ID: 925428858

View in Genome Browser
Species Human (GRCh38)
Location 2:3773916-3773938
Sequence TGAGACTCTCTAAAAATAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 4, 3: 9, 4: 225}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925428858_925428859 -5 Left 925428858 2:3773916-3773938 CCAGTTATTTTTAGAGAGTCTCA 0: 1
1: 0
2: 4
3: 9
4: 225
Right 925428859 2:3773934-3773956 TCTCAAAGAGTCAGTGCAAAAGG 0: 1
1: 0
2: 1
3: 12
4: 200
925428858_925428860 12 Left 925428858 2:3773916-3773938 CCAGTTATTTTTAGAGAGTCTCA 0: 1
1: 0
2: 4
3: 9
4: 225
Right 925428860 2:3773951-3773973 AAAAGGAGAGTATCTTTCCTTGG 0: 1
1: 0
2: 1
3: 36
4: 261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925428858 Original CRISPR TGAGACTCTCTAAAAATAAC TGG (reversed) Intronic
901907030 1:12421830-12421852 TGAGACTGTCTCAAAAAAAGGGG - Intronic
902761368 1:18582928-18582950 TGTGACTTTGGAAAAATAACTGG - Intergenic
903770819 1:25763254-25763276 TGAGACTGTCTCAAAAAAAAAGG + Intronic
904742974 1:32692742-32692764 CGAGACTCTGTAAAAATAACTGG + Intronic
905818533 1:40970953-40970975 TGAGACTTACTGAAAATAAATGG - Intergenic
906849622 1:49234363-49234385 TGAAACTTTCTAAAAAGAAATGG + Intronic
907217259 1:52874853-52874875 TGAGACTGTCTCAAAAAAAAAGG + Intronic
910138924 1:84004825-84004847 TCAAACACTCTAAAAATAATGGG - Intergenic
911046314 1:93631632-93631654 TGAGAGACTCAAAAACTAACAGG - Intronic
911789423 1:101993589-101993611 TGAGTTTTTCTAAAAAGAACTGG + Intronic
912486988 1:110036538-110036560 TCAGACTCTCTATAAAGAAATGG - Intronic
914809427 1:151015874-151015896 TGAGACACACTAAATATAGCAGG - Intronic
915207139 1:154278496-154278518 TGAGACTGTCTCAAAAAAAAAGG + Intergenic
916384509 1:164252331-164252353 TGAAAGTCTTTAAAAATTACAGG - Intergenic
918509713 1:185298006-185298028 TAAGACCCTCTCAAACTAACAGG - Exonic
919036535 1:192318139-192318161 TGACATTGTCTAAAAATAACAGG - Intronic
919288411 1:195596347-195596369 TGAGATTCTATAAAAATGAAGGG - Intergenic
921133549 1:212240206-212240228 TTAGATCTTCTAAAAATAACAGG - Intergenic
921665951 1:217871030-217871052 TGAGACTAGTTAAAAGTAACAGG - Exonic
921916462 1:220617036-220617058 TCAGTCTCTCTAAAAATGTCTGG - Intronic
924000538 1:239546412-239546434 TCAAACTCTGTAAAAATAAATGG + Intronic
924283456 1:242461473-242461495 TGTGACTTTTTAAAAATAAAAGG - Intronic
1063243958 10:4199459-4199481 TTAGACTCCCCAAAAATATCTGG - Intergenic
1064937347 10:20692802-20692824 CGAGTCTCTGGAAAAATAACTGG + Intergenic
1068387768 10:56353988-56354010 TGAATATCTCTAAAAATAAATGG - Intergenic
1068746598 10:60538817-60538839 TTACACTTTCTAAAAATAAATGG + Intronic
1070974897 10:80598740-80598762 TGAGACTCTCTGAATACATCAGG + Intronic
1072078391 10:92002334-92002356 AGAGCCTCTATAAAAATCACTGG - Intronic
1072263043 10:93700841-93700863 CGAGACTCTCCAAAAATAACTGG - Intronic
1075478683 10:122759840-122759862 AGAGACTCTCTGAAAATCTCTGG + Intergenic
1079648985 11:22902684-22902706 AAAGACTCACTAAAAATAAGAGG + Intergenic
