ID: 925429371

View in Genome Browser
Species Human (GRCh38)
Location 2:3778022-3778044
Sequence CTCAGGTAACCTACTGATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 127}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925429371_925429379 12 Left 925429371 2:3778022-3778044 CCTCCATCAGTAGGTTACCTGAG 0: 1
1: 0
2: 1
3: 11
4: 127
Right 925429379 2:3778057-3778079 CGGGACACCCCCTGGCCAGCTGG 0: 1
1: 0
2: 1
3: 10
4: 156
925429371_925429378 4 Left 925429371 2:3778022-3778044 CCTCCATCAGTAGGTTACCTGAG 0: 1
1: 0
2: 1
3: 11
4: 127
Right 925429378 2:3778049-3778071 TGTGTGGACGGGACACCCCCTGG 0: 1
1: 0
2: 1
3: 12
4: 96
925429371_925429375 -8 Left 925429371 2:3778022-3778044 CCTCCATCAGTAGGTTACCTGAG 0: 1
1: 0
2: 1
3: 11
4: 127
Right 925429375 2:3778037-3778059 TACCTGAGTGGCTGTGTGGACGG 0: 1
1: 1
2: 4
3: 24
4: 363
925429371_925429376 -7 Left 925429371 2:3778022-3778044 CCTCCATCAGTAGGTTACCTGAG 0: 1
1: 0
2: 1
3: 11
4: 127
Right 925429376 2:3778038-3778060 ACCTGAGTGGCTGTGTGGACGGG 0: 1
1: 2
2: 1
3: 28
4: 435

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925429371 Original CRISPR CTCAGGTAACCTACTGATGG AGG (reversed) Intronic
904456051 1:30648849-30648871 CTCAGGGAACTTACTAAAGGCGG - Intergenic
906202903 1:43971449-43971471 CTCAGGGAACCCACTGGTTGGGG - Exonic
906706810 1:47900989-47901011 CACAACTAACCTAATGATGGAGG - Intronic
906871575 1:49487608-49487630 CTCAGGAAACATAATCATGGTGG - Intronic
908346009 1:63233831-63233853 CTCAGGAAACATAATCATGGAGG + Intergenic
909798459 1:79774603-79774625 CTCAGGAAACATAATCATGGTGG + Intergenic
910265693 1:85334651-85334673 CTCAGGAAACCTAATCATGGTGG - Intronic
911350922 1:96754052-96754074 CTCAGGTAAACTCCTCATGTAGG + Intronic
912112876 1:106364524-106364546 CTCAGGAAACTTAGTCATGGTGG - Intergenic
913564913 1:120063449-120063471 CTCAGGTAACATTCTAATGGAGG + Intronic
913633217 1:120730114-120730136 CTCAGGTAACATTCTAATGGAGG - Intergenic
914285499 1:146222799-146222821 CTCAGGTAACATTCTAATGGAGG + Intronic
914546530 1:148673554-148673576 CTCAGGTAACATTCTAATGGAGG + Intronic
914620035 1:149397116-149397138 CTCAGGTAACATTCTAATGGAGG - Intergenic
918752582 1:188290884-188290906 CACAGGAAACCTAATCATGGTGG + Intergenic
920089518 1:203442267-203442289 CTCAGGTAAGCTGCTGACAGAGG - Intergenic
1066475393 10:35741904-35741926 ACCAGTTAACCTACTGATGCAGG + Intergenic
1066651223 10:37656872-37656894 ATCAGGTAACCTATTGTTGCAGG - Intergenic
1068823693 10:61409335-61409357 CTCAGGGAACATGGTGATGGAGG - Exonic
1073468178 10:103706554-103706576 CTCAGGGAGCCTACTGTTGAGGG - Intronic
1087185864 11:95194272-95194294 CTCAGGTTACCTAGTAATGGGGG - Intronic
1091020115 11:132091812-132091834 CTCAGGAAACTTACTGATAATGG - Intronic
1092495260 12:8986959-8986981 CTCAGGAAACTTAGTCATGGTGG - Intronic
