ID: 925429398

View in Genome Browser
Species Human (GRCh38)
Location 2:3778146-3778168
Sequence CTCAGGAAACCCACTGATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 0, 2: 4, 3: 53, 4: 260}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925429398_925429402 -8 Left 925429398 2:3778146-3778168 CCTCCATCAGTGGGTTTCCTGAG 0: 1
1: 0
2: 4
3: 53
4: 260
Right 925429402 2:3778161-3778183 TTCCTGAGTGGCTGTGTGGACGG 0: 1
1: 1
2: 3
3: 43
4: 407
925429398_925429405 4 Left 925429398 2:3778146-3778168 CCTCCATCAGTGGGTTTCCTGAG 0: 1
1: 0
2: 4
3: 53
4: 260
Right 925429405 2:3778173-3778195 TGTGTGGACGGGACTCCTCCCGG 0: 1
1: 0
2: 2
3: 9
4: 125
925429398_925429403 -7 Left 925429398 2:3778146-3778168 CCTCCATCAGTGGGTTTCCTGAG 0: 1
1: 0
2: 4
3: 53
4: 260
Right 925429403 2:3778162-3778184 TCCTGAGTGGCTGTGTGGACGGG 0: 1
1: 1
2: 7
3: 151
4: 5453

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925429398 Original CRISPR CTCAGGAAACCCACTGATGG AGG (reversed) Intronic
901200879 1:7466828-7466850 CTCAAGGCACCCAGTGATGGGGG - Intronic
902109523 1:14066641-14066663 CTCTGGAAACCAACAGAGGGCGG - Intergenic
903299125 1:22365548-22365570 TTCAGGACACTCACTGCTGGTGG + Intergenic
903318358 1:22526466-22526488 CTCAGGACAGCCAGGGATGGAGG - Exonic
903586919 1:24423069-24423091 GTCAGAAAACACATTGATGGTGG + Intronic
906187928 1:43875682-43875704 CTCAGGAAACACAATCATGGCGG - Intronic
906202903 1:43971449-43971471 CTCAGGGAACCCACTGGTTGGGG - Exonic
906251694 1:44315390-44315412 CCCAGGAAAATCACTGATGTGGG + Intronic
906768301 1:48457196-48457218 CTCAGGAGATCCACTCATGTGGG - Intronic
906871575 1:49487608-49487630 CTCAGGAAACATAATCATGGTGG - Intronic
908346009 1:63233831-63233853 CTCAGGAAACATAATCATGGAGG + Intergenic
909259799 1:73472880-73472902 CTCAGAAAACACAATCATGGCGG + Intergenic
909458930 1:75885411-75885433 CTCAGGATACCAACTGAGGTGGG - Intronic
909798459 1:79774603-79774625 CTCAGGAAACATAATCATGGTGG + Intergenic
910265693 1:85334651-85334673 CTCAGGAAACCTAATCATGGTGG - Intronic
910721168 1:90287662-90287684 CTCAGGGAAGCCAATGATGTTGG - Intergenic
911104822 1:94121353-94121375 CTCAGGAACCCCTCTCATGGAGG - Intergenic
911587748 1:99710476-99710498 CTGAGGAAACCCTGAGATGGAGG - Intronic
911735373 1:101331172-101331194 CTCAGGAAACTCAATCATGGTGG + Intergenic
912112876 1:106364524-106364546 CTCAGGAAACTTAGTCATGGTGG - Intergenic
913452608 1:119002161-119002183 CTCAGGAAACACCCGGATGTGGG + Intergenic
913584447 1:120260076-120260098 CTCAGAGAATCCACTGATGAAGG + Intergenic
913623734 1:120638262-120638284 CTCAGAGAATCCACTGATGAAGG - Intergenic
914566444 1:148871953-148871975 CTCAGAGAATCCACTGATGAAGG + Intronic
914606375 1:149258287-149258309 CTCAGAGAATCCACTGATGAAGG - Intergenic
915886518 1:159728185-159728207 CTCAGGAAACACAATCAAGGTGG + Intergenic
916233700 1:162564215-162564237 CTCAGGGAACACACAGATGTAGG + Intronic
917585766 1:176425370-176425392 CTGAGAATACCCACTGATAGTGG - Intergenic
