ID: 925429398

View in Genome Browser
Species Human (GRCh38)
Location 2:3778146-3778168
Sequence CTCAGGAAACCCACTGATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 0, 2: 4, 3: 53, 4: 260}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925429398_925429402 -8 Left 925429398 2:3778146-3778168 CCTCCATCAGTGGGTTTCCTGAG 0: 1
1: 0
2: 4
3: 53
4: 260
Right 925429402 2:3778161-3778183 TTCCTGAGTGGCTGTGTGGACGG 0: 1
1: 1
2: 3
3: 43
4: 407
925429398_925429403 -7 Left 925429398 2:3778146-3778168 CCTCCATCAGTGGGTTTCCTGAG 0: 1
1: 0
2: 4
3: 53
4: 260
Right 925429403 2:3778162-3778184 TCCTGAGTGGCTGTGTGGACGGG 0: 1
1: 1
2: 7
3: 151
4: 5453
925429398_925429405 4 Left 925429398 2:3778146-3778168 CCTCCATCAGTGGGTTTCCTGAG 0: 1
1: 0
2: 4
3: 53
4: 260
Right 925429405 2:3778173-3778195 TGTGTGGACGGGACTCCTCCCGG 0: 1
1: 0
2: 2
3: 9
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925429398 Original CRISPR CTCAGGAAACCCACTGATGG AGG (reversed) Intronic