1080183821 11:29455451-29455473 TGACAAATTCTAAAAATAACAGG - Intergenic
1080186296 11:29491208-29491230 TGAAATTATCTAAAAATAAGAGG + Intergenic
1081297392 11:41408769-41408791 TGAGTCTCTCAAAAATTAAATGG + Intronic
1081432766 11:42994727-42994749 AGAGAAACTCTTAAAATAACAGG - Intergenic
1082949748 11:58800271-58800293 TGAAACTATTTCAAAATAACAGG + Intergenic
1083565411 11:63711272-63711294 TGAGACTGTCTCAAAAAAAAAGG + Intronic
1083956970 11:65989395-65989417 TGAGAATCTATCACAATAACTGG + Intergenic
1090312102 11:125750183-125750205 ACAGTCTCTGTAAAAATAACTGG - Intergenic
1090383838 11:126345113-126345135 TGAGACTCTCCCAAAAGAAGTGG - Intronic
1091893466 12:4081994-4082016 TGAGACTCAGTTAAAATGACTGG + Intergenic
1093367424 12:18321398-18321420 TGAAACTCCCTGAAAATAAATGG + Intronic
1094188294 12:27668758-27668780 TGAAAGGCTCTAAAAATAATGGG - Intronic
1094484264 12:30911899-30911921 TGAGACTCTCCAAAGACATCCGG + Intergenic
1094687137 12:32729091-32729113 TGAGACTGTCTCAAAAAAAGGGG - Intronic
1095934518 12:47662559-47662581 TGATAGTCTCTAAAATTAACTGG + Exonic
1097285601 12:57874714-57874736 TGTCACTATCTAAAAATATCTGG - Intergenic
1097524175 12:60709944-60709966 TGAGACTCTCTAGACATAGTTGG + Intergenic
1099212794 12:79814132-79814154 TAAGAATCACTGAAAATAACAGG + Intronic
1099336896 12:81373005-81373027 TTAGAATATATAAAAATAACTGG - Intronic
1101609809 12:106280176-106280198 TCAGAGTCTTTAAAAATAAATGG + Intronic
1103594340 12:122014716-122014738 TGAGACTCTCTTAAAAAAACAGG - Intergenic
1108265606 13:48705153-48705175 GGACACTATATAAAAATAACAGG - Intronic
1108677227 13:52747633-52747655 TAAGACTATGTAAAAATAATTGG + Intergenic
1109727374 13:66360670-66360692 TTAGGCTCTCTGAAAATCACTGG + Intronic
1113968685 13:114171386-114171408 TGGGACTCTTTAAGAAAAACAGG - Intergenic
1115732054 14:36281298-36281320 TGAAACTCTCTAAACAAAAAGGG - Intergenic
1117487123 14:56209675-56209697 TTACGCTCTCTAAAAATGACTGG - Intronic
1118874341 14:69770558-69770580 TGAAAGTCTTTAAAAATATCCGG + Intronic
1119155587 14:72406970-72406992 TCAGACTTTATGAAAATAACCGG + Intronic
1119594258 14:75919269-75919291 TGAGATTCTCCAAAAAGAATAGG + Intronic
1119877437 14:78072885-78072907 TGAGACTCTCCAACTAGAACAGG - Intergenic
1120480060 14:85038293-85038315 CAAGACTCTCTAAAAAAAATAGG - Intergenic
1120916580 14:89715853-89715875 TGAGACTCCCTAAAATAACCAGG - Intergenic
1121879178 14:97484709-97484731 AGACAGTCTCTAATAATAACAGG + Intergenic
1122233033 14:100316616-100316638 TGAGACTCTCAAAAAAAAAAAGG - Intergenic
1123879342 15:24660984-24661006 AGAGAATCTATAAAAATTACTGG + Intergenic
1126150384 15:45518572-45518594 TGAGACTCTCTCAAAAAGAAGGG - Intronic
1127120175 15:55765113-55765135 TGAGACTGTCTAAAAAAAAAAGG + Intergenic
1128872192 15:71168558-71168580 TTAGAGTTTCTATAAATAACAGG - Intronic
1132538220 16:494286-494308 TGAGACTCCCTAGAACTAATAGG - Intronic
1134144615 16:11750037-11750059 TGTGACTCTCTAAAAATACTAGG - Intergenic