918074742 1:181161483-181161505 CCCAGGAAAAACAGTGATGGGGG + Intergenic
918752582 1:188290884-188290906 CACAGGAAACCTAATCATGGTGG + Intergenic
921508874 1:216007677-216007699 CTGAGGATACCCACTGAATGTGG + Intronic
921880651 1:220250867-220250889 CTCAGGAAACACAGTGGTGGAGG - Intronic
922174001 1:223180751-223180773 CTCAGGAAACAAACTCATGCAGG - Intergenic
923179026 1:231498414-231498436 ATCAGGAAACACAATCATGGTGG + Intergenic
923410004 1:233698715-233698737 CTCAGGAAACACAATCATGGTGG + Intergenic
1063129836 10:3168712-3168734 CTCAGGAAACACAATCGTGGTGG - Intronic
1064627955 10:17280880-17280902 CTCAGGAAACACAATCATGGTGG + Intergenic
1066648309 10:37633345-37633367 GTCAGGAAAGCCAGTGCTGGTGG + Intergenic
1071197492 10:83178025-83178047 CTCAGGAAACACAATCATGGAGG + Intergenic
1072047968 10:91675953-91675975 CTCAGGGAACCCACTGTTTTTGG - Intergenic
1072398611 10:95072110-95072132 CTAATGAACCCCACTGATGGGGG - Intergenic
1072641825 10:97216730-97216752 CTCAGGAAACACAATTATGGTGG - Intronic
1074325064 10:112442616-112442638 GTCAGGAGACCCACTGAAAGAGG + Intronic
1074765788 10:116699120-116699142 CTCAGGATCCCCCCTGATGGAGG + Intronic
1074961478 10:118449676-118449698 GTCAGGAAACCCGCTGCTGCAGG - Intergenic
1075234506 10:120714655-120714677 CTCATGAAACCCAAAGACGGAGG - Intergenic
1076449065 10:130543787-130543809 TTCAGGAAACCCACTGCTTCAGG + Intergenic
1076449068 10:130543804-130543826 TTCAGGAAACCCACTGCTTCAGG + Intergenic
1076449071 10:130543821-130543843 TTCAGGAAACCCACTGCTTCAGG + Intergenic
1077992975 11:7428570-7428592 CTCAGGAAGCCCACTGCTCCTGG + Intronic
1079742835 11:24085451-24085473 CTCAGAAAGCCCACAGATAGTGG - Intergenic
1079797006 11:24816743-24816765 CTCATGACAGCCACTGAGGGAGG + Intronic
1081753426 11:45528128-45528150 CTCAGGAAATTCACTGCTGCAGG - Intergenic
1083439126 11:62664616-62664638 CTCAGGAAAGCCGGGGATGGTGG - Intronic
1087046181 11:93845688-93845710 CTCAGAGACCCCACTGATGCTGG - Intronic
1087077278 11:94136932-94136954 CTCGGGAAACACAGTCATGGCGG + Intronic
1088818842 11:113440103-113440125 CTCAGGAGAGGCACTCATGGAGG - Intronic
1090794717 11:130124918-130124940 CTGAGGAATCCCACTGAGTGTGG + Intronic
1090880494 11:130828106-130828128 CTCTGGAAACCCAAGGCTGGAGG + Intergenic
1091020115 11:132091812-132091834 CTCAGGAAACTTACTGATAATGG - Intronic
1092495260 12:8986959-8986981 CTCAGGAAACTTAGTCATGGTGG - Intronic
1093570855 12:20664133-20664155 CTCAGGAAACATAATCATGGTGG - Intronic
1095109747 12:38279935-38279957 CTCAGGAAACTTAGTCATGGTGG - Intergenic
1097716159 12:62968772-62968794 CTCAGGAAAGCCATTTTTGGGGG + Intergenic
1099076436 12:78114458-78114480 CTCAGGAAACAGAATCATGGTGG + Intronic
1100216774 12:92458528-92458550 ATCAGGAAACACAATCATGGTGG + Intergenic
1100353588 12:93808074-93808096 CCCAGGACACCCACTGAATGGGG - Intronic
1101492697 12:105223919-105223941 CTCAGGCAATCAACTGATGATGG + Intronic
1102600162 12:114023593-114023615 CTCAGGAAACTTAGTCATGGCGG - Intergenic
