ID: 925434772

View in Genome Browser
Species Human (GRCh38)
Location 2:3827294-3827316
Sequence AAGGGGAGGCAGCAGGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1523
Summary {0: 1, 1: 0, 2: 18, 3: 168, 4: 1336}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925434760_925434772 10 Left 925434760 2:3827261-3827283 CCTTGTTGGACACCAAAAGGCAA 0: 1
1: 0
2: 3
3: 9
4: 119
Right 925434772 2:3827294-3827316 AAGGGGAGGCAGCAGGGGCAGGG 0: 1
1: 0
2: 18
3: 168
4: 1336
925434762_925434772 -2 Left 925434762 2:3827273-3827295 CCAAAAGGCAAAGCCACGTGGAA 0: 1
1: 0
2: 1
3: 18
4: 157
Right 925434772 2:3827294-3827316 AAGGGGAGGCAGCAGGGGCAGGG 0: 1
1: 0
2: 18
3: 168
4: 1336

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925434772 Original CRISPR AAGGGGAGGCAGCAGGGGCA GGG Intronic
900149299 1:1171212-1171234 GAGGGGAGGCTGCAGGGGTTGGG + Intergenic
900151467 1:1180942-1180964 CAGGGGCGGGCGCAGGGGCAGGG - Intronic
900346977 1:2214726-2214748 AAGGGAAGGGAGGAAGGGCAAGG - Intergenic
900388054 1:2419575-2419597 AAGGGGAGCAGGCAGGGGCCCGG + Intergenic
900402397 1:2477923-2477945 CAGGGGCGGGGGCAGGGGCATGG + Intronic
900507894 1:3038788-3038810 AGGGGGTTGCGGCAGGGGCAGGG + Intergenic
900512817 1:3068489-3068511 AAGGGGAGGAGGCGGGGGCCGGG + Intergenic
900598247 1:3492244-3492266 TATGGGGGGCAGGAGGGGCAGGG + Intronic
900700782 1:4047487-4047509 AAGGGGAGGAAGGAGGAGGAAGG + Intergenic
900747510 1:4371270-4371292 AAGGGGAGACATCAGGGTGAGGG + Intergenic
900802869 1:4748157-4748179 GAGGGGAGGATGCAGGGGCGAGG - Intronic
900868044 1:5282783-5282805 AGGGAGAGGCAGCAGGGACAGGG + Intergenic
900971162 1:5993059-5993081 GAGGGACGGCGGCAGGGGCAGGG - Intronic
900990856 1:6097607-6097629 AAAGGGAGGGAGCTGGGGCCAGG + Intronic
901212872 1:7536409-7536431 AAGGGCAGGCTGCAGCGGCAGGG - Intronic
901452244 1:9342819-9342841 AAGGGGAGGGGGCAGAGGCCTGG + Intronic
901731615 1:11284329-11284351 AAGGTGAGGCAGGAGAGGTAGGG + Intronic
902406652 1:16187798-16187820 AGGGGTAGGGAGTAGGGGCAGGG - Intergenic
902550837 1:17218761-17218783 AAGGGAGGGGAGAAGGGGCAAGG + Intronic
902598660 1:17526168-17526190 AAGGAGAGGGAGCACTGGCAGGG - Intergenic
902611888 1:17602566-17602588 AGAGGGAGGCAGCAGGGGTGGGG + Intronic
902721723 1:18308670-18308692 AAGTGGAGGAAGCCCGGGCATGG - Intronic
903070068 1:20722679-20722701 AAGGGCAGGCAGGAAGGGCCAGG + Intronic
903282385 1:22257398-22257420 AGGGGGAGGAGGAAGGGGCAGGG - Intergenic
903291226 1:22315471-22315493 AAGGGGAGGCTGCGGGGGTGTGG + Intergenic
903386448 1:22930195-22930217 AGGAGGAGGCAGGAAGGGCAGGG + Intergenic
903653393 1:24934402-24934424 GAGGGGAGGGAGAAGGAGCAAGG + Intronic
903796055 1:25929764-25929786 AAGGGGAGGGAGAAGGGAAAGGG - Intergenic
904047656 1:27618183-27618205 GAGGGCAGGCAGGAGGGGGACGG + Intronic
904259224 1:29278984-29279006 AGGGAAAGGCAGCAGGGGCCAGG - Intronic
904285838 1:29452812-29452834 ACGGGGATGCAGGAGGGGAAGGG + Intergenic
904339987 1:29828322-29828344 AAGTGGAGGGAGGTGGGGCAGGG + Intergenic
904404190 1:30275384-30275406 AAGTGGAGGGAGGTGGGGCAGGG - Intergenic
904419406 1:30381974-30381996 CAGAGGAGGAAGCATGGGCAGGG + Intergenic
904799257 1:33081363-33081385 GACAGGAGGCAGAAGGGGCAGGG - Intronic
905444402 1:38016211-38016233 GAGGGGAGGGAACAGGGTCATGG + Intronic
905463200 1:38134652-38134674 AAGGGGAGGGGGCAGTGTCACGG - Intergenic
906018880 1:42609095-42609117 AAGGGAAGGCAGGAAAGGCAGGG - Intronic
906321859 1:44822297-44822319 GAGGGGATGCAGCAGCAGCAGGG + Exonic
906484256 1:46222129-46222151 AAGGAGAGGGAGCAAGGGAAAGG + Intergenic
906495230 1:46301012-46301034 TAGGGGAGGGAGAAGGGGAAAGG + Intronic
906545463 1:46616677-46616699 GCGGCGAGGCCGCAGGGGCACGG + Intronic
906723053 1:48023261-48023283 CAGGCGGGGCAGAAGGGGCAGGG - Intergenic
906953205 1:50350783-50350805 ATGGGGAGTCAGAAGGGGGATGG - Intergenic
907190646 1:52645069-52645091 TCGGGGAGGTAGAAGGGGCAAGG + Intronic
907270393 1:53287774-53287796 ATGGGAAGGCAGCAGGTGCTGGG + Intronic
907300804 1:53485311-53485333 AAAAGGAGGCAGCCGGGGGATGG + Intergenic
907621291 1:55983455-55983477 AAGGGGAAGGGGAAGGGGCAGGG + Intergenic
907621294 1:55983461-55983483 AAGGGGAAGGGGCAGGGGAAGGG + Intergenic
907911807 1:58833735-58833757 AAGTGGAGGCAGGAAGGGTAGGG + Intergenic
908182391 1:61618883-61618905 ATGGGCAGGCAGAAGGGGGAGGG + Intergenic
908200241 1:61787912-61787934 CAGGTAAGGCTGCAGGGGCAGGG - Exonic
908252276 1:62274530-62274552 GAGGGAGGGCAGGAGGGGCAGGG + Exonic
908699794 1:66886778-66886800 CAGGGAAGGGAGTAGGGGCAGGG - Intronic
909039615 1:70633241-70633263 AAGGGGCAGCTGCAGGGTCATGG - Intergenic
909182260 1:72439542-72439564 AAGGGGAGGCAAGAGTGGGAAGG - Intergenic
909318024 1:74248053-74248075 ATGGGGAGGCAGCTGAGGCCTGG + Intronic
909816977 1:80006789-80006811 AAGGGGAGACAGAGGGGGCGGGG - Intergenic
910011349 1:82467159-82467181 AAAAGGAGGGAGCAGGGGGAAGG - Intergenic
910028509 1:82687913-82687935 AAGGGGAGGCAGGAGAGGCAGGG - Intergenic
911000549 1:93160822-93160844 CAGGGGAGGCAGGGGGGGCGGGG - Intronic
911174182 1:94802724-94802746 CAGGGAAGGCTTCAGGGGCAGGG - Intergenic
911507178 1:98767629-98767651 CATGGGAGGGAGCTGGGGCAAGG + Intergenic
911930486 1:103896677-103896699 AAGAGGAGGAGGCAGGGGAAGGG - Intergenic
912639785 1:111333659-111333681 AAGGAGAGGCTGCAGAGGAAAGG + Intergenic
912706497 1:111918933-111918955 GAGGGGAGGCAGCTGAGGAAGGG + Intronic
912887359 1:113488958-113488980 AAGGGAATGCAGCTGGAGCAGGG - Intronic
913498020 1:119446185-119446207 AAAGGGAGGCAGCAGGACCTGGG - Intergenic
913509043 1:119545929-119545951 AAAGGGAGGCAGCAGGATCTGGG - Intergenic
913968620 1:143397059-143397081 GAGGGGCGGATGCAGGGGCAGGG + Intergenic
913968834 1:143398533-143398555 AAGAGGAAGCAGCAAGTGCAAGG - Intergenic
914062999 1:144222658-144222680 GAGGGGCGGATGCAGGGGCAGGG + Intergenic
914063213 1:144224132-144224154 AAGAGGAAGCAGCAAGTGCAAGG - Intergenic
914115937 1:144742222-144742244 AAGAGGAAGCAGCAAGTGCAAGG + Intergenic
914116151 1:144743696-144743718 GAGGGGCGGATGCAGGGGCAGGG - Intergenic
914250147 1:145915349-145915371 GAGGGGTGGGAGCAGAGGCATGG - Intronic
914869252 1:151459231-151459253 AGGGGGTGGGAGCAGGGGGAGGG + Exonic
915455948 1:156040917-156040939 AGGGGCTGGCAGGAGGGGCAGGG - Intronic
915743999 1:158142158-158142180 CAGGGGCGGGGGCAGGGGCAGGG + Intergenic
915914387 1:159932235-159932257 AGAGGGAGGCAGCACGGTCAAGG + Intronic
915970243 1:160349833-160349855 AAGGGGAAGCAGGAGAGGGAAGG - Intronic
916641146 1:166729934-166729956 TGGGAGGGGCAGCAGGGGCAGGG - Intergenic
916682737 1:167119265-167119287 AAGGGGAGGCTGAAGAGGCTGGG + Exonic
918050009 1:180965561-180965583 AAGTGCTGGGAGCAGGGGCATGG - Intergenic
918059643 1:181049933-181049955 AAGTGCTGGGAGCAGGGGCATGG - Intronic
918097442 1:181346751-181346773 AATTGGAGGCACCATGGGCAGGG + Intergenic
918332340 1:183472365-183472387 AGGGGGAGGGAGGAGGGGCGGGG - Intronic
919419757 1:197355541-197355563 GAGGGGAGGCAGCTGAGGCCTGG + Intronic
919632724 1:199974620-199974642 AAAGGAAGGCAGCAAGGGCCAGG + Intergenic
919796671 1:201325220-201325242 TAGGGGAAGCACCAAGGGCAGGG + Intronic
919816621 1:201444892-201444914 AAGGGGAGAAAGCAGAGGCATGG + Intergenic
919837238 1:201583270-201583292 GAGAGGAGACAGCAGGGGCAAGG + Intergenic
919881936 1:201906597-201906619 CAGGGCAGGCAGCAGGGCCCAGG + Intronic
919974632 1:202602637-202602659 CAGAGGAGGCAGTTGGGGCAGGG + Intronic
919982040 1:202647820-202647842 AGGGGGAGGGAGGAGGGGGAAGG - Intronic
920044531 1:203124822-203124844 GTGGGGAGGCTGCAGGTGCAAGG + Intronic
920189161 1:204181389-204181411 AAGAGGAAACATCAGGGGCATGG + Intergenic
920255611 1:204652219-204652241 AAGGGGAGAGAGGAGGGGGAAGG - Intronic
920257980 1:204669250-204669272 AAGGGAAGGGAGCAGGAGTATGG + Intronic
920379366 1:205526835-205526857 AAGGTGAGGCCTCGGGGGCAGGG + Exonic
920399659 1:205669087-205669109 AAGGGGTGGCAGTAGAAGCAAGG + Intronic
920415181 1:205794842-205794864 AAGTGGCAGGAGCAGGGGCATGG - Intronic
920442398 1:205989675-205989697 CAGGGGAGGCAGAAGGGCCAGGG - Intronic
920756452 1:208738385-208738407 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
920761161 1:208784887-208784909 AAGGGAAGGAAGCCAGGGCAGGG - Intergenic
921334480 1:214072633-214072655 AGAGGGAGGCAGCAGGGGGGAGG - Intergenic
921422066 1:214959677-214959699 AAGTGGAGGCAGAAGGGAGAGGG + Intergenic
921456807 1:215380803-215380825 AAGGGGAGGAAGAAGTGGGAAGG + Intergenic
922564025 1:226589555-226589577 AAAGGCAGGCAGCAGAGGCCTGG - Intronic
922574405 1:226652494-226652516 AAGGGAGGGCTGGAGGGGCACGG - Intronic
922606910 1:226895143-226895165 CAGGGGAGGCAGCACGGCCTCGG + Intronic
922775790 1:228213750-228213772 TCGGGGAGGTAGCGGGGGCAAGG + Intronic
922785409 1:228280085-228280107 AAGGTGGGGCATGAGGGGCATGG + Exonic
922797349 1:228347010-228347032 AAGGGAAGGCAGAGGGGACACGG - Intronic
922810875 1:228414900-228414922 AAGGGGAGGCGGAAGCGGAAGGG - Exonic
922880350 1:228975750-228975772 AAGGGGAGGCGGCAGGGACAAGG - Intergenic
923072424 1:230577859-230577881 AAGGGGAAGAAGGAGGGGAAGGG - Intergenic
923457603 1:234178133-234178155 CAGAGGAGGCAACTGGGGCATGG - Intronic
923521630 1:234739428-234739450 AAGGGGCAGCAGAAGGGGCATGG - Intergenic
923540341 1:234884220-234884242 AAGGTGAGGTAGCAGGAGCGTGG + Intergenic
923552972 1:234978914-234978936 AAGCAGAGGCAGCAGGGGGCAGG + Intergenic
923789512 1:237100041-237100063 AAGGGCAGGCAGGAGGGTCCTGG - Intronic
924207123 1:241725019-241725041 AAAGGCAGACAGCAGGGGCAGGG + Intronic
924455011 1:244212372-244212394 AATGGGAGGGAGCAGGGGATGGG + Intergenic
1062767174 10:74696-74718 AAGGGGAAGGAGAAGGGGAAGGG + Intergenic
1062805310 10:415383-415405 AAGGAGAGGCAGCAGGAGGAGGG + Intronic
1062833577 10:622257-622279 AGGGGGAGGGAGGAGGGGGAGGG + Intronic
