG - Intergenic
942484079 2:176421201-176421223 CTGCTGGAACGGAATGATGAAGG + Intergenic
942855793 2:180545976-180545998 TTGAAGGTATGGAGTGAGGAAGG + Intergenic
943102734 2:183507972-183507994 CTGCTGGATAGGGGTGAAGAAGG + Intergenic
943134339 2:183892271-183892293 CTGCTGGATAGGGGTGAAGAAGG - Intergenic
943388415 2:187230935-187230957 GTGATGGAAAGGAGAGAAGATGG - Intergenic
943703710 2:191013701-191013723 CTGATGGAAAGGGGTGGAAACGG + Intronic
946059111 2:216926605-216926627 CTCATGGAAAGGAGAGAATAGGG - Intergenic
946127165 2:217572977-217572999 CTGATGAGATGGAATTAAGAAGG + Intronic
946630337 2:221660336-221660358 CTGATGGGATTGAGTATAGAGGG - Intergenic
947071031 2:226288050-226288072 CTTAAGGAAGAGAGTGAAGAAGG - Intergenic
948241007 2:236434988-236435010 CTCATGGAATTCAGTGAAGGAGG + Intronic
948636059 2:239338354-239338376 CTGATGGAATGAAGGGAAGCGGG - Intronic
1168868416 20:1108537-1108559 CTGGTGGAATGAAGTCAGGATGG + Intergenic
1168879820 20:1196844-1196866 CTGATGCAATGTAGTGACAAGGG - Intergenic
1169623172 20:7531313-7531335 CTGGTGGAATTGATTCAAGATGG - Intergenic
1169766971 20:9157074-9157096 TAAATGGAGTGGAGTGAAGAAGG + Intronic
1169974116 20:11304205-11304227 CTGATGCAATCAAATGAAGATGG + Intergenic
1170434931 20:16316583-16316605 CTGAATGACTGGAATGAAGAAGG + Intronic
1170440377 20:16373396-16373418 ATGTTTAAATGGAGTGAAGAAGG + Intronic
1170638665 20:18132204-18132226 TTTATGGAAAGGAGTGAAAAAGG + Intergenic
1170938268 20:20827964-20827986 GGGAAGGAATGGAGTGAGGAGGG + Intergenic
1171049891 20:21847469-21847491 CAGATGGAAAAGAGTGAAGTTGG + Intergenic
1171290295 20:23979230-23979252 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1172314566 20:33943758-33943780 CTGGAGGAGTGGAGTGATGATGG + Intergenic
1172340991 20:34157444-34157466 CTGCTGGATAGGGGTGAAGAAGG - Intergenic
1174299011 20:49568468-49568490 GTGATGGAAGGGAGGGGAGAGGG + Intergenic
1174509737 20:51042065-51042087 CTGATGGACTGGATGGAACAGGG - Intergenic
1176754940 21:10718879-10718901 GTAATGGAATGGAGTGGAGTGGG - Intergenic
1177136058 21:17306381-17306403 CTGCTGGATAGGGGTGAAGAAGG - Intergenic
1177457485 21:21360603-21360625 GTGATTGAAAGGAGTGAACAAGG - Intronic
1178767397 21:35467179-35467201 CTTATGGAATAGAGTGAGGCCGG - Intronic
1180067940 21:45421953-45421975 GGCATGGAATGGGGTGAAGATGG - Intronic
1180767133 22:18351782-18351804 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1180779178 22:18510597-18510619 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1180811897 22:18767917-18767939 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1180935167 22:19620670-19620692 CTGAGGGCATGGCGAGAAGACGG + Intergenic
1181198052 22:21202161-21202183 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1181401693 22:22653643-22653665 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1181468961 22:23126487-23126509 CAGATGGAATGCAGGGAAGGAGG - Intronic