1102898386 12:116616863-116616885 CTCAGGCAGCCCACTGAATGAGG - Intergenic
1103031832 12:117621246-117621268 CTCAGGAAACTTAGTTATGGTGG - Intronic
1104461918 12:128963145-128963167 CTCAGGTAACCCACTGTCGTTGG - Intronic
1106373323 13:29158801-29158823 CTCAGGGAACCCACTGTTCAAGG + Intronic
1107672167 13:42757420-42757442 CTCAGGAAACAGAATCATGGTGG + Intergenic
1107860898 13:44660174-44660196 CTCAGGAACCCCAATGAGGAAGG - Intergenic
1109804839 13:67425644-67425666 CTCAGGAAACACAATCATGGTGG + Intergenic
1110155788 13:72314406-72314428 CTCAGGAAAGCCACCCAGGGTGG - Intergenic
1110624574 13:77638453-77638475 CTCAGGAAATGCACTGATGTTGG - Intronic
1110827233 13:79986859-79986881 CTAAGGGAACCCAGTCATGGAGG - Intergenic
1113013102 13:105793419-105793441 CTCAGGAAACATATTCATGGCGG + Intergenic
1113038138 13:106073876-106073898 CTAAGGAAACCAACTGATATTGG + Intergenic
1113543984 13:111131980-111132002 CTGTGGAAACCCACCCATGGAGG + Intronic
1114222344 14:20708118-20708140 CTCAGAAAAATCACTGAGGGGGG - Intergenic
1114780576 14:25534008-25534030 CTCAGGAAACACAATCATGGTGG + Intergenic
1114988836 14:28263029-28263051 CTGAGCATACCCACTGATAGTGG + Intergenic
1115505140 14:34086616-34086638 CTCAGGAAACACAATCATGGAGG + Intronic
1116712917 14:48391935-48391957 CTCAGGAAACTTAGTCATGGCGG + Intergenic
1116713219 14:48396312-48396334 CTCAGGAAACTTAATCATGGTGG - Intergenic
1118369508 14:65125487-65125509 CTCAGGAAACACAATCATAGTGG + Intergenic
1120406944 14:84102344-84102366 CTCAGGAAACAGAATTATGGTGG - Intergenic
1120771260 14:88382967-88382989 CTCAGGAAACACTATCATGGTGG - Intergenic
1121086097 14:91147101-91147123 CTCAGGAAACTCACTTAAGGGGG + Intronic
1122808819 14:104277595-104277617 CTCAGGAAACCCACTCGTCCTGG + Intergenic
1123411200 15:20061270-20061292 CTCAGGAAACTCAGTCACGGTGG - Intergenic
1123520546 15:21068381-21068403 CTCAGGAAACTCAGTCACGGTGG - Intergenic
1124099889 15:26683361-26683383 ACCAGGAAACCCAGCGATGGGGG - Intronic
1124119111 15:26873784-26873806 CTCAGAAAGCCCACTGAAGCAGG + Intronic
1126696246 15:51328512-51328534 CTCAGGATTCCCAGTGAGGGTGG - Intronic
1127073664 15:55306352-55306374 CTCATGAAACCCAGTGAGGGTGG + Intronic
1127703976 15:61529099-61529121 CTCTGGAAACCTACTCAAGGCGG + Intergenic
1127744006 15:61945138-61945160 CTCAGGAAACTGAATCATGGTGG - Intronic
1127930765 15:63595885-63595907 CTCAGGAAAGCCACTGACAATGG + Intergenic
1128330438 15:66752093-66752115 CTCAGGGAAACCATTGAGGGAGG + Intronic
1130263343 15:82376843-82376865 CTCAGAAAACCACCTGTTGGAGG - Intergenic
1130277962 15:82492823-82492845 CTCAGAAAACCACCTGTTGGAGG + Intergenic
1130470291 15:84220008-84220030 CTCAGAAAACCACCTGTTGGAGG + Intergenic
1130477779 15:84334575-84334597 CTCAGAAAACCACCTGTTGGAGG + Intergenic
1130493986 15:84453555-84453577 CTCAGAAAACCACCTGTTGGAGG - Intergenic
1130592580 15:85224636-85224658 CTCAGAAAACCACCTGTTGGAGG + Intergenic
1131105766 15:89733195-89733217 CTCAACAAGCACACTGATGGTGG - Exonic