1062833584 10:622270-622292 AGGGGGAGGGAGGAGGGGGAGGG + Intronic
1062856304 10:781123-781145 AGCGGGAGGCAGCACGGGCCTGG + Intergenic
1062959970 10:1565512-1565534 GAGGGGAGGCAGCAGGGAAAGGG + Intronic
1062969186 10:1633062-1633084 CAGGAGAGGAAGCAGGAGCACGG - Intronic
1063286251 10:4692080-4692102 AAGGGGAAGGAGAAGGGGAACGG + Intergenic
1063380726 10:5583888-5583910 AAGGGGAGGGAACAGGGTCTGGG + Intergenic
1063536761 10:6891224-6891246 GAGGGCAGGCAGGAGGGGCCAGG - Intergenic
1063590581 10:7391945-7391967 AATGGGCGGCAGCAGAGGCATGG - Intronic
1064097835 10:12436948-12436970 GGGGAGAGGCACCAGGGGCAGGG + Intronic
1065284779 10:24176870-24176892 ACGGGGAGGCAGCTGAGGCCTGG + Intronic
1065625470 10:27624922-27624944 AAGGGGAGGGGTCTGGGGCAGGG - Intergenic
1066047198 10:31604044-31604066 ATGGGGAGGCAACAGGAGGAGGG - Intergenic
1066061551 10:31727891-31727913 AAGGGAAGGCAGAAAGGCCATGG + Intergenic
1066442058 10:35448730-35448752 TCAGAGAGGCAGCAGGGGCAGGG + Intronic
1066613593 10:37275470-37275492 ATGGGGAGGCAGCTGAGGCTCGG + Intronic
1067145599 10:43691612-43691634 CAGGGCTGCCAGCAGGGGCATGG - Intergenic
1067165482 10:43863558-43863580 GAGAGGAGGCAGCAGAGGGATGG - Intergenic
1067222479 10:44353884-44353906 ATGGGTAGGCAGCAAGGACAGGG + Intergenic
1067370609 10:45678608-45678630 CAGGGGAGGCAGCAGGGTGCGGG + Intergenic
1067389172 10:45847548-45847570 CAGGGGAGGCAGCAGGGTGCGGG - Intronic
1067416898 10:46109410-46109432 CAGGGGAGGCAGCAGGGTGCGGG + Intergenic
1067445085 10:46337001-46337023 CAGGGGAGGCAGCAGGGTGCGGG + Intergenic
1067502300 10:46816293-46816315 CAGGGGAGGCAGCAGGGTGCGGG + Intergenic
1067592287 10:47523727-47523749 CAGGGGAGGCAGCAGGGTGCGGG - Intronic
1067639403 10:48031800-48031822 CAGGGGAGGCAGCAGGGTGCGGG - Intergenic
1067713803 10:48671678-48671700 CAGCGGAGGCCGCAGGGGCTCGG + Intergenic
1067745536 10:48933020-48933042 GTGGGGAGGCAGCAGAGGCAGGG + Intronic
1067874091 10:49988505-49988527 CAGGGGAGGCAGCAGGGTGCGGG + Intronic
1068400004 10:56516269-56516291 AAGAGAAGGCAGCAGAGGTAAGG - Intergenic
1068665985 10:59676571-59676593 AAGGGGGGGAAAAAGGGGCAAGG + Intronic
1068668490 10:59700703-59700725 AAGGTGAGGAAGCAGAGGTAGGG - Intronic
1068722702 10:60263815-60263837 AAGGTGAGGCACGAGGGACACGG - Exonic
1068962064 10:62877038-62877060 ACAGGGAGGCTGCAGGGGAAGGG - Intronic
1069694661 10:70377670-70377692 AAGGGCAGAGAGAAGGGGCATGG + Intronic
1069772181 10:70907047-70907069 GAAGGGAGGCAGGAAGGGCAGGG + Intergenic
1069780079 10:70949877-70949899 AAGAGGAGGCAGATGAGGCAGGG + Intergenic
1069915364 10:71783756-71783778 AAGGGGACGGATGAGGGGCAGGG - Intronic
1070136391 10:73697950-73697972 CAGGGGAGGCAGCAGGGTGTGGG - Exonic
1070311359 10:75276122-75276144 GTGGGGACGCAGGAGGGGCAGGG + Intergenic
1070317327 10:75327237-75327259 AAGGGTAGGGGCCAGGGGCAGGG - Intergenic
1070675639 10:78409675-78409697 GAGTGGAGGGGGCAGGGGCATGG - Intergenic
1070711542 10:78686715-78686737 AAGGGCAGGAACCGGGGGCAGGG + Intergenic
1070811676 10:79301231-79301253 AAGGGTAGGGAGGAGGGGCCAGG - Intronic
1070896116 10:79983779-79983801 AAGAGGAGGCCGCAGGCGCTGGG - Intergenic
1071038763 10:81280949-81280971 CAGGGGAGACAGTAGGGGGATGG + Intergenic
1071100040 10:82025939-82025961 ATGTGGATGGAGCAGGGGCAGGG - Intronic
1071152233 10:82649245-82649267 AAGGGGAGGCAGGAGGTAGAGGG - Intronic
1071573260 10:86709499-86709521 AAGGGTAGGCAGAAGAGGCCAGG + Intronic
1072199889 10:93149077-93149099 AAGGGGAGTCACCAAAGGCAGGG - Intergenic
1072577846 10:96716891-96716913 AAGGGGAGGCTGTAGCAGCAGGG + Intronic
1072639584 10:97201871-97201893 AAGAGGAGGGAGCAGGTGGAGGG - Intronic
1072705889 10:97680581-97680603 CACGGGAGGCAGCTGAGGCAGGG - Intronic
1072801186 10:98393432-98393454 AAGGGGAAGCAGCTGGAGAATGG - Intronic
1072873004 10:99140663-99140685 AAGGGGAGGGAGCAAGGTTAAGG + Intronic
1073091132 10:100940773-100940795 CAGGGGCAGGAGCAGGGGCAGGG - Intronic
1073091146 10:100940803-100940825 AAGGAGAAGGGGCAGGGGCAGGG - Intronic
1073118689 10:101108200-101108222 GAGGGGTCACAGCAGGGGCAGGG + Intronic
1073358297 10:102874781-102874803 AAGGGGTGGCAAAAGGGGGAAGG + Intronic
1073539478 10:104306729-104306751 AGAGGAAGGCAGCAAGGGCAAGG - Intergenic
1073615662 10:104992139-104992161 TAGGGGAGGGAGCAGGGGGTAGG + Intronic
1074146370 10:110720696-110720718 GAGAGCAGGCTGCAGGGGCAGGG - Intronic
1074696238 10:116052206-116052228 AAGGGGAGGTGGTGGGGGCAGGG - Intergenic
1074765057 10:116694533-116694555 AAGGGGAGGGAGGAGGTGGAGGG - Intronic
1075083296 10:119397883-119397905 AAGGGGAGGCAACAAGGTGATGG - Intronic
1075086097 10:119415386-119415408 AAGGGGAAGCAGGTCGGGCAGGG + Intronic
1075284483 10:121171785-121171807 AAGGGAAGGCAGAAGGGGAAGGG + Intergenic
1075284490 10:121171803-121171825 AAGGGAAGGGAGAAGGGGAAGGG + Intergenic
1075284497 10:121171821-121171843 AAGGGAAGGGAGAAGGGGAAGGG + Intergenic
1075284504 10:121171839-121171861 AAGGGAAGGGAGAAGGGGAAGGG + Intergenic
1075691070 10:124394558-124394580 AAGGGGTTGAAGCAGGGGCGTGG - Intergenic
1075704894 10:124494713-124494735 TCAGGGAGGCAGCAGAGGCATGG - Intronic
1075775595 10:124984039-124984061 GAGGGTAGGCGGCAGGGGGAGGG + Intronic
1076135234 10:128041000-128041022 TAGGGGAGGCAGCCAGGGAAAGG - Intronic
1076172091 10:128327630-128327652 CTGGGGAGGAAGCAGGGTCAGGG - Intergenic
1076196070 10:128519303-128519325 AAGTGGGGGCTGTAGGGGCACGG - Intergenic
1076296873 10:129392235-129392257 AAGGTGAGGCACCATGGGGACGG - Intergenic
1076312490 10:129518468-129518490 AAGGGAGGGGAGGAGGGGCAGGG - Intronic
1076312503 10:129518493-129518515 AAGGGAGGGGAGGAGGGGCAGGG - Intronic
1076312516 10:129518518-129518540 AAGGGAGGGGAGGAGGGGCAGGG - Intronic
1076639615 10:131905387-131905409 CAGGAGAGGGAGCAGGGGCTGGG - Intronic
1076673259 10:132134634-132134656 AAGGGGCAGCGGCAGGGGCCAGG + Intronic
1076769255 10:132654201-132654223 GAAGGGCGGCAGCAGAGGCACGG - Intronic
1076790545 10:132774853-132774875 ACGGGCAGGGAGGAGGGGCAGGG + Intronic
1076790576 10:132774940-132774962 ACGGGCAGGGAGGAGGGGCAGGG + Intronic
1076790603 10:132775013-132775035 AGGGGCAGGGAGGAGGGGCAGGG + Intronic
1076790646 10:132775113-132775135 AGGGGCAGGGAGGAGGGGCAGGG + Intronic
1076985559 11:233455-233477 AAGTGGAGGCAGCAGTGACAAGG - Exonic
1077128874 11:959251-959273 AAGGGGCTGCAGCAGGGCCGGGG - Intronic
1077182893 11:1224433-1224455 AAGGGCAGTCAGCCTGGGCAGGG + Intronic
1077197525 11:1288824-1288846 ATGGTGCGGCTGCAGGGGCAGGG - Intronic
1077214009 11:1387719-1387741 AAGAGGGGACAGCAGGGCCAAGG + Intergenic
1077235844 11:1481703-1481725 CAGGGGCAGGAGCAGGGGCAGGG + Intronic
1077318656 11:1930222-1930244 AAGGCGGGGCAGCTGGTGCAGGG + Intronic
1077391338 11:2301962-2301984 AAGGGCAGGCAGGAAGGGGAGGG - Intronic
1077430143 11:2512292-2512314 ACGGGGAGGATGCAGAGGCAGGG - Intronic
1077486261 11:2839646-2839668 GAGGGAAGGCAGCAGGGGCTGGG + Intronic
1077755851 11:5026257-5026279 ACTTGGAGGCATCAGGGGCAAGG - Intergenic
1077866948 11:6230221-6230243 AAGAGGAGGGAGCTGGGGGAAGG + Intronic
1077874671 11:6294099-6294121 AAGAGAAGGAGGCAGGGGCAGGG + Intergenic
1077922160 11:6649708-6649730 AGGGTGAGGGAGCTGGGGCACGG + Intronic
1078068454 11:8093262-8093284 CAGTGCAGGCAGCAGGAGCAAGG + Intronic
1078241404 11:9534006-9534028 AAGGGCAAGCAGGAGGGGAAGGG - Intergenic
1078424507 11:11238440-11238462 AAGGGGCTGCAGCAGCTGCAGGG - Intergenic
1078822515 11:14895962-14895984 AAGAGGATGCAGAAGGGGAAAGG + Intergenic
1078845871 11:15118018-15118040 AAGGGGTGGCTGCGGGGCCAGGG - Intronic
1079077111 11:17390853-17390875 GAAGGGAAGTAGCAGGGGCAGGG - Intergenic
1079100407 11:17538189-17538211 CAGGGCTGGCAGCAGGGGCAGGG - Intronic
1079116959 11:17646103-17646125 AAAGGGAGCCAGGATGGGCAGGG - Intronic
1079312550 11:19379220-19379242 ATGGGGCGTGAGCAGGGGCAAGG + Intronic
1079621923 11:22566374-22566396 GCTGGGAGGCAGCAGGGGAAGGG + Intergenic
1080107485 11:28525946-28525968 AAGGGGAGGCAGCTAAGGCCCGG + Intergenic
1080268349 11:30424656-30424678 GAGGGGAGGGAGCAGGGGCCAGG - Intronic
1080642285 11:34165000-34165022 AGGGAGGGGGAGCAGGGGCAGGG - Intronic
1081000475 11:37664231-37664253 TAAAGGAGGCAGCAGAGGCAAGG + Intergenic
1081155475 11:39684421-39684443 AAGGGGAAGGAGAAGGGGAAGGG - Intergenic
1081158084 11:39719160-39719182 AAGGGGTGGTAGCAGGGTGAAGG + Intergenic
1081411918 11:42769462-42769484 AATGGTAGGCAGCAAGGGCTGGG - Intergenic
1081630583 11:44686888-44686910 AATGCCAGGCAGCATGGGCAGGG - Intergenic
1081635677 11:44720079-44720101 GGAGGCAGGCAGCAGGGGCATGG + Intergenic
1081678227 11:44983485-44983507 AGAGGGAGGCAGGAGGGCCAAGG + Intergenic
1081864609 11:46352644-46352666 AGGAGGAGGCAGAGGGGGCAGGG - Intronic
1081875207 11:46403839-46403861 AAGGGGAGTGGGGAGGGGCAGGG + Intronic
1081912366 11:46707973-46707995 AAGTGTAGACAGCAGGAGCAGGG + Intergenic
1082810625 11:57477000-57477022 AAAGGGAGGCAGCAAGGCCAGGG - Exonic
1083142523 11:60733703-60733725 AAGTGGAGGAAGAAGGAGCATGG + Intronic
1083160469 11:60851125-60851147 GATGGGAGGGAGCAGGGGCGAGG + Exonic
1083294891 11:61709982-61710004 GAGAGGAGGCAGCAGGACCAGGG + Intronic
1083618644 11:64038280-64038302 GAGGGGAGGCTGCAGGCCCAGGG - Intronic
1083714936 11:64569732-64569754 GAGAGGAGGCAGCAGGGGCAGGG - Exonic
1083719911 11:64598993-64599015 AAGCGGAGCCAGCAGAGGCCGGG - Intronic
1083996205 11:66274128-66274150 ATGGGGATGCAGCTGGGGCATGG - Intronic
1084215367 11:67644561-67644583 CAGGGAAGGCAGCAGGGCCAGGG + Intronic
1084360883 11:68667817-68667839 AAGTGGAGAGGGCAGGGGCAGGG - Intergenic
1084382821 11:68824310-68824332 GAAGGGAGGCAGCAGGGCAAGGG + Intronic
1084545242 11:69812120-69812142 AGGTGGAAGCAGCAGGTGCAAGG + Intronic
1084612432 11:70212181-70212203 GAGAGGAAACAGCAGGGGCAAGG - Intergenic