1181647857 22:24243457-24243479 ATGGGGGAATGGAGGGAAGAAGG + Intronic
1181703651 22:24634736-24634758 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1182414078 22:30209883-30209905 CTGATGGAAAAGACTGAGGATGG + Intergenic
1203228755 22_KI270731v1_random:92676-92698 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1203300747 22_KI270736v1_random:75375-75397 GGAATGGAATGGAGTGGAGAGGG + Intergenic
1203313713 22_KI270736v1_random:163609-163631 CGAATGGAATGGAGTGTTGACGG + Intergenic
949093578 3:59436-59458 CTCAAGGACTGGATTGAAGAGGG - Intergenic
949679224 3:6493979-6494001 CTAAAGGGAGGGAGTGAAGAAGG - Intergenic
949759632 3:7455219-7455241 ATGATGGAATAAAGTTAAGATGG + Intronic
950100777 3:10355435-10355457 CTGAAGGAAGTGAGGGAAGATGG + Intronic
950702799 3:14761718-14761740 CTGAAGGGATGGAGTGGGGAGGG + Intronic
950853316 3:16083147-16083169 GTGGTGGAGGGGAGTGAAGATGG + Intergenic
950976950 3:17256794-17256816 ATGATGGGATAGAGTGAATAGGG + Intronic
951180645 3:19654742-19654764 CTGGTGGAGTGGTGAGAAGAGGG - Intergenic
951403457 3:22264060-22264082 GATATGGAATGGAGTGAGGAAGG + Intronic
951459721 3:22937715-22937737 CTGATGGAATGGAGTGGTGGTGG - Intergenic
951615584 3:24539996-24540018 CTGAAGAAAAGGAGGGAAGAGGG - Intergenic
952102668 3:30032950-30032972 CTGAGGGGATGGAGGTAAGAGGG + Intergenic
952364392 3:32662066-32662088 CTGAGGGGAGGGAGTGGAGAGGG + Intergenic
952453604 3:33453186-33453208 CTGCTGGATAGAAGTGAAGAAGG - Intergenic
954599389 3:51856154-51856176 CTGCTGGACAGGGGTGAAGAAGG - Intergenic
954697916 3:52437276-52437298 GTGATGGAAGAGAGAGAAGAGGG - Intronic
956842481 3:73153490-73153512 CTGCTGGATAGGGGTGAAGAAGG + Intergenic
957978026 3:87472461-87472483 CTTATGGAATGGAGTGGTGTGGG + Intergenic
961012694 3:123447135-123447157 CTGTGGGAATGCAGTGAGGAAGG - Intronic
961225752 3:125244389-125244411 CGGATGGAATGGTTTGAAGAGGG - Intronic
961232862 3:125334847-125334869 CTGCTGGAGTGGAGTGAACAAGG - Intronic
962079668 3:132124505-132124527 TAGAAGGAAAGGAGTGAAGAAGG - Intronic
962981841 3:140497812-140497834 CTGATGGCATGGACTCATGAGGG + Intronic
963697314 3:148577504-148577526 CTGCTGGATAGGGGTGAAGAAGG - Intergenic
963894720 3:150673145-150673167 CGGATGGAAGGGAGGGAGGAAGG - Intronic
964972565 3:162579507-162579529 CTGCTGGATAGGGGTGAAGAAGG - Intergenic
965687113 3:171315852-171315874 CAGATGTAATGAAGTTAAGATGG - Intronic
966419764 3:179726088-179726110 CAGATGGTAGGGAGTGAGGAAGG + Intronic
967099377 3:186203631-186203653 CTGCTGGACTGGATTGAGGAAGG + Intronic
967640289 3:191854725-191854747 CTTAGAGAAGGGAGTGAAGAAGG - Intergenic
968148562 3:196319622-196319644 CTGAAAGAATGGAGGCAAGAAGG + Intronic
969195354 4:5558889-5558911 CTGTTGGAATGGAGAGGAGAAGG + Intronic
969333412 4:6492976-6492998 GTGTTGGAATGGAGTGAGGAGGG - Intronic
969723362 4:8905539-8905561 ATGATGGAATGAAATGAAGAGGG + Intergenic
970240824 4:14006896-14006918 ATGAGGGGAAGGAGTGAAGAGGG + Intergenic