1134431294 16:14209462-14209484 TGAGACTATTTCAAAATAAGGGG - Intronic
1135715851 16:24766107-24766129 ACAAACTCTCTAAAAATAAAGGG - Intronic
1137803215 16:51279806-51279828 TGAAACACTCAAAGAATAACAGG - Intergenic
1138366449 16:56482135-56482157 TTAGACTCCCTAAAAATGAATGG + Intronic
1138612354 16:58136106-58136128 TGAGACTATCTCAAAAAAAAAGG - Intergenic
1139116319 16:63958156-63958178 TGATTCTCTCCAAAAATAACAGG - Intergenic
1139709726 16:68766737-68766759 TGAGACTGTCTCAAAAAAAAAGG - Intronic
1139833527 16:69820057-69820079 TGAGACCCTCTACAAAAAATAGG + Intronic
1139908728 16:70383538-70383560 TGAGACTGTCAAAAAAAAAAAGG + Intronic
1141130977 16:81436484-81436506 TGAGTTTCTTTAAAAATAAATGG + Intergenic
1142634116 17:1246348-1246370 TGAGACTGTCTCAAAAAAAAAGG + Intergenic
1143720540 17:8806077-8806099 TGTGACCCTCCAAAAATACCTGG + Intronic
1145932342 17:28694989-28695011 TGAGACTGTCTCAAAAAAAAAGG + Intronic
1150139250 17:62714755-62714777 TGAGACTGTCTCAAAAAAAGAGG - Intronic
1151142868 17:72011844-72011866 TAAGGCTCCCTTAAAATAACTGG - Intergenic
1152100111 17:78296393-78296415 TGAGACTGTCTCAAAAAAAGAGG - Intergenic
1152191214 17:78889038-78889060 TGAGACTCTACAAAAATAGGTGG - Intronic
1157159355 18:45299228-45299250 TGGAACTCTCTAAAAAGAAAGGG - Intronic
1158308170 18:56129245-56129267 TGAGACTCTGTCAAAAAAAGAGG - Intergenic
1159433142 18:68382353-68382375 TAAGAATATCTACAAATAACAGG + Intergenic
1162074171 19:8173762-8173784 TGAGACACTCTCAAAAAAAAAGG - Intronic
1162648752 19:12069006-12069028 TGAGATTCTCTCAGAATAAAGGG - Intronic
1163942175 19:20505552-20505574 GGCCACTCTCTAAAAAAAACTGG - Intergenic
1165310214 19:35025269-35025291 CGAGACTGTCTCAAAAAAACTGG - Intronic
1165526690 19:36361752-36361774 TGAGTTTCTCTAAAAATCAAAGG - Intronic
1166057797 19:40303508-40303530 CGAGACTCTCAAAAAAAAAAAGG + Intergenic
1168600694 19:57715965-57715987 TGAATCCCTGTAAAAATAACTGG - Intronic
925428858 2:3773916-3773938 TGAGACTCTCTAAAAATAACTGG - Intronic
925658375 2:6175344-6175366 TGAGACTGTCTCAAAAAAAAAGG + Intergenic
926088084 2:10032593-10032615 TGAGGCTCTCTCAGAATACCTGG + Intergenic
926102868 2:10131725-10131747 TGAGACTGTCTGAAAAAAAAAGG + Intergenic
926359368 2:12071178-12071200 TCAGAATCTCTAAAAATACTGGG - Intergenic
926772213 2:16388467-16388489 TGAGACTCTAAAAAAAAAAGAGG + Intergenic
930650705 2:53961664-53961686 CAAGACTGTCTAAAAATAAGGGG + Intronic
930923567 2:56788468-56788490 TAAGATTCACTAAAAATAATGGG - Intergenic
931701644 2:64914004-64914026 TGGGAAACCCTAAAAATAACTGG - Intergenic
932059851 2:68485300-68485322 TGGGACACTCTAGGAATAACTGG - Intronic
932255426 2:70281929-70281951 TGAGACTGTCTCAAAAAAAAAGG - Intronic
932393465 2:71419046-71419068 TGATACTTTTTAAAAACAACTGG + Intronic
938749598 2:134315900-134315922 TGACACACTATCAAAATAACTGG + Intronic
938908392 2:135861350-135861372 TGTGACTCTCTGAAAAAAAAAGG + Intronic
939952600 2:148493071-148493093 TTAGACTTTCTAAAAATGTCAGG - Intronic