1084649311 11:70479411-70479433 ACCGTGAGGCAGCAGGCGCAGGG + Intronic
1084720462 11:70902428-70902450 GTGGGGAGGCGGCAGGGGCTGGG - Intronic
1084801239 11:71545610-71545632 GAGGGGAGGGAGCTGGGTCATGG - Intronic
1084900149 11:72303503-72303525 AAGGGGAGGCAGCATGTCCAAGG - Intronic
1084978661 11:72816875-72816897 CAGCACAGGCAGCAGGGGCAGGG - Intronic
1085268131 11:75249902-75249924 ACAGGGAGGAAGCTGGGGCAGGG - Intergenic
1085375902 11:76060779-76060801 ACGGGGAGGCAGCTGAGGCCTGG - Intronic
1085472816 11:76769026-76769048 GTGGGCAGGAAGCAGGGGCATGG + Intergenic
1085525070 11:77159390-77159412 GAGGGTGGGCAACAGGGGCAAGG - Intronic
1085572063 11:77568518-77568540 AAGGGGAGGGAAGAGGGGGAAGG - Intronic
1085716421 11:78877614-78877636 CAGGGGAGGCAGCACAGCCATGG - Intronic
1086598199 11:88600295-88600317 AAGGGGAGGGAGAGGGGGAAGGG - Intronic
1087031958 11:93715207-93715229 AAGGGGAGGGAACAGTGGAAAGG - Intronic
1087122498 11:94589594-94589616 CAGGGAAGGGAGCAGGGGAATGG - Intronic
1087144534 11:94798925-94798947 AAGGGGAGACAGCAAGTGTAGGG + Intronic
1087515437 11:99154176-99154198 GTGGGGAAGCAGCAGGAGCAGGG + Intronic
1088466731 11:110147701-110147723 AAGGGGAGGCAAAAGGAGTAAGG - Intronic
1088626355 11:111733180-111733202 AAAGGGAGGCAGCAGCAGGAAGG - Intronic
1088735332 11:112723744-112723766 AAGGGGAGGGAGGATGGGCAGGG + Intergenic
1088814985 11:113414589-113414611 CAGAGGAGGCAGTTGGGGCAAGG + Intronic
1089254579 11:117187576-117187598 AAGGAGAGGCCGCAGGGAAAGGG - Intronic
1089350735 11:117820299-117820321 AAGGGGAGGCGCCAGAGGCAGGG + Exonic
1089505321 11:118958395-118958417 AAGGTGAGGCACTGGGGGCAAGG - Exonic
1089629101 11:119772733-119772755 ATGGGGTGGCAGCAGGAGGAGGG + Intergenic
1089643189 11:119860970-119860992 AGGGGGAGGCAGCAAAGCCATGG + Intergenic
1089692499 11:120195612-120195634 AAGGGGCAGGAGCAGGGGCAGGG - Intergenic
1090437074 11:126695924-126695946 ATGAGGAGGCAGCAGTGTCAGGG - Intronic
1090476256 11:127023856-127023878 AAAGGGAGGCAGCAGGGAAAGGG - Intergenic
1090843895 11:130515248-130515270 AAGGGGTGGCAGCTGGAGAAGGG - Intergenic
1091312446 11:134584405-134584427 GTGGGGAGGCAGCAGGGGGGTGG - Intergenic
1091314117 11:134598691-134598713 AAGGGGAGTGACCAGGGCCAGGG - Intergenic
1091390974 12:125858-125880 AATCGGAGGCGGCAGGGGCGTGG - Exonic
1091790925 12:3271752-3271774 AGGGAGAGGCAGGAGGGGCAGGG - Intronic
1091915805 12:4271321-4271343 AAGTGGGGGCAGCGGGGGCGAGG - Intergenic
1092122224 12:6052518-6052540 AAGTGCAGGCAGCAGTGTCAGGG - Intronic
1092236876 12:6815965-6815987 ATGTGGAGGCAGCAGGGAGATGG - Intronic
1092261546 12:6955795-6955817 GAGGGGAGGCAGCTGGGGCAGGG - Intronic
1092882889 12:12901487-12901509 AAGGGGAGTCAGGAGGAGGACGG - Intronic
1092994298 12:13933734-13933756 AAGGGATGGCTGCAGGTGCATGG + Intronic
1093097264 12:14985612-14985634 TAGAGGAGGCAGCAGAGGCCAGG - Intergenic
1093554921 12:20460810-20460832 AAAAGGGGGGAGCAGGGGCATGG - Intronic
1093583260 12:20807586-20807608 AGGGGGAGGCAGCTGAGGCCTGG + Intergenic
1093653903 12:21674177-21674199 AAGGGGCAGGGGCAGGGGCAGGG - Intronic
1093952866 12:25183232-25183254 GAGGGGAGGGAGCGGGGACAAGG + Intronic
1094122294 12:26987096-26987118 AAGGGGAGGCAGAGGTGGAAGGG - Intronic
1094166614 12:27449941-27449963 GAAGGGAGGCAGCAAAGGCAGGG - Intergenic
1094250529 12:28354985-28355007 AAGGAGAGGCAGGAGGGAGAAGG - Intronic
1094494312 12:30979919-30979941 ACGGGAAGGCAGCAGGGGTGGGG - Intronic
1095374943 12:41515702-41515724 AAGGGAAGGCAGCAGTGATAAGG - Intronic
1095668928 12:44835467-44835489 AGAGAGAGGCAGCAGGGACATGG + Intronic
1095980555 12:47972094-47972116 ACCTGGAGGAAGCAGGGGCAGGG + Intergenic
1096096474 12:48938790-48938812 GAGGGGAGGCAGGGGAGGCAAGG + Exonic
1096128216 12:49135770-49135792 AAGAGGAGGCAGGCTGGGCATGG - Intergenic
1096143922 12:49264980-49265002 AAGGTGGGGCCGCAGCGGCACGG + Exonic
1096226109 12:49867859-49867881 CAGTGTAGGCAGCAGGGTCAGGG - Exonic
1096231883 12:49901273-49901295 GAGGGGCAGCAGCAGGTGCATGG - Exonic
1096346246 12:50849537-50849559 AAGGGCTGGATGCAGGGGCAGGG - Intronic
1096407416 12:51354101-51354123 TAGGGAAGGCAGCTGGGGGAGGG - Exonic
1096462916 12:51832538-51832560 AGGGGACGGCAGCAGGGGCCAGG - Intergenic
1096868675 12:54579784-54579806 AAAGGAAGGCAGCTGGGGCTTGG + Exonic
1097040584 12:56153819-56153841 AAGGGGCGGGGGCAGGGGCAGGG - Intronic
1097186551 12:57199411-57199433 AAGGGGTGGGAGCAGGCGAACGG + Intronic
1097351401 12:58553209-58553231 AAGGGTAGGAAGGAGGAGCAGGG - Intronic
1097369968 12:58766388-58766410 AAGAGGAGGTGGCAGAGGCAGGG + Intronic
1097790664 12:63811970-63811992 AAGAGGAGGAAGGAGGGGGAGGG + Intergenic
1097992034 12:65845937-65845959 AAGGGCAGGCAGCAGGGGGGAGG - Intronic
1098879336 12:75901088-75901110 GAGGAGAGGAAGCAGGGGCCGGG + Intergenic
1098880306 12:75910435-75910457 AACAGCAGGCAGCAGGGGCATGG - Intergenic
1098890073 12:76001241-76001263 AAAGGGAGGGAGTAGTGGCAAGG + Intergenic
1099758869 12:86892934-86892956 AACTAGAAGCAGCAGGGGCAGGG - Intergenic
1100178665 12:92059780-92059802 AAGAGGAGCCAGCAGATGCAGGG - Intronic
1100206373 12:92354412-92354434 ATGGGGAGCCAGCAGGGGGATGG - Intergenic
1100329718 12:93571810-93571832 AAGGGGAGGTGGGAGGGGCCCGG - Exonic
1100390972 12:94146629-94146651 GAGGGGAGGAAGAAGGGGAAAGG - Intergenic
1100409590 12:94302023-94302045 AAAGGTGGACAGCAGGGGCAAGG - Intronic
1100550731 12:95644353-95644375 AAGGAGAAGAAGAAGGGGCAAGG - Intergenic
1101362367 12:104040146-104040168 ATGGGGTGGGAGCAGGGGGAGGG + Intronic
1101452064 12:104788945-104788967 AGGGGCAGAAAGCAGGGGCAAGG + Intergenic
1101542421 12:105676991-105677013 CAGGGGAGGCAGGAGGGGCCAGG + Intergenic
1102009137 12:109607266-109607288 AAAGCGAGGAGGCAGGGGCAGGG + Intergenic
1102098231 12:110257403-110257425 AAGTGGAGGAAGCAGGGAAACGG - Intergenic
1102119549 12:110429636-110429658 GTGGGGACGCAGCAGGTGCAGGG + Intergenic
1102230239 12:111257225-111257247 AAGGGGAGGAAGAAGTGGGAGGG - Intronic
1102491048 12:113289816-113289838 CAGGGGAGGGAGGAGAGGCAAGG - Intronic
1102682239 12:114698664-114698686 AAAGGGAGGGAGAAGGGGAAAGG - Intergenic
1102786118 12:115606349-115606371 AAGGGGAGAGAGGAGGGGGATGG + Intergenic
1102793946 12:115672570-115672592 AAGGGATGGCAGCAGGGAAAGGG - Intergenic
1102923230 12:116808478-116808500 CAAGGGACGCAGCAGGGACAGGG + Intronic
1103568295 12:121828094-121828116 CAGGGGCAGGAGCAGGGGCAGGG - Intronic
1103605685 12:122084387-122084409 AAGGGGAGGAAGGAGAGGAAGGG + Intronic
1103612650 12:122133553-122133575 GCTGGGAGACAGCAGGGGCATGG - Exonic
1103907803 12:124336222-124336244 AAGTGGAGGCAGGCGGTGCAAGG - Intronic
1103944160 12:124517151-124517173 AAGGGGAGGCAACACGCCCAAGG + Intronic
1104080354 12:125424890-125424912 AAGAGGAGACAGCAAGGGTAGGG + Intronic
1104290701 12:127464012-127464034 AAGTGGAGGGAGCTGGGGCAGGG + Intergenic
1104466774 12:128996813-128996835 AGTGGGATGCAGGAGGGGCAGGG + Intergenic
1104640018 12:130461329-130461351 CAGGGGTGCCAGCAGGGGCAGGG + Intronic
1104945784 12:132414365-132414387 ACGGGGCGGCAGCTGGGACAGGG - Intergenic
1104983985 12:132586581-132586603 AAGGGCAGGCTGCATAGGCAGGG - Intergenic
1105595158 13:21830613-21830635 AGGGGGAGGGAGAAGGGGAAAGG - Intergenic
1105783954 13:23729192-23729214 AATGGGGAGCAGCAGGGACAGGG + Intergenic
1106230880 13:27820312-27820334 ATGGGGAGGAAGCAGGTGCAGGG + Intergenic
1107238386 13:38200375-38200397 AAGGGGAAGCGGAAGGGGAAGGG + Intergenic
1107330509 13:39295073-39295095 AAGAGAAGGCAGAAGAGGCATGG - Intergenic
1107561246 13:41559258-41559280 ATGGGGAGGCACCATGGGCCTGG - Intergenic
1107688401 13:42927285-42927307 AAGGGTAGGCAGAATGGGCCAGG - Intronic
1107795453 13:44046903-44046925 AAGGGGAAGGAGAAGGGGAAGGG - Intergenic
1107824299 13:44313624-44313646 AAAGGGAGGCTGGAGGAGCAGGG + Intergenic
1107963383 13:45578249-45578271 AAGAGGAAACATCAGGGGCATGG - Intronic
1109636460 13:65124446-65124468 AAGAGGAAACAGGAGGGGCAAGG - Intergenic
1110182656 13:72635916-72635938 AATGGGAGCCAGCATGTGCAGGG - Intergenic
1110388658 13:74945533-74945555 AAGGGAGGGCAACAGAGGCAGGG + Intergenic
1110484264 13:76019768-76019790 ATGGGGACCCAGAAGGGGCATGG + Intergenic
1110563005 13:76929354-76929376 AAGGGGAGGCAGGAGAGGCAGGG + Intergenic
1110582882 13:77152721-77152743 AAGGGGAGCTAGAAAGGGCATGG - Intronic
1111074543 13:83216500-83216522 AAGGGGAGGGAGCAAGGCCTTGG - Intergenic
1111217781 13:85166407-85166429 AAGGGGAGAAAACAGGGCCAGGG - Intergenic
1111262489 13:85760395-85760417 ATGGGGAGCCAGAAGGGGTATGG + Intergenic
1111396346 13:87672929-87672951 AAGGGGAGGGAGGAGAGGGAAGG - Intronic
1111413810 13:87912463-87912485 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1111850439 13:93566706-93566728 AAGGGGAGGGGGCAAGGGGAGGG - Intronic
1112929240 13:104714023-104714045 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1113164989 13:107430438-107430460 GAGTGGAGGGAGCAGGGGGAGGG - Intronic
1113260655 13:108558688-108558710 TACAGGAGGCAGCAGGAGCAAGG - Intergenic
1113433122 13:110267260-110267282 CAGTGGAGGGAGGAGGGGCAGGG + Intronic
1113675901 13:112207811-112207833 AAGGGAAGGCAGCAGCCACATGG + Intergenic
1113788083 13:113013380-113013402 GGGGGGAAGCAGCAGGGCCACGG - Intronic
1113789302 13:113019115-113019137 ATGGGGTGGGAGAAGGGGCAAGG - Intronic
1113866940 13:113532572-113532594 AAGGGGTGGCAGCCCAGGCAGGG + Intronic
1113955597 13:114098632-114098654 GAGGGGAGGCAGGAAGGGCAAGG + Intronic
1113967829 13:114164392-114164414 AAGGAGAGGCAGATGGGGGAAGG + Intergenic
1114066887 14:19067946-19067968 ATTGGAAGGAAGCAGGGGCATGG - Intergenic
1114095379 14:19332081-19332103 ATTGGAAGGAAGCAGGGGCATGG + Intergenic
1114155563 14:20099412-20099434 ATGGGGAGGCAGCTGAGGCCTGG - Intergenic