970739629 4:19220257-19220279 CTAATGGAATGGAAGGAAGAAGG + Intergenic
971400289 4:26269775-26269797 TTGAGGGAAGGGAGTGAAGGGGG + Intronic
973816412 4:54623418-54623440 CTGCTGGAACAGAGTGAGGAAGG - Intergenic
974527426 4:63061655-63061677 CTGCTGGATAGGGGTGAAGAAGG - Intergenic
974757387 4:66228104-66228126 CTGGAAGAATGGAGTCAAGAGGG + Intergenic
974969323 4:68804888-68804910 CTGATGGTTAGGGGTGAAGAAGG - Intergenic
975153268 4:71044113-71044135 CTCATGGAGAGGAATGAAGAAGG + Intergenic
975595283 4:76043919-76043941 CTGCTGGATAGGGGTGAAGAAGG + Intronic
975895365 4:79083793-79083815 CAGATGGGATGGAGGGAGGACGG - Intergenic
976395384 4:84549975-84549997 CTCATGGAAAGGAATGAAAAGGG + Intergenic
977640751 4:99355606-99355628 CTGCTGGATAGGAGCGAAGAAGG - Intergenic
978174461 4:105712405-105712427 TGGCTGGAAGGGAGTGAAGAAGG + Intronic
979504291 4:121478306-121478328 CAGATGTAATCGAGTTAAGATGG + Intergenic
979841241 4:125443393-125443415 CTGAGGGAATGTAGTGAAGACGG - Intronic
980587551 4:134836494-134836516 CTGATGAAATAAATTGAAGAAGG - Intergenic
983534480 4:168842756-168842778 ATGAGGGCATGGAGAGAAGACGG - Intronic
984661756 4:182382048-182382070 CTGATAGAATGTATTAAAGAGGG + Intronic
985124799 4:186682777-186682799 CTGATGACATGGAGAAAAGAAGG - Intronic
985427369 4:189843902-189843924 CAGATGCAGTGGAGGGAAGAAGG - Intergenic
986585240 5:9309559-9309581 CTGGAGGCATGGATTGAAGACGG + Intronic
986926834 5:12764920-12764942 CTGATAGAATGGAGACAAGCAGG + Intergenic
988286364 5:29222819-29222841 CTGATAAAACGGAGTGAACAAGG - Intergenic
988591476 5:32553392-32553414 CTGCTGGATAGGTGTGAAGAAGG + Intronic
988837137 5:35044647-35044669 ATGAAGGAATGGAGGGAAGGAGG - Intronic
990313072 5:54558369-54558391 ATGATGGAATGGAGAGAGGGAGG - Intergenic
992230628 5:74659973-74659995 CTGATGGAATGGAGAGGATTAGG + Intronic
993488027 5:88511007-88511029 GTGATGCAATGGAGTGAGCATGG + Intergenic
994003601 5:94811172-94811194 AAGATGGAATGGAGTAAAGAAGG - Intronic
995266127 5:110163231-110163253 CTAAAGGAATGGAGTGAGGCAGG + Intergenic
995673849 5:114639890-114639912 CTGATAGAATGAATTGAAAAAGG - Intergenic
995707310 5:114999072-114999094 CTGCTGGATAGGGGTGAAGAAGG - Intergenic
997712213 5:136015318-136015340 CTAATGGGATGGGGTGAAGTGGG + Intergenic
998149553 5:139748966-139748988 CTGTTGGGATGGAGTGCAGGTGG + Intergenic
998712963 5:144848102-144848124 CTGCTGGATAGGGGTGAAGAAGG + Intergenic
999132987 5:149298964-149298986 CTGATAACATGGAGTGAGGAGGG + Intronic
999236858 5:150103790-150103812 GTGAAGGAATGGAGTGGAGATGG + Intronic
999343742 5:150796425-150796447 CTGGTGGGAGGGAGTGAAGGGGG - Exonic
999758529 5:154682887-154682909 CGGGTGGAATGGAGGGAGGAGGG - Intergenic
1001011555 5:168103627-168103649 CTGATGTAATGCACTGAGGAGGG - Intronic
1002079458 5:176728735-176728757 CTGTCGGGATGGAGAGAAGAAGG + Intergenic
1003550529 6:7098684-7098706 CTGAGGGTAAGGAGAGAAGAAGG - Intergenic