1131458310 15:92600413-92600435 CTCAGGAAACAGGCTGATAGTGG - Intergenic
1133277037 16:4645272-4645294 CTCAGGACACTCACTGAGGCAGG - Intronic
1134914681 16:18059882-18059904 CTCAGGAAACACCCAGATAGGGG - Intergenic
1135759047 16:25121612-25121634 CTCAGGAAACTTAGTCATGGCGG + Intronic
1138419337 16:56889084-56889106 CACAGAAAAGCCACTGAGGGAGG - Intronic
1140072211 16:71660926-71660948 CTCAGGAAATGAACTGATAGTGG + Intronic
1141830415 16:86507276-86507298 CTCAGGAAGGCCAAAGATGGAGG - Intergenic
1143854179 17:9836307-9836329 CACAGGGATGCCACTGATGGAGG - Intronic
1146624347 17:34424450-34424472 CTCAGGAAACACTGTTATGGGGG - Intergenic
1146762703 17:35492363-35492385 CCCAGGAAGCCCAAGGATGGAGG - Intronic
1147627835 17:41911184-41911206 CTGAGGAAGCCCAATGAGGGAGG + Intronic
1147670025 17:42171517-42171539 CGCAGGAAACACTCTGAGGGTGG - Intronic
1149138865 17:53404985-53405007 CTCAGGAAACTTACACATGGTGG - Intergenic
1151444330 17:74153356-74153378 CACAGGAAACCCACTGAGCGTGG + Intergenic
1153525063 18:5987016-5987038 CTCAGCCATCCCACTGATGGTGG - Intronic
1153680318 18:7494366-7494388 ATCAGGAAAACAACTGATGCGGG - Intergenic
1154474149 18:14736802-14736824 CTCAGGAAAGGCTCTGATAGAGG + Intronic
1155100466 18:22605536-22605558 CTCACAAATCCCAATGATGGAGG + Intergenic
1155365055 18:25041571-25041593 CTCAGAAAACACACTGCTGCAGG - Intergenic
1156542460 18:37928504-37928526 CTGAGCAATCCCACTGATGCTGG + Intergenic
1156852686 18:41746319-41746341 ATCTGGAAACCCACTGATTTAGG - Intergenic
1158055635 18:53276894-53276916 CACAGGGTACCCATTGATGGTGG + Intronic
1162308695 19:9891651-9891673 CTCAGGGACCCCAGTGATGGAGG - Intronic
1163438683 19:17310531-17310553 CTCAGGATGCCAACTAATGGGGG - Intronic
1164484136 19:28640397-28640419 CTCAGTAAATGCACTGAGGGTGG - Intergenic
1164898497 19:31898103-31898125 CTCAGGAAACATAATCATGGTGG + Intergenic
1165716305 19:38047978-38048000 CTCAGGAAACCCTCTGCAGTGGG - Intronic
1166219336 19:41354644-41354666 CCCCGGACACCCAGTGATGGGGG - Exonic
1167145397 19:47678554-47678576 CTCAGGAAAGCCGCTGGTGGTGG - Intronic
1168085451 19:54042406-54042428 CTCCTGAAATCCACTGATAGGGG + Intronic
1168209792 19:54882066-54882088 CTCAGCACACTCACTGGTGGTGG - Intronic
1168562434 19:57395495-57395517 CTCAGGAAACACAATCCTGGCGG + Intronic
925140020 2:1543888-1543910 CTCTGGAAACACAGTCATGGTGG + Intergenic
925246739 2:2390215-2390237 CTCAGGAAACACAGTGATGGTGG + Intergenic
925429371 2:3778022-3778044 CTCAGGTAACCTACTGATGGAGG - Intronic
925429398 2:3778146-3778168 CTCAGGAAACCCACTGATGGAGG - Intronic
925585040 2:5456837-5456859 TTCCGGAAACACACTGCTGGAGG + Intergenic
926161235 2:10491083-10491105 CTCAGGTAACCCACTGCTCCTGG - Intergenic
926336211 2:11864698-11864720 ATCAGTAAGGCCACTGATGGAGG - Intergenic
926843951 2:17113112-17113134 CTCTGGAGTCCCAGTGATGGTGG - Intergenic
927098777 2:19770638-19770660 CTCAGGAAACACAATCATGGTGG + Intergenic