1114438295 14:22726283-22726305 TGGGGAAGACAGCAGGGGCATGG + Intergenic
1114483012 14:23047135-23047157 AGGGGGAGGCGGCTGGGGAAGGG - Exonic
1116076066 14:40112626-40112648 CAGGGCAGCCAGCAGGGGTAGGG + Intergenic
1116996774 14:51332989-51333011 CAGAGGAGGCAGCAGGGCCAGGG - Intergenic
1117763847 14:59059715-59059737 AGGGGCAGGGGGCAGGGGCAGGG + Intergenic
1117763857 14:59059734-59059756 AGGGGCAGGGGGCAGGGGCAGGG + Intergenic
1118459840 14:65977617-65977639 ACAAGGAGGCAGCTGGGGCATGG + Intronic
1118732613 14:68678989-68679011 AGGGGGTGGGGGCAGGGGCAGGG - Intronic
1118875895 14:69784729-69784751 GAGGGGAGGCTGCTGGGCCAGGG + Intronic
1119207896 14:72808321-72808343 AAGGAGTGGGAGCAGGGACAGGG + Intronic
1119407045 14:74405479-74405501 AGGAGCAGGCAGCAGGGGCGTGG + Intergenic
1119425946 14:74534828-74534850 AAGGGGAGGTTTCAGGGGCAGGG + Intronic
1119440328 14:74623949-74623971 AAGTGGAGGTAGCTGGGGCAAGG - Intergenic
1119913314 14:78371372-78371394 AAGGGGAGGTGGAAGGGGGATGG - Intronic
1120280463 14:82431747-82431769 ATGGGAAGGCAGAAGGGGGATGG + Intergenic
1120404360 14:84076053-84076075 AAGAGGAGGCAAAAGGAGCAGGG - Intergenic
1120827511 14:88969058-88969080 AAGGGGAAACAGCAGGAACAAGG - Intergenic
1120922046 14:89764174-89764196 TAGGGGAGGCAGGAGAGGCTGGG + Intergenic
1120978949 14:90274200-90274222 ACGGGGACTCAGCATGGGCAGGG + Exonic
1121083067 14:91124330-91124352 AAGAGGAGGCATCAGGAGGAGGG - Intronic
1121263271 14:92581900-92581922 AAGGGGAAACATCAGGGGCAGGG + Intronic
1121554904 14:94829127-94829149 CAGGTGAGGCTGCAGGGGCTGGG - Intergenic
1121617468 14:95322255-95322277 AAGTGCAGGGAGCAGGGGAAGGG - Intergenic
1121843738 14:97155542-97155564 AATGGGAGGCTACAGGGCCAAGG - Intergenic
1121904082 14:97723772-97723794 ATGGGGAGGGAGCAGGGGGTGGG - Intergenic
1121938265 14:98041570-98041592 CATGGCAGGCAGCAGGGACATGG - Intergenic
1122227978 14:100290806-100290828 CGGGCGGGGCAGCAGGGGCAGGG - Intergenic
1122366856 14:101199458-101199480 AAGGGGAGGAAGGGAGGGCAGGG - Intergenic
1122558182 14:102592601-102592623 GAGGGGAGGAGGCAGGGGCGGGG - Intergenic
1122769657 14:104092325-104092347 AGGAGGTGGGAGCAGGGGCAGGG + Intronic
1122856149 14:104561129-104561151 TGGGGCAGGCAGCTGGGGCAGGG - Intronic
1122881318 14:104691714-104691736 AAGGAGAGAGGGCAGGGGCACGG + Intronic
1122885267 14:104707834-104707856 ACGGGGGGGCTGCAGGTGCAGGG - Exonic
1122892201 14:104737693-104737715 AATGGGAGGCGCCAGGGGCTGGG - Intronic
1123068110 14:105628256-105628278 GAGGGGGGGCAGGAGGAGCAGGG - Intergenic
1202904389 14_GL000194v1_random:59978-60000 AAGAGGAGGCCGGAGGGGCTGGG - Intergenic
1202849997 14_GL000225v1_random:10155-10177 GCTGGGAGGCTGCAGGGGCACGG - Intergenic
1202855049 14_GL000225v1_random:44570-44592 GCTGGGAGGCTGCAGGGGCACGG - Intergenic
1202857472 14_GL000225v1_random:59860-59882 GCTGGGAGGCTGCAGGGGCACGG - Intergenic
1202859208 14_GL000225v1_random:71437-71459 GCTGGGAGGCTGCAGGGGCACGG + Intergenic
1202863482 14_GL000225v1_random:100279-100301 GCTGGGAGGCTGCAGGGGCACGG + Intergenic
1123706630 15:22955505-22955527 GTGGGCAGGCAGCAGGGGCTGGG + Intronic
1123799895 15:23808734-23808756 AAGTGGAGGGAGGTGGGGCATGG + Intergenic
1123871471 15:24578974-24578996 CAGGGCATGCAGAAGGGGCATGG + Intergenic
1123934382 15:25187077-25187099 GAGGGGAGCCAGCGTGGGCAAGG + Intergenic
1124056324 15:26243872-26243894 AAGTGGAGGCACCCTGGGCATGG + Intergenic
1124190789 15:27574613-27574635 AAGGAGGGGCAGGAGGGGCTCGG - Intergenic
1124231182 15:27947562-27947584 CAGAGAAGGCATCAGGGGCATGG - Intronic
1124244345 15:28056904-28056926 GGGGGCAGGCAGCTGGGGCAGGG - Intronic
1124248838 15:28094726-28094748 CAGGGGCGGCAGGAGGGGCCCGG - Intronic
1124396696 15:29308512-29308534 AAGGGGAGGCAGCTGACTCAGGG - Intronic
1124424052 15:29548049-29548071 AAGGGGAGTTATCAGGGGCTGGG + Intronic
1124613155 15:31222977-31222999 GAAGGGAGGCAGGAGAGGCAGGG + Intergenic
1124647666 15:31450415-31450437 AAGGGGAGGGAGAAGGGAAAGGG + Intergenic
1125356311 15:38820400-38820422 AGAGGGAGGCAGGAGGGTCAGGG - Intergenic
1125531420 15:40415968-40415990 AGGATGAGGAAGCAGGGGCATGG - Intronic
1125731841 15:41896801-41896823 GAGGGTAGGCAGCAGAGGCCAGG - Exonic
1125743073 15:41980914-41980936 GTGGGGAGGCAGCGGGGACAGGG + Intergenic
1125887676 15:43240748-43240770 AAGGGGAGGGACCAGGCTCATGG + Intronic
1125919064 15:43514325-43514347 AAGAGGAGCCAGCAGGGGTGGGG - Intronic
1126564896 15:50084829-50084851 AGAGGGAGGCAGGAGGGTCAAGG - Intronic
1128019876 15:64381157-64381179 AAGAGGAAGTCGCAGGGGCAGGG - Intronic
1128074961 15:64820168-64820190 ATGGGGAATAAGCAGGGGCAGGG + Intronic
1128237880 15:66079919-66079941 AAGGGGAGGAAGCAGGTGCTGGG - Intronic
1128278018 15:66370483-66370505 GAGGAGGGCCAGCAGGGGCATGG + Intronic
1128363451 15:66979555-66979577 AAGGGGAGGGAGGAAGGGGAAGG - Intergenic
1128562066 15:68675241-68675263 AATGGGAGGCAGCTGCCGCAAGG - Intronic
1128611778 15:69079787-69079809 AAGGGGTGGAAGGAGGGCCAGGG - Intergenic
1128673992 15:69595595-69595617 AAGGGGAGGAAGTAGAGCCAGGG - Intergenic
1128737165 15:70059740-70059762 AAGGGCAGGCTGTGGGGGCAGGG - Intronic
1128740978 15:70083532-70083554 GAGGGGAGGGAGGAGGGGGAAGG - Intronic
1128762006 15:70223497-70223519 GAGGGGAGGCAGGAGGGGCAGGG - Intergenic
1128782898 15:70374634-70374656 TGGGGGAGGCAGCAGAGACAGGG - Intergenic
1128943571 15:71807337-71807359 GAAGGGAGGAAGCGGGGGCAGGG - Intronic
1129155226 15:73713523-73713545 AAGAGGAGGAAGGAGGGGAAAGG - Exonic
1129242433 15:74259522-74259544 AGGGGGAGGCCCCAGGGGAAGGG - Intronic
1129468464 15:75737630-75737652 TAGGGGTGGCTGCAGGGGCAGGG - Intergenic
1129674235 15:77623666-77623688 AAGGGGAGGCAGGTGGGGGCGGG - Intronic
1129699157 15:77757688-77757710 AAAGAGAGCCAGCAGGGGCAGGG + Intronic
1129727108 15:77906866-77906888 TAGGGGTGGCTGCAGGGGCAGGG + Intergenic
1129739500 15:77983436-77983458 AAGGGGAGGCTGCTGTGGCAAGG - Intergenic
1129760437 15:78126130-78126152 AAGGGGGGGGGGCAGGGGAAAGG - Intronic
1130073751 15:80671052-80671074 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1130241758 15:82200063-82200085 CGGGGAAGGAAGCAGGGGCAGGG + Intronic
1130403972 15:83581580-83581602 AAGGAAAGGCAGTAGGGGCCTGG - Intronic
1130430439 15:83842031-83842053 ATGGGGAGGCAGAAGGGGGATGG - Intronic
1130430447 15:83842050-83842072 ATGGGAAGGCAGAAGGGGGATGG - Intronic
1130430479 15:83842219-83842241 ATGAGGAGGCAGAAGGGGGATGG + Intronic
1130441092 15:83955240-83955262 AAGGGGAGGGAAGAGGGGGAAGG - Intronic
1130458669 15:84141097-84141119 CGGGGAAGGAAGCAGGGGCAGGG - Intergenic
1131014142 15:89043472-89043494 AAGGAGAGGAAGAAGGGGGAGGG + Intergenic
1131014157 15:89043519-89043541 AAGAGGAGGGAGGAGGGGAAGGG + Intergenic
1131059779 15:89397556-89397578 CCTGGGAGGGAGCAGGGGCAGGG + Intergenic
1131312757 15:91305857-91305879 AAGGGGAGGAGGCCGGGTCACGG + Intergenic
1131331847 15:91507702-91507724 AAGGAGAGACAGCAGGGGACAGG - Intergenic
1131461866 15:92623180-92623202 AGTGGGAGACAGCAGGAGCATGG - Intronic
1132577752 16:671800-671822 AGGGGGCGGGGGCAGGGGCAGGG - Intronic
1132578969 16:676510-676532 GTGGGCAGGCGGCAGGGGCACGG + Intronic
1132605646 16:792693-792715 GAGGAGAGGCGGCAGGGCCAGGG - Intronic
1132638208 16:963988-964010 CACGGGAGGCAGCAGAGCCATGG + Intronic
1132738704 16:1400025-1400047 CAGGGGAGGCTGAGGGGGCAGGG + Intronic
1132748363 16:1446241-1446263 TCGGGGCAGCAGCAGGGGCAAGG + Exonic
1132851424 16:2026717-2026739 AGGGGGAGGCGGCAGGGCTAGGG - Intronic
1132878667 16:2151438-2151460 AAGGGAAGCCTGCAGGGGCTGGG + Intronic
1132973475 16:2700311-2700333 AAGGGGAGGCAGCCTGGGAAAGG - Intronic
1132978220 16:2721029-2721051 AAGGGATGGCAGCCGGGGCCCGG - Intergenic
1133022941 16:2974772-2974794 GAGGGGCGGAAGCAGGGGGAAGG + Intronic
1133203082 16:4216728-4216750 GAAGGGAGGCAGCAGGCCCAAGG - Intronic
1133214526 16:4283547-4283569 AAGGGTAGGAAGAAGGGGCCAGG - Intergenic
1133473535 16:6098237-6098259 ATGGAGAGGCAGCAGTGCCAAGG + Intronic
1133755244 16:8757685-8757707 AAGGAGAGGTGGGAGGGGCATGG + Intronic
1133971275 16:10569973-10569995 AAGGGGAGGCTGCAAGGGCAGGG - Intronic
1134111428 16:11517710-11517732 AAGGGCAGGCGGGAGGAGCACGG - Intronic
1134549466 16:15132327-15132349 GAGGGGAGGGGGCAGGGGCTAGG + Intronic
1134549477 16:15132346-15132368 TAGGGGAGGGGGGAGGGGCAAGG + Intronic
1134770605 16:16806050-16806072 AAGGGGAAGGAGAAGGGGGAAGG - Intergenic
1134955755 16:18381488-18381510 TAGGGGAGGAGGCAGGGGCTAGG + Intergenic
1134978812 16:18591128-18591150 AAGGAAAGGCGGCAGTGGCATGG + Intergenic
1135166826 16:20146492-20146514 AAGGGGAGGAAGGAGGGAGAAGG + Intergenic
1135381188 16:21997427-21997449 AGGGGGAGGCAGGAGGAGCGAGG + Intronic
1135992117 16:27224541-27224563 AATGGGATGCAGGAGGGTCAGGG + Intergenic
1136005271 16:27324949-27324971 AGGAGGAGGCAGCAGGGACTTGG - Intronic
1136069772 16:27780845-27780867 CCCTGGAGGCAGCAGGGGCATGG - Intergenic
1136086781 16:27890892-27890914 AAGGGGAGGGAGCAGTGGCAGGG + Intronic
1136100053 16:27987467-27987489 CAGGGGGCACAGCAGGGGCAGGG - Intronic
1136103020 16:28009363-28009385 AAGGGCATGCAGGGGGGGCAGGG - Intronic
1136396669 16:29996231-29996253 AAGTGGAGGCGGGAGCGGCACGG + Exonic
1136564990 16:31064433-31064455 AAGTGGAGGCTGCAGAGGCCCGG - Exonic
1136676539 16:31913669-31913691 AAGGGGAGGGAGGAGTGGTAAGG - Intronic
1136928561 16:34397332-34397354 GAGGGGAGGCAGAAGCGCCAAGG + Intergenic
1136976013 16:35014472-35014494 GAGGGGAGGCAGAAGCGCCAAGG - Intergenic
1137229090 16:46545281-46545303 AAGAGGAGGCAGAAGAGGCAAGG - Intergenic
1137401174 16:48155661-48155683 AGTGGGAGGCAGCAGGGACGAGG - Intronic
1137542865 16:49377090-49377112 CAGGGGAGGCAGGGAGGGCAGGG - Intronic
1137563897 16:49521558-49521580 ATGGGGAGACAGCAGTGGCATGG + Intronic