1092702820 12:11251552-11251574 CATAGGTAAACTTCTGATGGGGG - Intergenic
1093570855 12:20664133-20664155 CTCAGGAAACATAATCATGGTGG - Intronic
1095109747 12:38279935-38279957 CTCAGGAAACTTAGTCATGGTGG - Intergenic
1098039499 12:66339807-66339829 ATCAGGTTACCTAGGGATGGGGG - Exonic
1098806708 12:75029289-75029311 ATCAAGTAACCTACTTTTGGGGG - Intergenic
1100718897 12:97335301-97335323 CTCAGGTAACCTACCGAATTAGG + Intergenic
1101492697 12:105223919-105223941 CTCAGGCAATCAACTGATGATGG + Intronic
1102600162 12:114023593-114023615 CTCAGGAAACTTAGTCATGGCGG - Intergenic
1103031832 12:117621246-117621268 CTCAGGAAACTTAGTTATGGTGG - Intronic
1103927829 12:124433535-124433557 CTCAGGGACACTACTGCTGGAGG - Intronic
1104461918 12:128963145-128963167 CTCAGGTAACCCACTGTCGTTGG - Intronic
1104523908 12:129500251-129500273 CGGAGGTAACTGACTGATGGGGG - Intronic
1107528473 13:41257838-41257860 CTCAGGTAACCTTATGAGGTAGG - Intronic
1109914046 13:68956164-68956186 CTCAAGTAATCTGCTGATGTTGG + Intergenic
1113013102 13:105793419-105793441 CTCAGGAAACATATTCATGGCGG + Intergenic
1116712917 14:48391935-48391957 CTCAGGAAACTTAGTCATGGCGG + Intergenic
1116713219 14:48396312-48396334 CTCAGGAAACTTAATCATGGTGG - Intergenic
1119511563 14:75215570-75215592 CACAGGTAACCTGGTGGTGGTGG + Intergenic
1121563404 14:94891312-94891334 CTCAGGTAACCTGATGTTGACGG - Intergenic
1121689510 14:95866179-95866201 CTCATGTAACCTAATGACAGAGG - Intergenic
1121906439 14:97750474-97750496 CCCAGGTTATGTACTGATGGGGG + Exonic
1127703976 15:61529099-61529121 CTCTGGAAACCTACTCAAGGCGG + Intergenic
1129554676 15:76494940-76494962 CTCAGCTAAACTGATGATGGAGG + Intronic
1129555050 15:76499245-76499267 CTCAGCTAAACTGATGATGGAGG + Intronic
1130467140 15:84198111-84198133 CTCACGCAGCCTCCTGATGGGGG - Intergenic
1130497124 15:84475425-84475447 CTCACGCAGCCTCCTGATGGGGG + Intergenic
1131056117 15:89376116-89376138 CTCAGGCAGCCTACAGGTGGGGG + Intergenic
1133697641 16:8280140-8280162 ATAAGGTAACCTAATCATGGAGG - Intergenic
1135759047 16:25121612-25121634 CTCAGGAAACTTAGTCATGGCGG + Intronic
1149138865 17:53404985-53405007 CTCAGGAAACTTACACATGGTGG - Intergenic
1150335714 17:64329254-64329276 CTCAGTTCACCTTCTGATGAGGG - Intronic
1153525063 18:5987016-5987038 CTCAGCCATCCCACTGATGGTGG - Intronic
1161340305 19:3738278-3738300 CTCAGATAACCAAATCATGGTGG - Intronic
1162308695 19:9891651-9891673 CTCAGGGACCCCAGTGATGGAGG - Intronic
1164898497 19:31898103-31898125 CTCAGGAAACATAATCATGGTGG + Intergenic
925246739 2:2390215-2390237 CTCAGGAAACACAGTGATGGTGG + Intergenic
925429371 2:3778022-3778044 CTCAGGTAACCTACTGATGGAGG - Intronic
925429398 2:3778146-3778168 CTCAGGAAACCCACTGATGGAGG - Intronic
925487582 2:4353085-4353107 CACAGCTAGCCGACTGATGGAGG - Intergenic