941117490 2:161488572-161488594 TGACACTCTCTCAAAAAAAGGGG - Intronic
943410896 2:187546223-187546245 TAAAACTCTCTAAAAATGAATGG + Intronic
943795066 2:191981998-191982020 TGATACTGTCTGAAAATCACTGG + Intronic
945272895 2:207959604-207959626 TGAGACTCTCCTAAAATATGAGG - Intronic
947925484 2:233918487-233918509 TGAGACCCTCTTAGAATAAGAGG - Intronic
948817082 2:240517247-240517269 TGAGAACCTCTTAGAATAACTGG + Intronic
1169872414 20:10262208-10262230 TTAGAATATATAAAAATAACAGG - Intronic
1170258333 20:14372712-14372734 TGGAACTCTCCAAAAAAAACAGG - Intronic
1170780957 20:19424934-19424956 TCAGACTCTCCATAAAGAACAGG - Intronic
1172828010 20:37806833-37806855 TGAAACTCCCTAACAATATCAGG - Intronic
1178043222 21:28664971-28664993 TAAGCCTCTTTAAAAGTAACTGG - Intergenic
1180202776 21:46235931-46235953 TGATATTTTCTAAAAATGACTGG - Intronic
1181442986 22:22947608-22947630 TGAGAATCTCTCTAAATCACTGG + Intergenic
1181482756 22:23211495-23211517 TGAGACTGTCTCAAAAAAAAGGG - Intronic
953595102 3:44304023-44304045 TGAGACGATTTAAAAAGAACTGG + Exonic
954085831 3:48243059-48243081 TGAGACTCTAAAAAAAAAAAAGG + Intronic
954270870 3:49507675-49507697 TGAGACTGTCTCAAAAGAAAAGG - Intronic
954354529 3:50073859-50073881 TGAGACTGTCTCAAAACAAAAGG - Intronic
954620372 3:51992007-51992029 CGAGACTCTCTCAAAAAAAAAGG + Intergenic
956180172 3:66510204-66510226 TGACAAAATCTAAAAATAACTGG - Intergenic
957877724 3:86171131-86171153 TGAGACTGTCTGAAAAAAAAAGG + Intergenic
958941158 3:100316286-100316308 TGAGATTCTGTAGAAATAATTGG + Intronic
959059463 3:101603073-101603095 TGAGACTGTCTCAAAAAAAAAGG - Intergenic
959297200 3:104551477-104551499 TGAGACTGACTAAAAAAAAAAGG + Intergenic
959597580 3:108144734-108144756 TGAGACTCACAAAGAAAAACAGG - Intergenic
962846942 3:139281460-139281482 TGGTACCCTCTAAAAATAGCAGG + Intronic
966261077 3:177980173-177980195 TGAGATTCAGTAAAAATGACGGG + Intergenic
970796985 4:19924401-19924423 TGAGACTGTCTCAAAAAAAAGGG + Intergenic
971597282 4:28546881-28546903 TGAGAATATCTGAAAATATCTGG - Intergenic
971710360 4:30103537-30103559 TGAAATTCTCTGAAAACAACAGG + Intergenic
974694703 4:65351325-65351347 TCAGAATCTTTAAAAATAAATGG + Intronic
974701778 4:65458998-65459020 TCTTACTCTCAAAAAATAACAGG - Intronic
975230540 4:71927708-71927730 TGAGACTCTTTGAATGTAACAGG + Intergenic
975361920 4:73480398-73480420 TGAGACTGTCTCAAAAAAAAAGG + Intergenic
975429197 4:74268132-74268154 TGAGGATTTCTAGAAATAACAGG + Intronic
975506063 4:75139352-75139374 TGAGATGCTTTAAAAATAAGTGG - Intergenic
976717503 4:88138217-88138239 TGAATTTCTCTTAAAATAACAGG + Intronic
976938474 4:90669467-90669489 AGAGACTCTCTATAAACTACAGG - Intronic
981237066 4:142430833-142430855 TAATACTTTCTAAGAATAACTGG - Intronic
982783623 4:159517237-159517259 TGACACTCTTTAAAAACAAATGG + Intergenic
983618405 4:169733567-169733589 TGAGACTAACGAAAAATATCAGG + Intronic
983815465 4:172121017-172121039 GGAGACTCTCTAAAAGAAAATGG + Intronic