1137908446 16:52350916-52350938 AAGGGAAGGCAGAATGGGGAGGG - Intergenic
1137945708 16:52731623-52731645 ATGGGGAGGCAGCTGAGGCCTGG - Intergenic
1138279382 16:55761424-55761446 AAGGGGAAGCAGCAGAGCCTGGG + Intergenic
1138289147 16:55832253-55832275 AAGGGGAAGCAGCAGAGCCTGGG - Intronic
1138350609 16:56344488-56344510 CAGGGGAGGGAGCAGGGAGACGG - Exonic
1138429846 16:56961817-56961839 TAGAGGAGGCCGCAGGGGCTGGG + Intergenic
1138503011 16:57460125-57460147 AATGGGAGAGAGGAGGGGCAGGG - Intronic
1138585962 16:57970707-57970729 AAGTGCAGTCAGCAGGGACACGG - Intronic
1138599148 16:58044993-58045015 AGGTGTAGGCTGCAGGGGCAAGG - Exonic
1139284455 16:65798071-65798093 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1139494505 16:67306548-67306570 ATGGAGAGGCAGGACGGGCACGG - Intronic
1139658126 16:68401457-68401479 TATAGGAGGCAGCAGGGGCTGGG + Intronic
1139959642 16:70710260-70710282 AAGGGGAGCCAGCCAGGGAAGGG - Intronic
1140018683 16:71215257-71215279 AAAGGGAGGAAGGAGGGGGAAGG + Intronic
1140034799 16:71364029-71364051 TGGGGGAGGGAGCAGAGGCAGGG - Intronic
1140043316 16:71423985-71424007 GAGGGGAGGCAGCAGGACCAGGG - Intergenic
1140222383 16:73053353-73053375 GTGGGGAGGCTGCGGGGGCAAGG + Intronic
1140354901 16:74297169-74297191 AAGTGGCGGCGGCTGGGGCAGGG - Intronic
1140889339 16:79271896-79271918 CAGGGGAGGCAGAGGGGTCAGGG - Intergenic
1141117677 16:81324454-81324476 AGGGGGAGGCACCAGGATCAGGG + Intronic
1141241309 16:82267540-82267562 AAGGGGAGGAAGCAGAGCAAGGG + Intergenic
1141301846 16:82823238-82823260 AAAGTGGGGCAGCAGGGGAAGGG + Intronic
1141612223 16:85188088-85188110 AAGGGGAGGCAGGTGTGGGATGG + Intergenic
1141638909 16:85329874-85329896 AGGGCCAGGCATCAGGGGCAGGG + Intergenic
1141667505 16:85473517-85473539 AGGGGGAGCCGGCAGAGGCAGGG - Intergenic
1141691898 16:85601300-85601322 GAGAGGAGGCAGCAGGGGTGGGG + Intergenic
1141747516 16:85935717-85935739 AGAGGGAGGCAGGAGGGTCAGGG + Intergenic
1141918982 16:87122257-87122279 AAGGGGAGACGGAACGGGCAGGG - Intronic
1142071232 16:88092188-88092210 AAGAGGAAGGAGCTGGGGCAGGG - Intronic
1142126088 16:88411382-88411404 GTGGTGGGGCAGCAGGGGCAAGG + Intergenic
1142132329 16:88436745-88436767 CAGAGGAGGCTGCAGGGGCAGGG + Exonic
1142225936 16:88877686-88877708 GAGGGGGTGCAGCAGAGGCAGGG - Intronic
1142263889 16:89054758-89054780 CCAGGGAGGCAGCAGGGGCCGGG - Intergenic
1142595717 17:1028921-1028943 AAGGGGATGCTGCGGGGGCAGGG + Intronic
1143267684 17:5652724-5652746 ATGGGGAGGGAGGAAGGGCAAGG + Intergenic
1143894856 17:10128010-10128032 GAGGGGAGGCAGCACCGGCGAGG + Intronic
1144320844 17:14117926-14117948 ATGGGGAGCCAGAAGGGGGATGG + Intronic
1144591593 17:16528657-16528679 GAGTGGAGGCAGCAGTGTCAGGG + Intergenic
1144729348 17:17517764-17517786 CAGGCTGGGCAGCAGGGGCAGGG - Intronic
1144955824 17:19018331-19018353 AAGGGGATGAAGCTGGGGCATGG - Intronic
1145255658 17:21320942-21320964 AAGAGGAGGCAGTGGAGGCAGGG - Intergenic
1145320956 17:21767006-21767028 AAGAGGAGGCAGTGGAGGCAGGG + Intergenic
1145328154 17:21848978-21849000 AAGGGGAGGTTACAGGGGCTGGG - Intergenic
1145348499 17:22057087-22057109 AAGGGGAGGTTACAGGGGCTGGG + Intergenic
1145694939 17:26780325-26780347 AAGGGGAGGTTACAGGGGCTGGG - Intergenic
1145761322 17:27426763-27426785 CTGGGGAGGCAGCCTGGGCAGGG - Intergenic
1146466292 17:33089267-33089289 AAAGGGAGGCAGGAGGATCAAGG + Intronic
1146842546 17:36166026-36166048 AAGTGGAGGCCGCAGAGGCAAGG + Exonic
1146854858 17:36253985-36254007 AAGTGGAGGCCGCAGAGGCAAGG + Exonic
1146865762 17:36334391-36334413 AAGTGGAGGCCGCAGAGGCAAGG - Exonic
1146870758 17:36377877-36377899 AAGTGGAGGCCGCAGAGGCAAGG + Exonic
1146878116 17:36428958-36428980 AAGTGGAGGCCGCAGAGGCAAGG + Exonic
1146882057 17:36450062-36450084 AAGTGGAGGCCGCAGAGGCAAGG + Intergenic
1147068632 17:37935003-37935025 AAGTGGAGGCCGCAGAGGCAAGG - Exonic
1147073641 17:37978501-37978523 AAGTGGAGGCCGCAGAGGCAAGG + Intronic
1147080154 17:38014540-38014562 AAGTGGAGGCCGCAGAGGCAAGG - Intronic
1147085163 17:38058039-38058061 AAGTGGAGGCCGCAGAGGCAAGG + Exonic
1147096103 17:38138500-38138522 AAGTGGAGGCCGCAGAGGCAAGG - Intergenic
1147101109 17:38182005-38182027 AAGTGGAGGCCGCAGAGGCAAGG + Intergenic
1147258435 17:39195561-39195583 CTGGGGAGGGAGTAGGGGCATGG + Intronic
1147320392 17:39642420-39642442 CAGGAGAGGCAGCCTGGGCAGGG + Intronic
1147326353 17:39671565-39671587 AGGGGCTGGCAGCAGGGGAATGG + Exonic
1147476163 17:40713470-40713492 AATGGGAGGGAGAAGGGGCAGGG - Intergenic
1147906343 17:43825573-43825595 ATGGGGTGGCAGCAGGAGGAGGG - Intronic
1147927379 17:43954004-43954026 AGGGGGAGCCAGCAGGGGGTGGG + Intronic
1148032107 17:44628535-44628557 CAGGGGCAGCGGCAGGGGCAGGG + Intergenic
1148228942 17:45919250-45919272 TAGAGGAGGCACCAGGGGCCCGG - Intronic
1148374604 17:47131530-47131552 GAGGGGAGGGAGAAGGGGAAAGG + Intronic
1148406062 17:47417284-47417306 AAGAGGAGGCAGAAGAGGCAAGG + Intronic
1148437376 17:47694545-47694567 AAGGGGCCGCAGGAGGGGCCCGG + Intronic
1148448738 17:47759182-47759204 AAGGGGAGGCAGGAAAGGCTGGG + Intergenic
1148667647 17:49386786-49386808 AGGGGAAGGGAGCAGTGGCAGGG - Intronic
1148677199 17:49452313-49452335 CAGGGGAAGCAGGAAGGGCAGGG - Intronic
1148713763 17:49700705-49700727 AAGGGGAGGCAGTGGGGAAATGG + Intergenic
1148715976 17:49716241-49716263 GAGGGGAGGCAGCAAAGGCAAGG + Exonic
1148748737 17:49932486-49932508 GAGGGCAGGCAGCGGGGGCCTGG - Intergenic
1148939552 17:51196472-51196494 AAGGGGGGGCAGCCTGGCCAAGG - Intronic
1148985017 17:51613459-51613481 AGGGGGAGGGAGAGGGGGCAAGG - Intergenic
1149753990 17:59172737-59172759 ACGGGGAGGCAGCTGAGGCCCGG - Intronic
1149845700 17:60008468-60008490 AAGTGGAGGCCGCAGAGGCAAGG + Intergenic
1150084048 17:62265048-62265070 AAGTGGAGGCCGCAGAGGCAAGG + Intergenic
1150519571 17:65852280-65852302 AAGGGAAGGGAGGAGGGGAAGGG - Intronic
1150999025 17:70352137-70352159 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1151145229 17:72034388-72034410 AGGGGGAAGCAGGAGGGACATGG - Intergenic
1151326011 17:73380169-73380191 AGGGGAAGGAAGCAGGGGCAGGG - Intronic
1151381655 17:73729961-73729983 AGGGGTGGGCAGCAGGGGGAAGG + Intergenic
1151439785 17:74120671-74120693 AAGGGAAGGCAGCCAGGGAAGGG + Intergenic
1151557229 17:74852647-74852669 AAGGGGCGGGAGGAGGGGCTCGG - Intronic
1151732978 17:75921834-75921856 ACGGGGACGGGGCAGGGGCAGGG + Intronic
1151963028 17:77417346-77417368 AAGAGGAGGCCACAGGTGCAAGG + Intronic
1151983145 17:77526193-77526215 ATGGGGAGGCAGCTGAGGCCCGG + Intergenic
1152143054 17:78549841-78549863 CAGGGGCCGCAGCAGGTGCAGGG - Intronic
1152316577 17:79584036-79584058 GAGAGGAGGAGGCAGGGGCACGG + Intergenic
1152379804 17:79936561-79936583 AATCGCAGGCAGCAGGGGCCAGG + Exonic
1152397067 17:80039933-80039955 AAGGGGAAGCAGCAGTGGAAGGG + Exonic
1152461942 17:80446161-80446183 CTTGGGGGGCAGCAGGGGCAGGG - Intergenic
1152464637 17:80458853-80458875 ACTGGGAGCCAGCAGGGGAACGG - Intergenic
1152589727 17:81205490-81205512 GAGGGGAGGTAGGAGGGGCAGGG + Intronic
1152676194 17:81642540-81642562 GTGGGGTGGCACCAGGGGCAGGG - Intronic
1152809683 17:82375584-82375606 AAGGGGACGGAGGAGGGGCAGGG - Exonic
1152840070 17:82561644-82561666 GAGGGGAGGCAGCGGCAGCACGG + Intronic
1203192763 17_KI270729v1_random:205166-205188 AAGGGGAGGTTACAGGGGCTGGG - Intergenic
1203202127 17_KI270730v1_random:4601-4623 AAGGGGAGGTTACAGGGGCTGGG - Intergenic
1153220384 18:2855587-2855609 AAGGGGAGGCAGGTGGGGCCAGG + Intronic
1153322411 18:3786073-3786095 AAAGGGAGGCAGGAGGGTCTGGG - Intronic
1153446014 18:5173998-5174020 AAGGGGAGGGCTCTGGGGCAAGG - Intronic
1153466859 18:5397604-5397626 AAGTGCATGCACCAGGGGCAGGG - Intronic
1153528067 18:6016212-6016234 CCGGGGGAGCAGCAGGGGCACGG + Intronic
1153868725 18:9297151-9297173 ACGGGGAGGCAGCTGAGGCCCGG - Intergenic
1153951493 18:10061383-10061405 AGGGGGAGGGAGCAGGGAGAGGG - Intergenic
1154409440 18:14129404-14129426 AGGGGCTGGCAGCAGGGTCAGGG + Intronic
1154415168 18:14172303-14172325 AAGGGTAGGGGGCAGGGTCAGGG + Intergenic
1154983653 18:21527028-21527050 TGGTGGAGGCAGCAGGGACACGG - Intergenic
1155016800 18:21850495-21850517 AAGTAGAAGAAGCAGGGGCAAGG - Intronic
1156055653 18:32999259-32999281 AAGGGGAGGAAAGAGGGGGAAGG + Intronic
1156290876 18:35747843-35747865 GAGGGGAGGGAGCAGGGGACAGG + Intergenic
1156504535 18:37581031-37581053 AAGGGGTGGCAGATGGGACAGGG - Intergenic
1156856371 18:41786217-41786239 GAGAGGAGGCAGCAGGAGGAGGG + Intergenic
1157298730 18:46464543-46464565 AAGGGGCGGGAGCAGAGGCTAGG - Intergenic
1157858654 18:51122507-51122529 AAGGCCAGGCAGCAGGGCCTTGG - Intergenic
1158383801 18:56966286-56966308 AAGAGGGGGCAGGAGAGGCAAGG - Intronic
1158423107 18:57313436-57313458 AAGGGGAGGGGGAAGGGGGAAGG + Intergenic
1159109815 18:64043178-64043200 ACGGGGAGGCAGCTGAGGCCTGG - Intergenic
1159183372 18:64939749-64939771 AAATGGAGTCAGCAGGGGCCTGG + Intergenic
1159390765 18:67789207-67789229 AAGGGGATGCTGCAGTGGAAGGG + Intergenic
1159417604 18:68173259-68173281 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1159421705 18:68229751-68229773 AAGGGGAGGCAAGAGAGGCAGGG - Intergenic
1159428649 18:68322257-68322279 AAGGGGAACCAGCAGAGACAGGG + Intergenic
1159733101 18:72056251-72056273 AAGTGGAGGCTGCAGGTGCCTGG - Intergenic
1159950392 18:74478502-74478524 CCAGGGAGGCAGCTGGGGCATGG - Intergenic
1160265278 18:77336453-77336475 AGAGGGAGGCAGCAGGGTCAAGG + Intergenic
1160316154 18:77849525-77849547 AGGAGAAGGCAGCACGGGCAGGG - Intergenic
1160411000 18:78675394-78675416 CAGGGGCGGGAGCAAGGGCAGGG + Intergenic
1160722709 19:604422-604444 GGGTCGAGGCAGCAGGGGCAGGG + Intronic
1160771761 19:835227-835249 AAGGGGGAGCAGCAGGGGCTGGG - Intergenic