926161235 2:10491083-10491105 CTCAGGTAACCCACTGCTCCTGG - Intergenic
928879654 2:36083799-36083821 CTCATGTAACCAACTGTTTGGGG + Intergenic
932747442 2:74345472-74345494 CTCAGGAATCCTCCTAATGGAGG + Intronic
933596522 2:84288667-84288689 CTCAGGCAACATCCTGAGGGTGG - Intergenic
937116243 2:119406967-119406989 CTCAGTTTACCCAGTGATGGGGG - Intergenic
940724361 2:157319053-157319075 CTCAGGTAACATAATGGTGATGG - Exonic
941723406 2:168836338-168836360 CCCAGGGAAGCTGCTGATGGGGG - Intronic
946151281 2:217773152-217773174 CTCAGGAAACTTACAAATGGTGG - Intergenic
946867358 2:224054176-224054198 CTCAGGCAACATACTAAGGGTGG + Intergenic
1169755490 20:9038979-9039001 CTCAGCTAACCTACAGTTGACGG + Intergenic
1173382236 20:42556218-42556240 CTCAAGTAACTTAAGGATGGAGG - Intronic
1174729373 20:52900375-52900397 CTCAGGGAACTTACAGATGAGGG + Intergenic
1176344266 21:5727444-5727466 GTCAGGTTACCTACAAATGGAGG - Intergenic
1176351080 21:5848028-5848050 GTCAGGTTACCTACAAATGGAGG - Intergenic
1176500561 21:7597012-7597034 GTCAGGTTACCTACAAATGGAGG + Intergenic
1176538587 21:8125513-8125535 GTCAGGTTACCTACAAATGGAGG - Intergenic
1177679758 21:24351529-24351551 CTCAGGAAACATAATCATGGTGG + Intergenic
1177820387 21:26024582-26024604 CTCAGCAAAACTACTTATGGCGG - Intronic
1179230400 21:39498950-39498972 CTCAGGAAACTTAGTCATGGTGG + Intronic
1181787249 22:25236132-25236154 CTCAGTTTCCCTACTGAGGGAGG - Intergenic
1182624182 22:31634027-31634049 CTCAGGCCACCTGCAGATGGAGG + Intronic
1183168006 22:36161995-36162017 CTCAGGAAACCTTCTGGCGGCGG + Intronic
1203243533 22_KI270733v1_random:41868-41890 GTCAGGTTACCTACAAATGGAGG - Intergenic
949521224 3:4855857-4855879 CTCAGGAAACTTAGTCATGGCGG - Intronic
956480815 3:69672296-69672318 CCCATGCAAGCTACTGATGGTGG + Intergenic
956692412 3:71890342-71890364 CCCAGGGAGCCTACTTATGGGGG + Intergenic
960384966 3:117011865-117011887 CTCAGGGAACTCACTGAGGGAGG + Intronic
966217533 3:177518878-177518900 CTCAGGAAACATAATCATGGTGG + Intergenic
967231100 3:187338189-187338211 CCCATGTAATCTACTCATGGGGG + Intergenic
968524445 4:1048857-1048879 CTCAGGAAACTTAGTCATGGTGG + Intergenic
970403274 4:15738094-15738116 CTCAGGTAAACTACAGAGGCTGG + Intronic
972517300 4:39820323-39820345 CTCAGGAAACTTAATCATGGTGG + Intergenic
973845710 4:54910951-54910973 CTCAGGCTACCAACTGATGGGGG + Intergenic
974850797 4:67403223-67403245 CTCAGGAAAGCTGCTCATGGTGG + Intergenic
975520077 4:75291058-75291080 CTCAAGTAAAATATTGATGGTGG - Intergenic
976656474 4:87493817-87493839 CTCATGGAACCTACTGATGATGG - Exonic
978255948 4:106693093-106693115 CTAAGGTAAAATAGTGATGGTGG - Intergenic
982074902 4:151729479-151729501 CTCAGGAAAGCTACTGTTGATGG - Intronic
983313563 4:166097383-166097405 CTCACACAACCTACTGATAGAGG - Intronic