928496233 2:31835033-31835055 CTCAGGAAACTAACAGATGCTGG - Intergenic
928899390 2:36301180-36301202 CTCAGGAAACACAATCATGGTGG + Intergenic
929351216 2:40957730-40957752 CTCAGGAAACTGAATCATGGAGG + Intergenic
929505517 2:42525110-42525132 CTCAAGAGACCCACAGGTGGGGG - Intronic
929576941 2:43057887-43057909 CTCAGGAATCCCATTTCTGGAGG - Intergenic
932747442 2:74345472-74345494 CTCAGGAATCCTCCTAATGGAGG + Intronic
933455880 2:82518453-82518475 CTCAGGAAACTAACTTATAGAGG + Intergenic
933689736 2:85170712-85170734 CCCAGGAAACCCACTCAGAGTGG + Intronic
933864279 2:86501606-86501628 CTCAGGAAACACAGTCGTGGCGG + Intergenic
933949619 2:87317370-87317392 CTCAGGAAACACAATTATGGTGG + Intergenic
934861472 2:97766990-97767012 TTCAGGAATCCCACTGGTGGTGG - Intronic
935524473 2:104148490-104148512 CTCAGGAAACCCACTAGAGATGG - Intergenic
935868689 2:107420903-107420925 CTCAGGAAACACAATCATGATGG + Intergenic
936330574 2:111544227-111544249 CTCAGGAAACACAATTATGGTGG - Intergenic
937116243 2:119406967-119406989 CTCAGTTTACCCAGTGATGGGGG - Intergenic
938055327 2:128209904-128209926 CTCAGCAAACCCAGTCATGCTGG - Intergenic
938657802 2:133452405-133452427 AGAAGGAAATCCACTGATGGAGG + Intronic
940252654 2:151696597-151696619 CTCAGGACACCCAATTATGAGGG - Intronic
940706264 2:157108319-157108341 ATCAGCAATCCCTCTGATGGGGG - Intergenic
944677044 2:202042323-202042345 CTCAAGAAACCATCTGTTGGAGG - Intergenic
946151281 2:217773152-217773174 CTCAGGAAACTTACAAATGGTGG - Intergenic
947995396 2:234523116-234523138 CTCAGGAAACACAATAATGGCGG - Intergenic
948209700 2:236183706-236183728 CTCAGGAAGCTCAATCATGGTGG - Intergenic
1168860140 20:1040145-1040167 CTCAGGAACCCCACAGATTCTGG - Intergenic
1173943649 20:46932987-46933009 CTCAGGAAACACAATCATGTTGG - Intronic
1174410953 20:50335165-50335187 CTCAGGAATCTGACAGATGGGGG + Intergenic
1174541461 20:51292987-51293009 CTCAGGAAACACAATCATGGCGG + Intergenic
1174825729 20:53766730-53766752 CTAAGTAAACCCAATGATGCTGG + Intergenic
1177679758 21:24351529-24351551 CTCAGGAAACATAATCATGGTGG + Intergenic
1177820387 21:26024582-26024604 CTCAGCAAAACTACTTATGGCGG - Intronic
1178806694 21:35845426-35845448 CTCAGGAAACCCACAACTGAGGG + Intronic
1178912217 21:36684295-36684317 TTCAGGAAATCCAGGGATGGAGG - Intergenic
1179230400 21:39498950-39498972 CTCAGGAAACTTAGTCATGGTGG + Intronic
1181074249 22:20364457-20364479 CTCAGGAAAGCCCCTCCTGGAGG - Intronic
1181129477 22:20722090-20722112 CTCAGGAAACAGAATCATGGTGG - Intronic
1182010273 22:26994987-26995009 CTCTGGGAATCCACTCATGGGGG + Intergenic
1182232138 22:28846391-28846413 CTCAGGAAAGCCAGGGAAGGTGG + Intergenic
1183168006 22:36161995-36162017 CTCAGGAAACCTTCTGGCGGCGG + Intronic
1183598034 22:38823868-38823890 CTCTGGAAAGCCACTGCTGATGG + Intronic
1184609097 22:45590987-45591009 CTCAGGAGACACACGGAGGGAGG + Intronic
1184674441 22:46032792-46032814 AGCAGGAACCCCACTGTTGGGGG - Intergenic
1184956412 22:47889772-47889794 CTCAGGAAACACAATTATGGTGG - Intergenic