1160805006 19:988765-988787 CAGTGGTGGCAGCAGAGGCAGGG - Intronic
1160829834 19:1098589-1098611 GAGGGGAGGCAGCAGCAGGAGGG + Intergenic
1160925137 19:1540701-1540723 GGGGGGAGGAAGCAGGGGGACGG + Intergenic
1160935743 19:1593680-1593702 AAGGGGAGACAACAGGGGGTGGG - Intergenic
1160985617 19:1837281-1837303 GAGGGGAGGCCCCAGGAGCAGGG - Intronic
1160998335 19:1895574-1895596 GCGGGGAGGGAGCAGGGCCAGGG + Intergenic
1161083534 19:2323185-2323207 GAGGGGAGCGAGCGGGGGCAGGG + Intronic
1161146613 19:2682708-2682730 ATGGGGTGGGAGCAGGGGCAGGG - Intronic
1161238569 19:3209641-3209663 AGGGGGTGACAGTAGGGGCAGGG + Intergenic
1161267263 19:3370058-3370080 TGGGGGAGGCAGCAGGGCCCAGG + Intronic
1161303015 19:3552027-3552049 AGGTAGAGGCAGCAGGGGCCAGG - Intronic
1161404032 19:4081895-4081917 AAGAGCAGGGAGGAGGGGCAGGG - Intergenic
1161435786 19:4262062-4262084 AAGGGCTGGCTGCAGGGGCGAGG - Exonic
1161574809 19:5049380-5049402 CAGGGGAGACAGCTGGGGCGGGG + Intronic
1161657172 19:5523421-5523443 AAGGGGAGGCAGGGAGGGGACGG - Intergenic
1161741292 19:6022620-6022642 AAGGGGACGGAGCCGGGGCTGGG - Intronic
1161751717 19:6102577-6102599 AAGGAGAGGCAGAAGAGGCAGGG - Intronic
1162032841 19:7924902-7924924 CAGGGGAGGGAGGAGGGACAAGG + Exonic
1162084650 19:8241130-8241152 AAGGGAAGGTGGCAGGGGCAAGG + Intronic
1162378110 19:10316811-10316833 AAGGGGAGGGGGCTGCGGCAGGG + Exonic
1162690511 19:12426035-12426057 AAGGGGAAGGAGAAGGGGAAGGG + Intronic
1162739962 19:12768155-12768177 CAGGGCTGGGAGCAGGGGCAGGG + Intronic
1162782038 19:13011522-13011544 GAGGGGTGGGAGCAGAGGCAGGG + Intronic
1163163445 19:15479529-15479551 GGCGGGAGGCAGCAGGGACATGG + Exonic
1163408937 19:17141408-17141430 AAGGGGAGGGCACAGGGGCAGGG - Intronic
1163496151 19:17647693-17647715 AAGGGCAGGACGCAGGGACATGG - Intronic
1163638179 19:18447184-18447206 CAGTGGAGGCAGCAAGGGCCTGG - Intronic
1163703857 19:18800992-18801014 GAGGGGACGCAGCTGGGGCACGG - Intergenic
1164079841 19:21852479-21852501 ACGGGGAAGCAGCTGGGGCTAGG + Intergenic
1164609740 19:29623974-29623996 AAGTGGGGCCTGCAGGGGCATGG + Intergenic
1164629759 19:29754400-29754422 AAGAGGAGACAGCAGTGGCGAGG + Intergenic
1164684529 19:30158134-30158156 AATGGGGGGCAGCAGGGGTAAGG + Intergenic
1165076315 19:33281668-33281690 CTGGGGAGGCAGCAGGAGCCCGG + Intergenic
1165113260 19:33514145-33514167 AGGAGGAGTAAGCAGGGGCAGGG + Intronic
1165144884 19:33724672-33724694 AAGGAGAGGGGGCAGGGGCAGGG - Intronic
1165331449 19:35142990-35143012 AGGGGGAGTCTGCGGGGGCAGGG - Exonic
1165792933 19:38502804-38502826 CAGGGGGAGGAGCAGGGGCAGGG + Intronic
1165798757 19:38534942-38534964 AAGGGGAAGCTGCAAGGGCTGGG - Intronic
1166007321 19:39916505-39916527 AGGAGGAGGCAGCTGGGGCTGGG - Intronic
1166083546 19:40460012-40460034 AAGGCTGGGCAGCAGGGGCTGGG - Intronic
1166330647 19:42076328-42076350 AAGAGGAGGCCGCGGCGGCAGGG - Intronic
1166425878 19:42677247-42677269 AGAGGGAGGCAGGAGGGTCAGGG - Intronic
1166803983 19:45474003-45474025 GAGGGGAGGAAGAAGGGGGATGG - Exonic
1166859311 19:45800582-45800604 AGAGGGGGGCAGCAGGGTCAGGG + Intronic
1166864970 19:45830310-45830332 CTGGAGAGGCAGCAGGGGGATGG - Intronic
1167090930 19:47343123-47343145 AGAGGGAGGCAGGAGGGTCAGGG + Exonic
1167509158 19:49887296-49887318 AGTGGGAGGAAGGAGGGGCAGGG + Intronic
1167579069 19:50331484-50331506 AAGGGGAAGAAGAAGGGGGAGGG - Intronic
1167705740 19:51079886-51079908 AAGGAGAGGCAGCTGGGGCTGGG - Intronic
1168153269 19:54460378-54460400 CAGGGGAGGCAGCGAGGGCTGGG + Intronic
1168291956 19:55361445-55361467 AGAGGGAGGCAGGAGGGGCCCGG + Intronic
1168329318 19:55557537-55557559 TGGGGGAGGCAGTGGGGGCAGGG - Intergenic
1168688377 19:58362223-58362245 AAGGGGAGGAAGCTGCGGCCAGG + Intronic
1202702409 1_KI270712v1_random:174529-174551 GAGGGGCGGATGCAGGGGCAGGG + Intergenic
1202702625 1_KI270712v1_random:176003-176025 AAGAGGAAGCAGCAAGTGCAAGG - Intergenic
924982303 2:235347-235369 CAGGGGAGGCAGCATGGGCCAGG + Intronic
924982317 2:235388-235410 CAGGGGAGGCAGCATGGGCCAGG + Intronic
924982324 2:235407-235429 CAGGGGAGGCAGCATGGGTCAGG + Intronic
924982330 2:235426-235448 CAGGGGAGGCAGCATGGGCCAGG + Intronic
924982351 2:235489-235511 CAGGGGAGGCAGCATGGGCCAGG + Intronic
924982358 2:235508-235530 CAGGGGAGGCAGCATGGGTCAGG + Intronic
924982364 2:235527-235549 CAGGGGAGGCAGCATGGGCCAGG + Intronic
924982385 2:235590-235612 CAGGGGAGGCAGCATGGGCCAGG + Intronic
924982392 2:235609-235631 CAGGGGAGGCAGCATGGGTCAGG + Intronic
924982412 2:235672-235694 CAGGGGAGGCAGCATGGGCCAGG + Intronic
924982426 2:235713-235735 CAGGGGAGGCAGCATGGGTCAGG + Intronic
924982444 2:235776-235798 CAGGGGAGGCAGCATGGGCCAGG + Intronic
924982451 2:235795-235817 CAGGGGAGGCAGCATGGGCCAGG + Intronic
924982458 2:235814-235836 CAGGGGAGGCAGCATGGGCCAGG + Intronic
924982484 2:235899-235921 CAGGGGAGGCAGCATGGGCCAGG + Intronic
924982510 2:235984-236006 CAGGGGAGGCAGCATGGGCCAGG + Intronic
924982517 2:236003-236025 CAGGGGAGGCAGCATGGGCCAGG + Intronic
924982524 2:236022-236044 CAGGGGAGGCAGCATGGGTCAGG + Intronic
924982537 2:236063-236085 CAGGGGAGGCAGCATGGGCCAGG + Intronic
924982544 2:236082-236104 CAGGGGAGGCAGCATGGGTCAGG + Intronic
924982564 2:236145-236167 CAGGGGAGGCAGCATGGGCCAGG + Intronic
924982598 2:236252-236274 CAGGGGAGGCAGCATGGGCCAGG + Intronic
925092509 2:1166946-1166968 ATGGAGAGCCAGAAGGGGCATGG - Intronic
925185202 2:1842393-1842415 GAGGTGGGGCAGCAGGGGCCTGG - Intronic
925369779 2:3336122-3336144 AAGGGGAGGGTGAAGGGTCAAGG + Intronic
925434772 2:3827294-3827316 AAGGGGAGGCAGCAGGGGCAGGG + Intronic
925476354 2:4221063-4221085 AAGGAGAGGCAGGAGGGCAATGG - Intergenic
925548288 2:5041746-5041768 AAGGGGAAGGAGAAGGGGAAGGG - Intergenic
925611676 2:5706762-5706784 AAGGGCGGGCAGGTGGGGCACGG + Intergenic
925635179 2:5935646-5935668 ATGGGGATGGGGCAGGGGCAGGG - Intergenic
925933851 2:8734149-8734171 AAGGGGAGGCAGCAGGAGTGGGG + Intronic
926085346 2:10016408-10016430 AATAGGATGTAGCAGGGGCAGGG + Intergenic
926436997 2:12848489-12848511 AAGCAGAGTCACCAGGGGCAAGG - Intergenic
927235346 2:20868545-20868567 AAGTGGAGGTGGCAGGGCCAGGG + Intergenic
927473908 2:23397410-23397432 TGGGGGAGGCAGCAGGGGTGGGG + Intronic
927704443 2:25288324-25288346 CTGGGGAGGCAGCAGGAGAATGG + Intronic
927809528 2:26173603-26173625 ACGGGGCGGGAGCAGGGGCTCGG - Intronic
927900828 2:26817111-26817133 AAGGGGAGGGAGCCTGGGCCTGG - Intergenic
927932845 2:27056573-27056595 AAGGAGAGACAGAAGGGACAAGG - Intronic
928037195 2:27835713-27835735 AAGGGGAGGTAGGCCGGGCACGG - Intronic
928103247 2:28451854-28451876 GAGAGGAGTCAGCAGGGGCTGGG + Intergenic
928115065 2:28540314-28540336 GAGGGGAGGCAGTGTGGGCAGGG - Intronic
928158232 2:28895383-28895405 AAGGGGGGGCAGGAGGGGGAAGG - Intronic
928308829 2:30193469-30193491 CTAGGGAGGCAGCAGGGGGAGGG - Intergenic
928600638 2:32900720-32900742 AAAGAAAGGCAGCAGGGACAAGG + Intergenic
928858379 2:35827572-35827594 AAGGGGCAGGGGCAGGGGCAGGG - Intergenic
928921364 2:36531711-36531733 AAGAGGAGGAAGAAGCGGCAAGG - Intronic
929222457 2:39478492-39478514 ATGGGGAGGAAGCAGGGGTATGG + Intergenic
929347230 2:40899666-40899688 AAGGAGAAGCATCAGGGGTAAGG - Intergenic
929481229 2:42310323-42310345 AAGGGGAAGGAGAAGGGGAAGGG - Intronic
929983109 2:46699224-46699246 AAGGGGAGGCGGCAGGGAAGGGG + Intronic
930405892 2:50955024-50955046 AAGGGAAAGAAGCAGGTGCAGGG + Intronic
930717799 2:54609076-54609098 AAGGGGAGGCAGAAGAGGCAGGG + Intronic
931502203 2:62881461-62881483 AAGGGGAAGGAGAAGGGGAAGGG + Intronic
931669118 2:64630831-64630853 ACTGGAAGACAGCAGGGGCAGGG + Intergenic
931855706 2:66299737-66299759 GAGGGGAGCCAGCATGGGGAGGG + Intergenic
932024168 2:68116745-68116767 CAGGGCAGGCAGCTGGGCCAGGG - Intergenic
932220808 2:69997595-69997617 AGGAGGACGCAGCTGGGGCAGGG - Intergenic
932257850 2:70302222-70302244 AAAGGCAGGCAGCAGCCGCAGGG - Intergenic
932334609 2:70922834-70922856 GAGAGGAGGCTGCAGTGGCAGGG + Intronic
932476468 2:72009356-72009378 AATGGGTGGGGGCAGGGGCAGGG + Intergenic
932610018 2:73191950-73191972 CAGGGGAAGCAGGAGGGGCAGGG + Intergenic
932736490 2:74258054-74258076 AAGTGGAGTCAGCAGGGCCCTGG - Intronic
932784883 2:74591519-74591541 TGGGGGAGGGAGCAGGGGAATGG + Intronic
932830022 2:74980325-74980347 ATGCTGAGGCAGAAGGGGCATGG + Intergenic
933250632 2:80024964-80024986 AAGGGGAGCTGGAAGGGGCAAGG + Intronic
933936573 2:87208936-87208958 GAGGGGAGGGAGGAGGGGAAGGG - Intergenic
933947466 2:87299002-87299024 AAGGAGAGACAGAAGGGGCATGG - Intergenic
934173321 2:89557983-89558005 GAGGGGCGGATGCAGGGGCAGGG + Intergenic
934173535 2:89559456-89559478 AAGAGGAAGCAGCAAGTGCAAGG - Intergenic
934283636 2:91632336-91632358 GAGGGGCGGATGCAGGGGCAGGG + Intergenic
934283849 2:91633809-91633831 AAGAGGAAGCAGCAAGTGCAAGG - Intergenic
934502257 2:94870422-94870444 AAGAGGAGGCCGGAGGGGCTGGG + Intergenic
934563930 2:95328056-95328078 AGGGGAAGAGAGCAGGGGCAAGG + Intronic
934942649 2:98513764-98513786 AGGGAGGGGCAGCAGGGACAAGG - Intronic
934951812 2:98580703-98580725 ATGGGGAGGCAGGAGGCCCAGGG - Intronic
934983809 2:98869677-98869699 AAGGCGAGGCAGGAGGGGCCGGG - Intronic
935138819 2:100333142-100333164 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
935199316 2:100842543-100842565 AAGAGGAGGCAGCTGGGTCAGGG - Intronic
935326734 2:101944312-101944334 ACGGGGAGAGAGTAGGGGCATGG + Intergenic
935483587 2:103624045-103624067 ACTGGGAGGAAACAGGGGCAGGG - Intergenic
935958172 2:108399242-108399264 ATGGGGAGGTAGCAAGGGGATGG - Intergenic
936154106 2:110037169-110037191 AAGGGGAAGAAGCAGAGGGAGGG - Intergenic
936172110 2:110185602-110185624 AAGGGGAGGCAGCAGCTGCCTGG - Intronic
936190578 2:110334246-110334268 AAGGGGAAGAAGCAGAGGGAGGG + Intergenic