984306939 4:178005491-178005513 CTCAGGAAACATAATCATGGTGG + Intergenic
986946156 5:13023970-13023992 CTCAGGTAAAGTAATGATGAAGG - Intergenic
987003928 5:13689568-13689590 CTCAGGAAACGTAATCATGGTGG - Intergenic
989254548 5:39352054-39352076 CTCAGGAAACCCAATCATGGTGG + Intronic
992208001 5:74449606-74449628 GTTAGGTAACCTGCTGAAGGAGG + Intergenic
995895672 5:117007599-117007621 CTCAGGAAACTTACACATGGTGG + Intergenic
999756562 5:154668990-154669012 CTGAGGTAACCTACTGTAGTAGG - Intergenic
1005927172 6:30453327-30453349 CTCCGGTAACCGACGGATTGGGG + Intergenic
1009707884 6:67278163-67278185 CTCAGGAATCCTAGTTATGGCGG + Intergenic
1011981560 6:93385853-93385875 CTCAGGAAACATAATCATGGTGG + Intronic
1018589435 6:165402473-165402495 CTCATGCAAACTACTGATGAAGG + Intronic
1023606347 7:41934717-41934739 CTCTTGTAACCTACTGACAGAGG + Intergenic
1024122950 7:46263546-46263568 CTCATGTCACCCACTGATGGAGG + Intergenic
1028393220 7:90338414-90338436 CTCAGGAAACTTAATCATGGTGG - Intronic
1032068934 7:128791967-128791989 CTGAGGTGGCCTACAGATGGAGG - Intronic
1032366630 7:131306140-131306162 CTCAGGAAACGTAATCATGGTGG - Intronic
1035634562 8:1134719-1134741 CTCAGGAAACTTATTCATGGTGG + Intergenic
1036726727 8:11227272-11227294 CTCAGGTATCCAGGTGATGGAGG + Intergenic
1037384374 8:18322021-18322043 CTCAGGAAACTTACAAATGGCGG + Intergenic
1040996598 8:53408719-53408741 CTCAGGAAACCCACAGATGCAGG + Intergenic
1041265607 8:56061239-56061261 CTCAGGAAACTTAATCATGGCGG - Intergenic
1043102330 8:76061240-76061262 CTCAGGAAACATAATCATGGTGG - Intergenic
1046332725 8:112741716-112741738 CTCAAATAACCTTTTGATGGGGG - Intronic
1047151369 8:122267269-122267291 CTCAGGAAACATAATCATGGCGG + Intergenic
1047872757 8:129103395-129103417 CTTATCTAACCTCCTGATGGAGG + Intergenic
1055926895 9:81519612-81519634 CTCAGGAAACTTAGTGATGGTGG + Intergenic
1057075280 9:92135272-92135294 CTCAGGAAGCATCCTGATGGGGG + Intergenic
1057678529 9:97154473-97154495 CTCAGCTTCCCTACAGATGGAGG + Intergenic
1059516767 9:114903143-114903165 CTCATGTAACCTAGAGAAGGAGG + Exonic
1060039034 9:120283892-120283914 CTCAGCTGCCCTTCTGATGGAGG + Intergenic
1060767755 9:126307822-126307844 CTGAGGGAATCTGCTGATGGGGG + Intergenic
1061716440 9:132521285-132521307 CTTGGGGAACCTAGTGATGGGGG - Intronic
1203459861 Un_GL000220v1:24951-24973 GTCAGGTTACCTACAAATGGAGG - Intergenic
1185435969 X:95324-95346 CTCAGACAACCTCCTGATAGTGG - Intergenic
1185444289 X:249698-249720 CTCAGACAACCTCCTGATAGTGG + Intergenic
1188382449 X:29512204-29512226 AACAGGTAACCAACTGATTGTGG + Intronic
1188558140 X:31435154-31435176 CTCACGTAACCCAGTGAGGGAGG - Intronic
1197146206 X:123175465-123175487 CTGGGGTAACCCACTGAGGGAGG + Intergenic
1198999964 X:142624121-142624143 CTCAGGGAACTTACTCGTGGCGG + Intergenic