1185058767 22:48594652-48594674 CTCTGGACACCCACAGATGAGGG - Intronic
1185226677 22:49657442-49657464 CTCAGGAAACACAATCATGGCGG + Intronic
949521224 3:4855857-4855879 CTCAGGAAACTTAGTCATGGCGG - Intronic
951034849 3:17921632-17921654 CTCAGGAAACACAATCATGGTGG - Intronic
951180489 3:19653674-19653696 CTCAGGAAACACAATCATGACGG + Intergenic
951704891 3:25534562-25534584 CCCAGGAAAGCCACTGATAAGGG - Intronic
952014938 3:28945309-28945331 CTCAGAAAACAAAATGATGGGGG - Intergenic
952120141 3:30232462-30232484 CTCAGGAAACACAATCAAGGTGG + Intergenic
952221240 3:31326367-31326389 CTCAGGAAACTCAATCATGGTGG + Intergenic
952906011 3:38139498-38139520 CTCAGGAGACCCACTGGTTATGG - Intronic
953835298 3:46338197-46338219 CTCAGGAAACACAGTTATGATGG + Intergenic
954327901 3:49873521-49873543 CTCAGGGAAGCCACTCATGAGGG + Intergenic
954601892 3:51876597-51876619 CTCAGGAGCCAGACTGATGGAGG - Intergenic
955840314 3:63105867-63105889 CTCAAGGAACCCACAGGTGGTGG + Intergenic
956314121 3:67915056-67915078 CTCTGGCAAACCACTGATGTAGG + Intergenic
957784636 3:84866335-84866357 CTCAGGAAACACAATCATGGTGG - Intergenic
957847407 3:85755622-85755644 CTCAGGAAACTCAATCATGGTGG + Intronic
959498132 3:107074733-107074755 CCCAAGAGACCCACTGAAGGAGG - Intergenic
959647761 3:108722686-108722708 CTCAGGCAGCCCAGTGATTGTGG - Intergenic
960384966 3:117011865-117011887 CTCAGGGAACTCACTGAGGGAGG + Intronic
960722435 3:120638117-120638139 CTCAGGAAATACAATCATGGTGG - Intronic
965820012 3:172675855-172675877 TACAGGACCCCCACTGATGGTGG + Intronic
966217533 3:177518878-177518900 CTCAGGAAACATAATCATGGTGG + Intergenic
966414635 3:179676170-179676192 CTCAGGAAACAAAATCATGGCGG - Intronic
967145579 3:186603218-186603240 CTCAGGGAACCCAATGAGGCAGG - Intergenic
968189887 3:196660060-196660082 GTCAGGAAACGCCCTGACGGAGG + Exonic
968524445 4:1048857-1048879 CTCAGGAAACTTAGTCATGGTGG + Intergenic
969103496 4:4787691-4787713 CTCAGGAAACACAATCATGGCGG - Intergenic
969558776 4:7932298-7932320 GTCAAGAAAACAACTGATGGTGG - Intronic
972517300 4:39820323-39820345 CTCAGGAAACTTAATCATGGTGG + Intergenic
973845710 4:54910951-54910973 CTCAGGCTACCAACTGATGGGGG + Intergenic
974850797 4:67403223-67403245 CTCAGGAAAGCTGCTCATGGTGG + Intergenic
976656474 4:87493817-87493839 CTCATGGAACCTACTGATGATGG - Exonic
977002223 4:91518814-91518836 CTGAGCATACCCACTGGTGGTGG - Intronic
977138726 4:93339789-93339811 CTCAGGAAACACAATCATGGTGG + Intronic
979454729 4:120914572-120914594 CTCAGGAAACAGAATCATGGTGG + Intronic
982074902 4:151729479-151729501 CTCAGGAAAGCTACTGTTGATGG - Intronic
982272861 4:153609213-153609235 CTTAGGAAACACAGTTATGGTGG + Intronic
983181776 4:164656677-164656699 CTCAGGGATCCCAGTGAGGGTGG - Intergenic
984306939 4:178005491-178005513 CTCAGGAAACATAATCATGGTGG + Intergenic
987003928 5:13689568-13689590 CTCAGGAAACGTAATCATGGTGG - Intergenic
988119455 5:26942114-26942136 CTCAGGAAACACAATCATGGTGG + Intronic