984406188 4:179333697-179333719 TGATTCTACCTAAAAATAACTGG + Intergenic
984637634 4:182129342-182129364 TGTGATACTCTAAAAATACCAGG - Intergenic
985115896 4:186590319-186590341 TGATACTCACTAAAAACAATGGG - Intronic
985279619 4:188272232-188272254 TTAGATTCCCTAATAATAACAGG - Intergenic
987221701 5:15797047-15797069 TCAGACTATCTACAAATAATTGG - Intronic
987515026 5:18894712-18894734 TGAAAATCTGTAATAATAACAGG + Intergenic
988162614 5:27540660-27540682 TGAGACTCTAGAAAAGTAACGGG + Intergenic
992232452 5:74676751-74676773 TGAGATTCTCTCAAAAAAAAGGG + Intronic
993201269 5:84818218-84818240 TGAGACTGTCAAAAAATGAAAGG - Intergenic
994470624 5:100200258-100200280 TTAGACTCTTTAAAATTAATAGG - Intergenic
994629188 5:102261798-102261820 TGAGATTCTATAAAAGAAACAGG + Intronic
995717916 5:115098454-115098476 TGAGAGTTTTCAAAAATAACTGG - Intergenic
995888161 5:116919174-116919196 TTAGACCCTCTAAAAAAAAAAGG - Intergenic
1000218567 5:159188531-159188553 TGAGACTATCCAAAACTAAGGGG - Intronic
1001504340 5:172265236-172265258 AGAGTCTCTCTAAAGATAATAGG + Intronic
1003760145 6:9170801-9170823 TGAGATTATCTAAAAATAACAGG - Intergenic
1004096757 6:12562562-12562584 TGAGACTCCATAAAAAAAAAAGG + Intergenic
1008555250 6:52667075-52667097 TCAGACCCTCTAAAACTTACGGG - Intergenic
1010097347 6:72062475-72062497 TGAGATTCTTTAGAAAAAACGGG - Intronic
1011523734 6:88239926-88239948 TGAGACTGTCTCAAAAAAAAAGG + Intergenic
1013017080 6:106169592-106169614 TGAGAATCTGTAATAAAAACTGG + Intergenic
1015953167 6:138574328-138574350 TGAGAGTCTCAAAATATAAAAGG + Intronic
1016632230 6:146246899-146246921 AGAGACTCCCTTAATATAACTGG - Intronic
1016659656 6:146562999-146563021 TGATGCTTTATAAAAATAACTGG + Intergenic
1019454498 7:1118942-1118964 TGAGACTCTTAAAAAAAAATAGG + Intronic
1020732511 7:11899838-11899860 TGCCACTCTCAGAAAATAACAGG - Intergenic
1021571825 7:22073680-22073702 TGAGATACTCTAAAAGTCACTGG + Intergenic
1022357641 7:29630860-29630882 TGAGACTCTGTCAAAAAAAAAGG + Intergenic
1022941440 7:35244412-35244434 TGAAACTCTCCAAAAAAAAATGG + Intronic
1027379518 7:77591793-77591815 TGACAATCTCTACAAATATCTGG - Intronic
1029550259 7:101233608-101233630 TGAGACTGTCAAAAAAAAAATGG - Intronic
1030968242 7:116020876-116020898 TAAGACTCTCAAACAATAACAGG + Intronic
1031041115 7:116839395-116839417 TGAGACTCTATATAAATTAGCGG + Intronic
1031441470 7:121799950-121799972 TGTCACTCTGTAAAAATAAAGGG - Intergenic
1032809626 7:135398674-135398696 TTAGATTCTCCAAAAATAATGGG + Intronic
1033442389 7:141391781-141391803 TGAGCCACTCACAAAATAACAGG - Intronic
1035199409 7:157251011-157251033 TGGGAATCTCTATGAATAACTGG - Intronic
1036245250 8:7110689-7110711 TGAGACTCTGGAAAAAAAAAAGG + Intergenic
1036615641 8:10385420-10385442 TGAGACTCTGTCAGAATGACGGG + Intronic
1037380487 8:18280342-18280364 TGAGACTCTGCCAATATAACAGG - Intergenic
1039174698 8:34790490-34790512 TGAGACTCTCAAAGAATAGAAGG + Intergenic