1004070873 6:12296242-12296264 CTGATGGAAGCCAGTGAAGATGG - Exonic
1004521963 6:16369730-16369752 CTGGTGGAATGAAATAAAGAAGG - Intronic
1004532220 6:16464016-16464038 CTGCTGGATAGGGGTGAAGAAGG - Intronic
1004812820 6:19278101-19278123 CTGCTGGATAGGGGTGAAGAAGG - Intergenic
1004891910 6:20109156-20109178 CTGATCGAGTGGTGTGCAGAAGG - Intronic
1005804873 6:29464898-29464920 CTGCTAAAATGGAGTGAAGAAGG - Intergenic
1006226256 6:32539050-32539072 CTGATGGATAGGGGCGAAGAAGG - Intergenic
1006554867 6:34857359-34857381 CTGCAGGAAAGGAGTGTAGATGG - Exonic
1006883609 6:37360989-37361011 CAGATTGAAAGGAGTGAGGAAGG - Intronic
1006905333 6:37529490-37529512 ATGAAGGAATGGAGTGATGAAGG - Intergenic
1007019735 6:38507487-38507509 TGGATGGTATGGAGAGAAGAGGG - Intronic
1007567120 6:42860078-42860100 GTGAGGGAATGCAGTGTAGAAGG + Intronic
1007697171 6:43741088-43741110 CTGCTGGAATGGAGCAATGAAGG + Intergenic
1009385079 6:63078027-63078049 CTGCTGGATAGGGGTGAAGAAGG + Intergenic
1009407196 6:63327086-63327108 CTGCTGGATAGGGGTGAAGAAGG + Intergenic
1010021395 6:71163858-71163880 CTGGAGGAATGGAGTGAGTATGG - Intergenic
1012480676 6:99663675-99663697 GGGAAGGAAGGGAGTGAAGAAGG - Intergenic
1012496995 6:99844424-99844446 GGGATGGAATGAAGTGAGGAGGG + Intergenic
1012620069 6:101333117-101333139 CTAAAGGAATGCAGAGAAGAAGG - Intergenic
1012992228 6:105937997-105938019 GGGCTGGAATGGAGTGAAGGAGG - Intergenic
1013209706 6:107975381-107975403 GTTATGGAATGGGGAGAAGATGG + Intergenic
1014052362 6:116969498-116969520 TTGATGGAATGGGGAGAACAAGG + Intergenic
1014778513 6:125537435-125537457 CTGGTGCTGTGGAGTGAAGAAGG - Intergenic
1014882219 6:126737238-126737260 CTTGTGGAATGGAGAGAACAGGG - Intergenic
1015517579 6:134099321-134099343 GTAATGGGATGGAGTGAGGAAGG - Intergenic
1018492962 6:164315591-164315613 CTGCTGGCATGTAGTGATGAAGG + Intergenic
1018630547 6:165818189-165818211 GAGATGGAATGGGATGAAGATGG - Intronic
1018650415 6:165987820-165987842 CAGATGGAAAGGAGGGAAGGAGG - Intergenic
1021089358 7:16464591-16464613 GTAGTTGAATGGAGTGAAGAAGG + Intronic
1021224905 7:18015224-18015246 CTGATAGAATATAGAGAAGAAGG + Intergenic
1021356041 7:19654394-19654416 CTGCTGGATAGGGGTGAAGAAGG + Intergenic
1021873336 7:25025651-25025673 CTGGTGGAATTGGGTGCAGAAGG + Intergenic
1022280928 7:28908417-28908439 CTGAGGGAAGGGGGTGAGGAGGG + Intergenic
1023460760 7:40393747-40393769 CTGAAGGAAGGGAATGAAGATGG + Intronic
1024804206 7:53117612-53117634 CTGATGGGGTGGAGTCAGGAAGG + Intergenic
1026696222 7:72595092-72595114 TTGAAGGAAAGTAGTGAAGATGG - Intronic
1027179967 7:75931744-75931766 CTGATGGAAAGGACTCAAAAGGG - Intronic
1029252567 7:99247571-99247593 CTGGTGGGAGGGAGGGAAGATGG - Intergenic
1029469688 7:100746486-100746508 TGGATGGAATTGAGGGAAGATGG - Intronic
1029588608 7:101492039-101492061 CTGCTGGGATGGAATGATGAGGG + Intronic
1030078049 7:105753619-105753641 CTGCTGTAATGGAGAGGAGAGGG - Intronic