936332729 2:111562565-111562587 AAGGAGAGACAGAAGGGGCATGG + Intergenic
936356571 2:111756890-111756912 GAGGGGAGGGAGGAGGGGAAGGG + Intergenic
936496560 2:113027281-113027303 AGGGGGAGGCAGGAGAAGCAGGG + Intronic
937260020 2:120579374-120579396 AAGGAGGGGCAGCGAGGGCAGGG + Intergenic
937508898 2:122570722-122570744 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
937784448 2:125878667-125878689 AAGCAGGGGAAGCAGGGGCATGG + Intergenic
937993628 2:127677590-127677612 AAGGGGAGGTGGCAGGTGGAGGG + Intronic
938043413 2:128095383-128095405 AAGGGGAAGGAGAAGGGGAAGGG - Intronic
938092191 2:128441213-128441235 AAGGGTAGGCAGGCAGGGCAGGG - Intergenic
938092532 2:128442812-128442834 AAGGTGAGGCAGCCAGGGAAAGG + Intergenic
938219640 2:129554480-129554502 AATGGGAGGAAGAAGAGGCAGGG - Intergenic
938386404 2:130870218-130870240 CAGGGTAGGCTGAAGGGGCAAGG + Intronic
938804084 2:134789687-134789709 GAGGGGTGGGGGCAGGGGCAGGG + Intergenic
938970219 2:136424707-136424729 CAGGGGAGGCAGCAGGACGAAGG + Intergenic
939616964 2:144372664-144372686 TATGGGAGGCAGCCGAGGCAGGG - Intergenic
939956189 2:148529453-148529475 AAGGAGAGGCTGAAGGTGCACGG - Intergenic
940134932 2:150425255-150425277 AACCGGAGGCAGGAGGGGCCAGG + Intergenic
940859958 2:158761200-158761222 GAGAGGAGGCAGCAGTGGCCAGG + Intergenic
941044035 2:160652643-160652665 AAGTGGAGGAAGGTGGGGCATGG - Intergenic
941071206 2:160956495-160956517 CAGGGGGTGGAGCAGGGGCAGGG - Intergenic
941234024 2:162946629-162946651 AAGGGGAAGGAGAAGGGGAAGGG + Intergenic
942164565 2:173229681-173229703 AAAGGAAGGCAGCAGCTGCATGG - Exonic
942228063 2:173834203-173834225 CAGGGGAGGCAGCTAAGGCAAGG - Intergenic
942415877 2:175758883-175758905 AAAGGGAGGGAGCAGGGTGAGGG - Intergenic
944586640 2:201178869-201178891 AATGGGAGGCAGAAGGGGGCAGG + Intergenic
944643576 2:201754518-201754540 AAGGAAGGGCAGCTGGGGCACGG - Exonic
944669848 2:201985569-201985591 AAGGGCAGGCAGCGGGGGTGAGG - Intergenic
944972132 2:205005121-205005143 AAGGGGAGGAAGACAGGGCAAGG - Intronic
945035026 2:205697200-205697222 GAGGGGAGGCAGGAAAGGCAGGG + Intronic
945038693 2:205726407-205726429 ACAGGGAGGCATCAGGGACATGG + Intronic
945428774 2:209739795-209739817 AAGGGGAGTCAGAAAGGACAAGG + Intergenic
945931159 2:215855819-215855841 AAGAGGAAGCATCAGGGGTAAGG + Intergenic
946142879 2:217706564-217706586 AAGGGGAGGAGGAAGGGGAAGGG + Intronic
946142891 2:217706594-217706616 AAGGGGAGGAGGAAGGGGAAGGG + Intronic
946142899 2:217706612-217706634 AAGGGGAGGAGGAAGGGGAAGGG + Intronic
946142907 2:217706630-217706652 AAGGGGAGGAGGAAGGGGAAGGG + Intronic
946142915 2:217706648-217706670 AAGGGGAGGAGGAAGGGGAAGGG + Intronic
946160461 2:217832609-217832631 TGGGGAAAGCAGCAGGGGCAGGG - Intronic
946335827 2:219035911-219035933 CAGGGAAGGCTTCAGGGGCAGGG - Intronic
946407409 2:219498955-219498977 GAGGGGTGGCGGCAGGGGTAAGG + Exonic
946414533 2:219533132-219533154 AAGTGGAGGCAGCAGGGTGGGGG + Intronic
946482887 2:220073811-220073833 AAGGGGAGGCAGAAGGAAAATGG + Intergenic
947190967 2:227504152-227504174 GAGGGGAGGCGGAAGAGGCAGGG + Intronic
947445095 2:230157167-230157189 AAGAGAAAGCAGCAGGGGGAAGG - Intergenic
947491463 2:230598759-230598781 GAGGGGAGGGAGGAGGGCCAGGG + Intergenic
947511011 2:230754397-230754419 AAGGGGAAGAAGGAGGGGAAGGG - Intronic
947511024 2:230754433-230754455 AAGGGGAAGAAGGAGGGGAAGGG - Intronic
947523674 2:230865981-230866003 AAGTGGAGGAAGCCGGGGTAGGG - Intronic
947642790 2:231716335-231716357 CAGGGTAGGCAGCAGGGCCCTGG - Intergenic
947678756 2:232010254-232010276 AAAGGGAGGGGGCAGGGGAAAGG - Intronic
947698861 2:232215996-232216018 AAGAGGAGGAAGCAGGGCAAAGG - Intronic
948192504 2:236070778-236070800 GCGGGGAGGCATCAGGGGGATGG + Intronic
948344335 2:237282673-237282695 AAGGGGAAGGAGAAGGGGAAGGG + Intergenic
948344349 2:237282703-237282725 AAGGGGAAGGAGAAGGGGAAGGG + Intergenic
948396311 2:237647726-237647748 AGGTGGAGGGAGCAGGAGCAGGG + Intronic
948396330 2:237647789-237647811 AGGTGGAGGGAGCAGGGGCAGGG + Intronic
948430069 2:237913182-237913204 AAGCGGAGGAAGCTGGGGCCTGG - Intergenic
948586107 2:239020764-239020786 AGAGGGAGGCAGGAGGGGGACGG - Intergenic
948687316 2:239677414-239677436 GAGGAGACGCAGCAGGGACAAGG - Intergenic
948889422 2:240899782-240899804 AAGGGGAGGCCGCAGGGGCCGGG - Intergenic
948902023 2:240960903-240960925 AACTGGGGGCAGCAGGGGGAGGG + Intronic
948949099 2:241237239-241237261 TAGGGGAGACAGAAAGGGCAAGG + Intronic
1168831287 20:846551-846573 AAAGGGAGCCTGCAGGGGAAAGG + Intronic
1168904345 20:1391813-1391835 AAGGGGAAGGAGGAGGGGGAGGG + Intronic
1168914609 20:1475887-1475909 AAAGGGCTGCAGCAGGGGCAAGG + Exonic
1169178619 20:3542548-3542570 AAGGGGAGGTGGAAGGGGGAAGG - Intronic
1169216456 20:3797124-3797146 GGGTGGAGGGAGCAGGGGCATGG - Intronic
1169440128 20:5626927-5626949 AAGGGGAGCCAGAAGGGGGATGG - Intergenic
1169705912 20:8504573-8504595 AAGAGGAGGAAGTTGGGGCAGGG - Intronic
1170398422 20:15953207-15953229 AAGGGGAGGGGGAAGTGGCAGGG + Intronic
1170651320 20:18245270-18245292 CAGGAGAGCCAGCAGGAGCAGGG + Intergenic
1170710312 20:18784782-18784804 AAGGGGAGGCAGCAGAGCAGTGG + Intergenic
1171024765 20:21619803-21619825 GAGGGGAGGCAGAAGTGGAAAGG + Intergenic
1171085830 20:22237438-22237460 AAGGGGAAGGAGGAGGAGCAGGG - Intergenic
1171245831 20:23608767-23608789 AAAGGAAGACAGCAGGGGCAGGG + Intergenic
1171415787 20:24979635-24979657 CAAGGGAGGGAGCAGGGGCGAGG - Intronic
1171558469 20:26098586-26098608 AAGGGGAGGTTACAGGGGCTGGG + Intergenic
1172409666 20:34711680-34711702 TGGGGGAGACAGAAGGGGCAGGG + Exonic
1172519304 20:35556888-35556910 AAGGGGAAGGAGCAGGGGTGGGG + Intronic
1172815880 20:37685522-37685544 TAGGTAAGGCAGCAGTGGCAAGG + Intergenic
1173002048 20:39111647-39111669 AAGGGGAGGAGGAAGGGGGAGGG + Intergenic
1173010341 20:39176355-39176377 AGGGGGAACCAGCAGGTGCAAGG - Intergenic
1173423907 20:42926664-42926686 ACGGGGAGGAAGCAGAGGCTGGG - Intronic
1173667748 20:44774842-44774864 ATGGAGAGGCAGCAGACGCAAGG - Intronic
1173805577 20:45922773-45922795 AAGGTGAGGTAGAAGGGGCCTGG - Intergenic
1174067078 20:47873327-47873349 AAGAGGAGACAGCTGGGGCCTGG + Intergenic
1174075578 20:47933387-47933409 AAGGTGAGGGGGCAGGGGCCAGG + Intergenic
1174078762 20:47956482-47956504 GAGCGGAGTCAGCAGGGGGAGGG + Intergenic
1174449370 20:50610039-50610061 CAGGGGAGGCAGGGGAGGCAGGG - Intronic
1174531983 20:51221647-51221669 AAAGGGAGGTAGCAAGTGCAAGG + Intergenic
1174709522 20:52690257-52690279 AAGGGGAAGGAGAAGGGGAAAGG - Intergenic
1175131736 20:56794553-56794575 AAGGGGAGCGGGGAGGGGCATGG - Intergenic
1175379794 20:58554881-58554903 AAGGGGAGGCAGAAAGAGCTGGG + Intergenic
1175412203 20:58777739-58777761 CAGGGCAGGCAGCAGGGGCCAGG - Intergenic
1175491122 20:59381765-59381787 AAGGCAAGGCAGCAGGGCCAAGG + Intergenic
1175605906 20:60312011-60312033 AAGGGGAGGCAGCAGGAGGCAGG + Intergenic
1175723704 20:61302867-61302889 AAAGGGAGGCCGGAGGGTCAAGG + Intronic
1175839155 20:62015662-62015684 AAGGGGAGGAAGGAGAGGCTGGG - Intronic
1175892808 20:62322912-62322934 CAGGGGAGGCAGCTGGGGAGTGG - Intronic
1175950538 20:62581073-62581095 AGGGGGAGGCAGCTGGGCCTGGG - Intergenic
1176086292 20:63296994-63297016 AAGAGGGGGCGGCAGGGGCCTGG - Intronic
1176104487 20:63379521-63379543 GAGGCCAGGCAGCGGGGGCAGGG - Intergenic
1176124498 20:63469461-63469483 GAGCGGGGGCAGCAGGGGCCTGG + Intronic
1176195781 20:63835899-63835921 CAGGGGAGAGGGCAGGGGCAGGG + Intergenic
1176195795 20:63835937-63835959 CAGGGGAGAGGGCAGGGGCAGGG + Intergenic
1176195809 20:63835975-63835997 CAGGGGAGAGGGCAGGGGCAGGG + Intergenic
1176195823 20:63836013-63836035 CAGGGGAGAGGGCAGGGGCAGGG + Intergenic
1176195847 20:63836078-63836100 CAGGGGAGAGGGCAGGGGCAGGG + Intergenic
1176195863 20:63836122-63836144 CAGGGGAGAAGGCAGGGGCAGGG + Intergenic
1176195876 20:63836160-63836182 CAGGGGAGAGGGCAGGGGCAGGG + Intergenic
1176195890 20:63836198-63836220 CAGGGGAGAGGGCAGGGGCAGGG + Intergenic
1176195932 20:63836312-63836334 CAGGGGAGAAGGCAGGGGCAGGG + Intergenic
1176195950 20:63836362-63836384 CAGGGGAGAGGGCAGGGGCAGGG + Intergenic
1176195982 20:63836453-63836475 CAGGGGAGCGGGCAGGGGCAGGG + Intergenic
1176239173 20:64067995-64068017 AAGGGGAGGCAGAGGAGGGAGGG - Intronic
1176270518 20:64233451-64233473 AAGGGGAGGAAGGTGGGGGAAGG - Intronic
1176379195 21:6103349-6103371 CAGAGGCAGCAGCAGGGGCAGGG + Intergenic
1176379201 21:6103367-6103389 CAGGGGCAGCAGCAGGGGCAGGG + Intergenic
1176379221 21:6103421-6103443 CAGGGGCAGCAGCAGGGGCAGGG + Intergenic
1176623757 21:9074745-9074767 AAGAGGAGGCCGGAGGGGCTGGG - Intergenic
1176673326 21:9754028-9754050 AAGTGAAGGCAGAAGAGGCAAGG - Intergenic
1176863791 21:14030457-14030479 AGGGGCTGGCAGCAGGGTCAGGG - Intergenic
1176866432 21:14057195-14057217 AAGGGTAGGGGGCAGGGTCAGGG + Intergenic
1177114866 21:17073349-17073371 AAGGGGAAGGAGAAGGGGAAGGG + Intergenic
1177114953 21:17074043-17074065 AAGGGGAGCTAGCACGTGCAGGG - Intergenic
1178303077 21:31468896-31468918 CTGGGGAGGCACCACGGGCAGGG + Intronic
1178422361 21:32452707-32452729 ATGGGGAGCCAGAAGGGGGATGG + Intronic
1178594499 21:33940864-33940886 CAGGGGAGGCAGCTGGTGCCAGG + Intergenic
1178723048 21:35027122-35027144 AAGGGCAGGGTGGAGGGGCAGGG + Intronic
1178824649 21:36004998-36005020 AGGGGGAGGCAGGGGGGGCAGGG + Intergenic
1178834776 21:36087703-36087725 AAGGGCAGGCAGCTGAGGTATGG - Intergenic
1179007579 21:37529028-37529050 ATGGGGAGACAGCAGGGGAGGGG - Intergenic
1179095916 21:38314340-38314362 ATGGGGAGTCAGAAGGGGGATGG - Intergenic
1179118977 21:38525258-38525280 AAGAGGTGGCAGGAGGGGCGCGG - Intronic
1179468973 21:41597954-41597976 AAGGCGGGGCAGCTGGGGCCTGG - Intergenic
1179646925 21:42781940-42781962 GAGGGGAGGGAGGAGAGGCAGGG - Intergenic