1039205585 8:35149948-35149970 TAAGAATCTCTCAAAATAATGGG - Intergenic
1039425698 8:37484008-37484030 TGAGAATTTCTAAATATAAATGG - Intergenic
1041944194 8:63423570-63423592 TATTACTCTCTAAAAATAACTGG + Intergenic
1042145107 8:65720036-65720058 AGAGTCAGTCTAAAAATAACAGG + Intronic
1042151038 8:65784195-65784217 TGAGACTGTCTCAAAAAAAGGGG + Intronic
1042841964 8:73133012-73133034 AGAGAATCTTTAGAAATAACTGG + Intergenic
1044360352 8:91275978-91276000 TAATCCTCTCTGAAAATAACTGG + Intronic
1045971819 8:108086936-108086958 TGTGACTATATAAAAAGAACAGG - Intergenic
1046187695 8:110744785-110744807 TGAGACTGTCTAATAATATAGGG + Intergenic
1046515790 8:115258551-115258573 TGAGAATAGCTGAAAATAACTGG - Intergenic
1048260424 8:132940397-132940419 AGTGACACTCTAAAATTAACAGG + Intronic
1049757934 8:144319032-144319054 TGAGGTTCTCCAGAAATAACCGG + Exonic
1050772535 9:9220518-9220540 TGAAACTTTCTAAAAATAGGTGG + Intronic
1050877145 9:10652360-10652382 TGAAATTCCTTAAAAATAACTGG + Intergenic
1051288546 9:15521749-15521771 TGAGAATATCTAAAAAGAATTGG + Intergenic
1052948040 9:34184322-34184344 CGAGACTATCTAAAAAAAAAAGG - Intronic
1055063183 9:72091933-72091955 TGAGAATCTATGAAAATAAGAGG - Intergenic
1055472463 9:76626686-76626708 GGAGAGTCTCTAAAAGCAACAGG + Intronic
1057068430 9:92075652-92075674 TTAGAGTCTCTCAAAATCACAGG + Intronic
1057364844 9:94410049-94410071 CAATACTCTCTAAAAATAAAAGG - Intronic
1057658486 9:96978044-96978066 CAATACTCTCTAAAAATAAAAGG + Intronic
1060250547 9:121983515-121983537 TGAGACTCTCCAACACTGACAGG + Intronic
1060715694 9:125926506-125926528 TGAAACTGTCTCAAAATAATAGG + Intronic
1061154449 9:128849101-128849123 TGAGACTGTCTCAAAAAAAAAGG + Intronic
1186031236 X:5371452-5371474 CGAGACTCTCTCAAAAAAAATGG + Intergenic
1186144814 X:6614255-6614277 AGTGTCACTCTAAAAATAACAGG - Intergenic
1186977201 X:14920559-14920581 TGAAACTCCATAAAAATGACTGG - Exonic
1188018723 X:25134248-25134270 TGAGACTGTCTCAAAAAAAACGG - Intergenic
1188305163 X:28552846-28552868 TCTAACTCTCTAACAATAACAGG + Intergenic
1188314563 X:28657401-28657423 TGAAATGCTCTTAAAATAACTGG - Intronic
1188544011 X:31282410-31282432 TGAGAATCTTGAAATATAACCGG - Intronic
1191670091 X:63740840-63740862 TGAGGAACTCTAAAAATAGCAGG + Intronic
1191862467 X:65677131-65677153 TGAGAATCTGAAAAAATAAATGG - Intronic
1193112914 X:77747510-77747532 TGAGACTGTCTCAAAAAAAGGGG + Intronic
1193703635 X:84793241-84793263 TTAGACTCTCATAAAATAATAGG + Intergenic
1194193347 X:90863923-90863945 TGAGACTTTGTAAAAAAAAATGG - Intergenic
1194811443 X:98391833-98391855 TTAAAAACTCTAAAAATAACAGG - Intergenic
1196516922 X:116624786-116624808 AGATACTATCAAAAAATAACAGG + Intergenic
1196990457 X:121323228-121323250 TGAGACTGTCTACTTATAACAGG - Intergenic
1197088328 X:122506582-122506604 TGAGGTGCTCTAAAAATAAGAGG + Intergenic
1200164706 X:154027948-154027970 TGAGACTCTACAAACAGAACGGG + Intronic
1200931272 Y:8699203-8699225 AGAGACTCTCTGAAAAAAGCAGG + Intergenic