1030088133 7:105834849-105834871 GTGATGGAGTGGAGGGGAGAGGG + Intronic
1030105097 7:105980699-105980721 CTGATGCAATTGACTGGAGATGG - Intronic
1030420805 7:109304216-109304238 CTGCTGGATAGGGGTGAAGACGG - Intergenic
1031113939 7:117646654-117646676 CTGATGGCATGGGGTGTAGGTGG + Intronic
1031256990 7:119465557-119465579 CTGGTGGAAGGGTGTGAAAAAGG - Intergenic
1031952550 7:127907231-127907253 GTGATGGAAAGAAGGGAAGAAGG - Intronic
1033765082 7:144480527-144480549 ATTAGGGAATGGAGTGTAGAGGG + Intronic
1034579312 7:152028747-152028769 CTGCTGGATAGGGGTGAAGAAGG + Intronic
1035012418 7:155731216-155731238 CTGATGGAAGGTAGGAAAGAAGG + Intronic
1035693020 8:1572218-1572240 CTGATGAGATGGAGAGGAGAGGG + Intronic
1035693093 8:1572586-1572608 CTGCTGGTATGGAGAGGAGAGGG + Intronic
1035825641 8:2641842-2641864 CTGAGAGGATGGAGTGAAGGAGG + Intergenic
1036918436 8:12828343-12828365 CTGATGTAATGGAGTCCAGGAGG + Intergenic
1037139962 8:15507870-15507892 CAGATGGAAAGGAGTGAAGGTGG + Intronic
1037444949 8:18956090-18956112 CTGAATGAATGGAAGGAAGAAGG + Intronic
1037597132 8:20363612-20363634 CAGATGTAATCGGGTGAAGATGG + Intergenic
1038239191 8:25792509-25792531 CTGATGGAGTGAAGAGAGGAAGG + Intergenic
1038257850 8:25967074-25967096 ATGATGGAATGAAATGCAGATGG + Intronic
1039637205 8:39179832-39179854 CTCATGGAAAGGAATGAAAACGG - Intronic
1040008553 8:42641678-42641700 CTGTTAGAATGGAGTGAGCATGG - Intergenic
1040999574 8:53437509-53437531 CTGCTGGATAGGGGTGAAGAAGG + Intergenic
1041002806 8:53468357-53468379 CTGCTGGATAGGGGTGAAGAAGG - Intergenic
1042745111 8:72098787-72098809 CTGAAAGAATGGAGGGAAGCTGG - Intronic
1042823056 8:72952754-72952776 CTGAGGGAAGAGGGTGAAGAGGG - Intergenic
1043196214 8:77295627-77295649 CTTATAGAATTGTGTGAAGAGGG - Intergenic
1043301970 8:78744798-78744820 CTGATGGAGTGGGTTCAAGAGGG + Intronic
1044004636 8:86926265-86926287 CTGCTGGATAGGGGTGAAGAAGG + Intronic
1045611317 8:103846345-103846367 GTAAGGGAATGGAGTGAAGCAGG + Intronic
1045815362 8:106271075-106271097 CTGAGGGATTTGGGTGAAGAGGG + Intronic
1045858874 8:106793529-106793551 CTGCTGGATAGGGGTGAAGAAGG - Intergenic
1046462045 8:114552132-114552154 CAACTGGAGTGGAGTGAAGAAGG - Intergenic
1047555335 8:125923297-125923319 CTGATAAAATGCAGTGAGGATGG + Intergenic
1048340413 8:133534455-133534477 CGGATGGCATGGGGTGAAGGAGG - Intronic
1048457056 8:134587741-134587763 ATGAGGGAATGGAGAGAAGAAGG - Intronic
1048757600 8:137755750-137755772 CTGCTGGATAGGGGTGAAGAAGG + Intergenic
1048772037 8:137905344-137905366 CCTTTGGAATGGAGTGATGAGGG + Intergenic
1049169214 8:141148234-141148256 CTGGTGGAAAGGAGGGAGGAGGG + Intronic
1049877615 8:145035786-145035808 CTGCTGGATAGGGGTGAAGACGG - Intergenic
1050438649 9:5636214-5636236 CTGATGAAATAAACTGAAGAAGG - Intronic
1051786465 9:20749972-20749994 CTAACAGAATGGAGTGAGGAAGG - Intronic
1053445741 9:38151730-38151752 CTCATGAAATGGATTAAAGATGG + Intergenic