988590013 5:32540630-32540652 CTGGGGCCACCCACTGATGGTGG - Intronic
989197162 5:38726884-38726906 CTCAGGAAACACAATCATGGCGG + Intergenic
989254548 5:39352054-39352076 CTCAGGAAACCCAATCATGGTGG + Intronic
989386098 5:40855937-40855959 CTCAGGAAACACAATCATGATGG - Intronic
990274521 5:54180990-54181012 CTCTTGAAAGCCACTGATCGGGG - Intronic
991992245 5:72351583-72351605 CTCAGGAAATACAGTCATGGGGG + Intronic
993713662 5:91253019-91253041 CTCAGGAAACACAATCATGGTGG - Intergenic
995895672 5:117007599-117007621 CTCAGGAAACTTACACATGGTGG + Intergenic
997410261 5:133685638-133685660 CTCAAGAATCCCACTGAGAGGGG - Intergenic
997855213 5:137367157-137367179 GGCAGGAAAGCCATTGATGGAGG - Intronic
999237208 5:150106090-150106112 GTCAGCACACCCACTGCTGGGGG - Intronic
1001142538 5:169156895-169156917 CTCAGGAATGACACAGATGGTGG + Intronic
1005078228 6:21929749-21929771 CTCAGGAAATGCAGTCATGGCGG + Intergenic
1005879776 6:30047260-30047282 CTCAGGAAACACAATAATGGTGG + Intergenic
1007158167 6:39766471-39766493 CTAAGAAAACTCCCTGATGGTGG + Intergenic
1008255106 6:49289105-49289127 CTCAGGAAATGCACTGATGTTGG + Intergenic
1009629542 6:66176673-66176695 CCTAGAAAACCAACTGATGGTGG + Intergenic
1009707884 6:67278163-67278185 CTCAGGAATCCTAGTTATGGCGG + Intergenic
1009773300 6:68173356-68173378 CTCAGGAAACAGAATCATGGTGG - Intergenic
1011026340 6:82873446-82873468 CCCTGGAAAACCACTGATGTAGG - Intergenic
1011981560 6:93385853-93385875 CTCAGGAAACATAATCATGGTGG + Intronic
1012505008 6:99935007-99935029 CCCAGGATAGCCAATGATGGTGG + Intronic
1013441815 6:110179268-110179290 CTCGGAAAACCCGCGGATGGGGG + Intronic
1014250016 6:119105487-119105509 CTCAGGAAACTGAATCATGGTGG - Intronic
1014951357 6:127559231-127559253 CTCAGGAAACACAATCATGGAGG - Intronic
1015695539 6:135976015-135976037 CTCAGGGAACCCAGAAATGGTGG + Intronic
1016466049 6:144326836-144326858 CTGAGGAATCCCACTCAAGGAGG + Intronic
1017545043 6:155441603-155441625 CTCAGGAAACCCTCTAATTTAGG - Intronic
1018229349 6:161661042-161661064 CTCAGCACGCCCACTGCTGGTGG + Intronic
1018244101 6:161805420-161805442 CTCAGGAAGGCCACAGAAGGAGG - Intronic
1018870698 6:167780140-167780162 CTCAGGAAACCCACAGCAGAAGG - Intergenic
1024122950 7:46263546-46263568 CTCATGTCACCCACTGATGGAGG + Intergenic
1024581756 7:50806297-50806319 CTCATGAAAGCCAGTGATGAGGG - Intergenic
1024895874 7:54261344-54261366 CTCAGGAAACACAGTCATGGTGG + Intergenic
1026112294 7:67468138-67468160 CTCAGCACTCCCACTGATGATGG + Intergenic
1028306011 7:89265795-89265817 GTCAAGAAACACACAGATGGTGG - Intronic
1028393220 7:90338414-90338436 CTCAGGAAACTTAATCATGGTGG - Intronic
1030699819 7:112626084-112626106 CTCAGGAAAACCACTGGTACAGG + Intergenic
1031194079 7:118590333-118590355 CTCAGGAAACTCAAACATGGTGG - Intergenic
1031708354 7:125011738-125011760 GTCAGGAAACCAAGTGAGGGAGG - Intergenic
1032366630 7:131306140-131306162 CTCAGGAAACGTAATCATGGTGG - Intronic
1033974455 7:147082856-147082878 CTCAGGACACGCAGTGATGCCGG - Intronic