1055421349 9:76146404-76146426 CTGATAGAAATGACTGAAGAAGG + Intronic
1055916464 9:81406829-81406851 CTGAAATAATGGACTGAAGAGGG + Intergenic
1056507592 9:87271614-87271636 CTGAAGACACGGAGTGAAGAAGG - Intergenic
1057572542 9:96215584-96215606 TGGATGGAATGGACTGCAGACGG - Intergenic
1057841242 9:98487014-98487036 CTCAAGGAAGGGAGCGAAGAGGG + Intronic
1059761480 9:117341859-117341881 CTAATGGAATTGAGTGTATATGG - Intronic
1059820808 9:117970007-117970029 CTGATGGAATGGACAGAAACTGG - Intergenic
1059915462 9:119094787-119094809 CTGATTTAATGGTGTGAAAAGGG + Intergenic
1060127984 9:121068459-121068481 CTGATGGAAGAAATTGAAGAGGG + Intergenic
1061522839 9:131131146-131131168 TTTATGGAATGGACTGAAAAAGG - Intronic
1061653416 9:132069167-132069189 CTGATGGAAGAGAGTCAAGCAGG + Intronic
1061802113 9:133118382-133118404 CAGGTGGGCTGGAGTGAAGAGGG - Intronic
1203353015 Un_KI270442v1:96814-96836 CGAGTGGAATGGAGTGAAAAAGG + Intergenic
1185627293 X:1491934-1491956 GTGATGGAATGGACAGAAGGCGG + Intronic
1186406929 X:9312856-9312878 GTGATGGATGGGAGGGAAGAAGG + Intergenic
1187992266 X:24887728-24887750 TTGATGTATTGGAGTGAGGAAGG + Intronic
1189301065 X:39952700-39952722 CTGATGGAATAGAATGTAGATGG - Intergenic
1190328509 X:49221386-49221408 AGGCTGGAATGGAGTGAGGAAGG - Intronic
1190605184 X:52134182-52134204 CTCAGGGAATTGAGTGAGGATGG + Intergenic
1190787828 X:53669798-53669820 CTGAAGTAATGGTGTGAAGTAGG - Intronic
1192424999 X:71067800-71067822 CTGAAGGAAGGGAGGGAGGATGG - Intronic
1193136856 X:77981402-77981424 GTGAAGGAATGGTGTAAAGAGGG + Intronic
1194771313 X:97909238-97909260 TTGATGGAATGAAGTGATGGAGG + Intergenic
1195309295 X:103615226-103615248 CTGAGGGAAGGGAGGGAAGCAGG + Intronic
1195551978 X:106181678-106181700 CTGCTGGATAGGGGTGAAGAAGG + Intronic
1195850615 X:109278234-109278256 CTGCTGGATAGGGGTGAAGAAGG + Intergenic
1198686404 X:139232222-139232244 CTGATTAAATGTAGTGAGGAAGG + Intergenic
1198777384 X:140194725-140194747 CAGATCGAATGGATTGCAGATGG + Intergenic
1199535722 X:148900636-148900658 CTGATGGAGTGAAGTGTGGAAGG + Intronic
1199878651 X:151955202-151955224 CTGATGTAATGGTGAGAAGTTGG - Intronic
1200960066 Y:8988318-8988340 CTGCTGGATAGGGGTGAAGAAGG - Intergenic
1201106097 Y:10764543-10764565 GGAATGGAATGGAGTGAAAATGG - Intergenic
1201113757 Y:10820028-10820050 GAAATGGAATGGAGTGGAGAGGG - Intergenic
1201404575 Y:13636686-13636708 CTGCTGGATAGGGGTGAAGAAGG - Intergenic
1201430428 Y:13896965-13896987 CTGCTGGACAGGAGTGATGAAGG - Intergenic
1201488059 Y:14512542-14512564 CTGCTGGATAGGGGTGAAGAAGG - Intergenic
1201648463 Y:16261060-16261082 CTGCTGGATAGGGGTGAAGAAGG + Intergenic
1201654347 Y:16324241-16324263 CTGCTGGATAGGGGTGAAGAAGG - Intergenic
1201907527 Y:19100895-19100917 CTGTTGGATAGGGGTGAAGAAGG + Intergenic
1201989258 Y:20006991-20007013 CTGCTGGATAGGGGTGAAGAAGG + Intergenic
1202604863 Y:26630264-26630286 CTGATGAAATAGTTTGAAGATGG + Intergenic