1034477640 7:151296021-151296043 CTCAGGAAACACAATCATGGTGG + Intergenic
1034635142 7:152561223-152561245 CTCAGGACTCCCACTGATTATGG + Intergenic
1034824971 7:154253856-154253878 CTTAGGAAACACAATTATGGTGG + Intronic
1035634562 8:1134719-1134741 CTCAGGAAACTTATTCATGGTGG + Intergenic
1036057275 8:5270231-5270253 CTCAGGAAACACATTCATGGAGG - Intergenic
1036492633 8:9242134-9242156 CTCTAGAAATCCAGTGATGGAGG + Intergenic
1037294448 8:17385782-17385804 CACAGGAAACACAATCATGGTGG - Intronic
1037384374 8:18322021-18322043 CTCAGGAAACTTACAAATGGCGG + Intergenic
1040567723 8:48582334-48582356 CTTTGGAAACCCGCTGGTGGTGG + Intergenic
1040829937 8:51665012-51665034 GTCAGGAGACGCACAGATGGTGG + Intronic
1040996598 8:53408719-53408741 CTCAGGAAACCCACAGATGCAGG + Intergenic
1041265607 8:56061239-56061261 CTCAGGAAACTTAATCATGGCGG - Intergenic
1041468606 8:58183523-58183545 CTCAGGAAACCCAGTATTGATGG + Intronic
1042905753 8:73770105-73770127 CCCAGGAACCCCATTGCTGGTGG - Intronic
1043102330 8:76061240-76061262 CTCAGGAAACATAATCATGGTGG - Intergenic
1046611378 8:116429417-116429439 CTCAGGAAACACAGTCATGGTGG + Intergenic
1047151369 8:122267269-122267291 CTCAGGAAACATAATCATGGCGG + Intergenic
1048442511 8:134470224-134470246 TTCAGCAAACCCTTTGATGGGGG - Intergenic
1054819071 9:69504100-69504122 ATCAGGAAACACAATGATGTTGG - Intronic
1055926895 9:81519612-81519634 CTCAGGAAACTTAGTGATGGTGG + Intergenic
1056459067 9:86791746-86791768 CTCAGAAGACCCAGTCATGGGGG + Intergenic
1056998282 9:91484123-91484145 CTCTGGAAACACACTGCAGGAGG + Intergenic
1057075280 9:92135272-92135294 CTCAGGAAGCATCCTGATGGGGG + Intergenic
1058653310 9:107197181-107197203 CTCAGGAAACACAATCATGGCGG + Intergenic
1060423346 9:123485108-123485130 CTCAGGATCCCCAGTGTTGGGGG + Intronic
1060428236 9:123524695-123524717 CTCAGGCTGCCCTCTGATGGAGG + Intronic
1062143410 9:134973028-134973050 CTCAGGAAGACCACAGAGGGTGG + Intergenic
1185894880 X:3849172-3849194 CTCATAAAACCCACTGACCGTGG - Intergenic
1185899998 X:3887597-3887619 CTCATAAAACCCACTGACCGTGG - Intergenic
1185905114 X:3926025-3926047 CTCATAAAACCCACTGACCGTGG - Intergenic
1188473235 X:30563289-30563311 CTCAGGAAACACAATCATGGTGG - Intronic
1188558140 X:31435154-31435176 CTCACGTAACCCAGTGAGGGAGG - Intronic
1188872791 X:35394509-35394531 CACAGAAAAGCCACTGATGATGG - Intergenic
1189412286 X:40783209-40783231 CTCAGGACCTCCACTTATGGGGG + Intergenic
1190034243 X:47005765-47005787 CTCACCAATCCCAGTGATGGAGG + Intronic
1193727119 X:85055327-85055349 CTCAGGACAGCCACTGCTGTTGG - Intronic
1197146206 X:123175465-123175487 CTGGGGTAACCCACTGAGGGAGG + Intergenic
1197165967 X:123378087-123378109 CTTAGCAAAGACACTGATGGGGG - Intronic
1197740470 X:129888623-129888645 CTCAGGAAACAGAATCATGGTGG - Intergenic
1199748832 X:150795211-150795233 CGCAGGAAACCAATTGCTGGAGG - Exonic
1200739457 Y:6837434-6837456 CTCAGGAAACACAATAATTGTGG - Intergenic