1179744252 21:43434816-43434838 CAGGGGCAGCAGCAGGGGCAGGG - Intergenic
1179744272 21:43434870-43434892 CAGGGGCAGCAGCAGGGGCAGGG - Intergenic
1179744278 21:43434888-43434910 CAGAGGCAGCAGCAGGGGCAGGG - Intergenic
1179801909 21:43815200-43815222 AGGGCGTGGCAGCAGGGGAAAGG + Intergenic
1179873281 21:44254508-44254530 AGGAGGCGGCAGCAGGGGCTGGG - Intronic
1180413986 22:12692906-12692928 GCTGGGAGGCGGCAGGGGCACGG + Intergenic
1180699026 22:17771834-17771856 AAGGGGAAGCTTCCGGGGCAGGG - Intronic
1180708302 22:17822981-17823003 AAGGGGAGGCAGCAGAGGATGGG - Exonic
1180800684 22:18630539-18630561 CAAGGGAGGCAGCAGGGTCTTGG - Intergenic
1180851916 22:19026096-19026118 CAAGGGAGGCAGCAGGGTCTTGG - Intergenic
1180938295 22:19640304-19640326 AATGGTAGGCGCCAGGGGCAAGG - Intergenic
1180971947 22:19820453-19820475 AAGGGTCCGCAGCAAGGGCAGGG - Intronic
1181021374 22:20105181-20105203 AAGAAGAGGGAGGAGGGGCAGGG + Intronic
1181034814 22:20164802-20164824 CAGGGGTGGGAGGAGGGGCAGGG + Intergenic
1181038939 22:20182894-20182916 AAGGGGAGGCAGGGGTGGGAGGG + Intergenic
1181044462 22:20207948-20207970 AGGGGGACGGGGCAGGGGCAGGG - Intergenic
1181109379 22:20592258-20592280 CAGGGTGGGCAGCTGGGGCAGGG + Intergenic
1181221035 22:21364723-21364745 CAAGGGAGGCAGCAGGGTCTTGG + Intergenic
1181239370 22:21468262-21468284 ACGGGGAGGCAACAAGGGCGAGG - Intergenic
1181305992 22:21917595-21917617 AAAGCAAGGCAGCAGGGGCCGGG - Intergenic
1181473110 22:23152842-23152864 AAAGGGAGGCTGCAGGAGCTCGG - Intronic
1181534356 22:23534013-23534035 AAGGGAAGGCAGGAGGGAGAGGG + Intergenic
1182041458 22:27241838-27241860 AGAGGGAGGCACCAGGAGCAGGG + Intergenic
1182520315 22:30881211-30881233 GGGGGTAGGCAGAAGGGGCAGGG + Intronic
1182598943 22:31444614-31444636 TGATGGAGGCAGCAGGGGCAGGG + Exonic
1182626182 22:31648221-31648243 CAGGGGACGCAGCAGGAACATGG + Intronic
1182667914 22:31972620-31972642 AAGGGGAGACAGCCTGGACATGG + Intergenic
1182709633 22:32312428-32312450 TATTGGAGGGAGCAGGGGCAAGG + Intergenic
1182910621 22:33981231-33981253 CAGGAGAGGCAGATGGGGCAGGG - Intergenic
1182910751 22:33982131-33982153 AAGGGGAGACATCTGGGGAATGG - Intergenic
1183049689 22:35250734-35250756 AAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1183306124 22:37084158-37084180 AAGGGGAGCGAGCAGAGGCTGGG - Intronic
1183339871 22:37274199-37274221 AAGGGGGAGCAGCAGAGGGATGG - Intergenic
1183725473 22:39586840-39586862 GAAGGGAGGCATCAGAGGCACGG + Intronic
1183784907 22:40023666-40023688 AGAGAGCGGCAGCAGGGGCAGGG - Intronic
1184256519 22:43290130-43290152 AAGGGCAGGCATCTGAGGCAGGG - Intronic
1184313022 22:43660709-43660731 ATGGGGAGGCATGAAGGGCAAGG - Intronic
1184387567 22:44185096-44185118 AAGGGAAGGCAACAGCGTCATGG - Intronic
1184397191 22:44249284-44249306 TACTGGAGGGAGCAGGGGCAAGG + Exonic
1184469872 22:44690351-44690373 AGGGGGAGGGAGGAGGGCCAGGG + Intronic
1184652596 22:45925962-45925984 CAGGGGAGGGAGGAGGGGGAGGG - Intronic
1184733310 22:46382867-46382889 AACGGTAGGCACCAGGGGCTGGG + Intronic
1184741256 22:46430207-46430229 GAGGGTGGGCAGCAGCGGCATGG + Intronic
1184939410 22:47750218-47750240 CAAGGGAGGCAGCAGAGCCAGGG + Intergenic
1184946978 22:47810774-47810796 AAAGGGAAGCAGGAGGGCCAAGG - Intergenic
1184955990 22:47886251-47886273 AAGGGGCGACAGCAAGGGGATGG + Intergenic
1185006286 22:48278732-48278754 AGGGTGAGGCAGCAGGGCAAAGG + Intergenic
1185106384 22:48872171-48872193 ATGGGGAGGCAGGAGGGACAGGG - Intergenic
1185305708 22:50114695-50114717 GAGGGCGGGCAGCAGGGGCCAGG + Intronic
1185330590 22:50250534-50250556 ATGGGCAGGCAGGAGAGGCAGGG + Intronic
1185402461 22:50626017-50626039 CAGGGTAGGCAGCAGGTCCAGGG + Exonic
1185414846 22:50704364-50704386 AAGCGGGAGCCGCAGGGGCAAGG - Intergenic
949281505 3:2352605-2352627 AAGGGGAGGCAGCAGAGGCCCGG - Intronic
949292769 3:2485123-2485145 ACGGGGAGGCAGCTGAGGCCTGG - Intronic
949327958 3:2888386-2888408 AAGGGGCAGCATCAGGTGCATGG - Intronic
949611973 3:5712082-5712104 AAGTGGAGGAAGCACTGGCAGGG - Intergenic
949719762 3:6975065-6975087 AAGGGTTGGCATCAGGAGCAAGG + Intronic
949830770 3:8211793-8211815 AAACGGAGGCAGAAGGGGCAAGG + Intergenic
949872032 3:8597021-8597043 CAGTGGAGGGAGAAGGGGCAAGG - Intergenic
950138377 3:10599170-10599192 AAGGTTATTCAGCAGGGGCAGGG - Intronic
950482129 3:13250804-13250826 GAGGGGTGGCAGCAGGGGTGGGG - Intergenic
950544351 3:13629791-13629813 GAGGGCAGGCAGCAGGTACAGGG - Intronic
950601243 3:14037413-14037435 GCGGGGAGGCAGCTGGGGCCCGG - Intronic
950718883 3:14868440-14868462 AAGGTGAGGCTACAGGTGCAAGG - Intronic
950744223 3:15074109-15074131 AGGAGGAGGAAGCAGTGGCAGGG - Exonic
950829439 3:15859682-15859704 TAGGGCAGGCAGCAGAGGGAAGG - Exonic
951551305 3:23877970-23877992 AAGGGGCAGAGGCAGGGGCAGGG - Intronic
951551867 3:23882681-23882703 ACGGGGAGGCAGCTGAGGCCTGG + Intronic
951720202 3:25689707-25689729 CCTGGGAGGCAGCAGGGGCCAGG + Intergenic
952284040 3:31950665-31950687 AAGGGGAGGCACTTGGGTCATGG + Intronic
953119720 3:40027815-40027837 AAGGGGTGGCAAGATGGGCAGGG + Intronic
953680516 3:45035228-45035250 AAGGGGTGTCAGCTGGGGCTGGG + Intronic
953818943 3:46187741-46187763 AATGGGAAGCAGCAGAGGCCTGG + Intronic
953888935 3:46736287-46736309 AAGGTAAGGCTTCAGGGGCATGG - Exonic
953983016 3:47422122-47422144 AGGAGGAGGCTGCAAGGGCATGG - Intronic
954036025 3:47851701-47851723 GAGGGGAGGGAGGAGAGGCAAGG - Intronic
954291661 3:49653161-49653183 AAGGCCAGGCAGCAGGGGCCCGG + Exonic
954407254 3:50352072-50352094 TAGGGGTGGGAGCATGGGCATGG + Intronic
954411579 3:50373518-50373540 AGGGGGAGGGAGGAGGGGGATGG + Intronic
954574405 3:51667682-51667704 AAGAGTTGGCAGCAGGGGAACGG - Exonic
954731948 3:52671406-52671428 AAAAGGAGGCAGCAGAGGGACGG + Intronic
954855573 3:53641128-53641150 AAGGGGCATCAGGAGGGGCAGGG + Intronic
955510978 3:59679938-59679960 CAGCAGGGGCAGCAGGGGCAGGG - Intergenic
955569219 3:60286031-60286053 AGGGGGAGGAAGCAGGGGTGGGG + Intronic
955758250 3:62249297-62249319 GAGGGCAGACAGGAGGGGCAGGG + Intronic
955937266 3:64113513-64113535 ATGGGGAGGGAGCATGTGCATGG - Intronic
956181141 3:66519145-66519167 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
956214210 3:66831833-66831855 AAGGGTGGGCAGAAGGGGGAAGG - Intergenic
956390830 3:68771106-68771128 ATGGGGAGTCAGAAGGGGGATGG - Intronic
956567395 3:70654278-70654300 ATGGGGATGCCACAGGGGCAAGG + Intergenic
956975787 3:74576967-74576989 AAGGAGAGGCAGCAGTGACTTGG + Intergenic
957350049 3:79012900-79012922 AAGTGGAGGGAGAAGGGGAAAGG + Intronic
957631741 3:82724727-82724749 AGAGGGAGGCAGGAGGGCCAAGG + Intergenic
958001956 3:87761837-87761859 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
958002251 3:87764878-87764900 AAGGGGAGAGAGCTAGGGCAGGG - Intergenic
959584725 3:108015422-108015444 CAGGGCATGCAGGAGGGGCATGG - Intergenic
960417704 3:117405486-117405508 CTGAGGAGGCAGCAGGGGCATGG + Intergenic
960501609 3:118445051-118445073 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
960881260 3:122347973-122347995 AAGGGTAGGCGACAGGAGCAAGG - Intergenic
961037640 3:123653565-123653587 GAGGGGTGGCAGCAGGGGAGGGG + Intronic
961175855 3:124834541-124834563 GAGGGGAGGGAGCGGGGGGAGGG + Intronic
961202274 3:125054978-125055000 AAGGGGAGGGAGGAGGCTCAGGG + Intronic
961688131 3:128649772-128649794 AATGAGAAGCAGCAGGGGGAAGG + Intronic
961700775 3:128743067-128743089 ACGGGGAGGCAGCTGAGGCCTGG + Intronic
961819293 3:129567064-129567086 AAGGGGAGGCATGAGAGGCATGG + Intronic
961880221 3:130056495-130056517 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
962134752 3:132722188-132722210 CGGGGGCGGCAGCAGGGGCCGGG - Exonic
962272980 3:133991726-133991748 GAGGGGAGGCTGCAGGGGGCCGG + Intronic
962383214 3:134913240-134913262 TAGTGGAGGCTGCAGGGGCATGG + Intronic
962415392 3:135177421-135177443 CAGGGGAGGCTCCAGGGCCAGGG - Intronic
962591058 3:136890143-136890165 ACGGGGAGGCAGCTGAGGCCCGG + Intronic
962600719 3:136989059-136989081 AAGTGGTGACAGGAGGGGCATGG + Intronic
962875238 3:139530975-139530997 CAGGGCAGGCAGCAGGGACAAGG + Intronic
962948990 3:140200800-140200822 AAGAGGAGGCAGGTGGGGGAGGG - Intronic
963071280 3:141307457-141307479 AAGGGGAGGGAGAGGTGGCAGGG + Intergenic
963860907 3:150309278-150309300 AAGGGGAAGCATCAGGGACATGG - Intergenic
963989026 3:151631824-151631846 AAGGAGAGGCAGGAGGAGCCAGG + Intergenic
964669466 3:159209345-159209367 AAGGGGAGCCGGAAGGGGGATGG - Intronic
964720198 3:159763149-159763171 AAGGGGATGCGGCGGCGGCAAGG + Intronic
964756103 3:160092094-160092116 AAGGTCAGACAGCAAGGGCAGGG - Intergenic
965144941 3:164889587-164889609 AAGGGGAGGCAAGAGTGGGAAGG - Intergenic
965634314 3:170766195-170766217 AAGGGGAGACAGGAGTGGCTGGG - Intronic
966060541 3:175749208-175749230 AAGGGGAGGGAGAGGGGGTAGGG + Intronic
966402794 3:179563667-179563689 AAGGTGAGGCAGCTCGCGCATGG - Intronic
966446988 3:180011760-180011782 AAGGGAAGGGAGCAGGAGGAAGG - Intronic
966566892 3:181392968-181392990 AAGGGGAGCCTGCATGGGCTGGG + Intergenic
966862749 3:184239661-184239683 GAGGCAAGACAGCAGGGGCATGG - Intronic
967295738 3:187963054-187963076 AGGGGAAGGCAGCAGAGGAATGG + Intergenic
967317368 3:188161980-188162002 AATGGTAGAGAGCAGGGGCAGGG - Intronic
967501043 3:190197735-190197757 AAGGGGAGAAAGAAGGGGAAAGG + Intergenic
967512353 3:190326420-190326442 AAGAGAAGGCAGCAATGGCAGGG + Intronic
967954501 3:194867962-194867984 AAGGTAAGGGAGCAGGGGCTGGG - Intergenic
968261104 3:197324794-197324816 ATTGGGAGGCAGAAGGGGCCAGG + Intergenic
968261119 3:197324840-197324862 ATTGGGAGGCAGAAGGGGCCAGG + Intergenic
968534173 4:1113196-1113218 AGGGGGAGGGGGCAGGGGGAGGG - Intronic
968613612 4:1567787-1567809 GAGGGGAGGCTGGAGGGGCCGGG - Intergenic
968627103 4:1630731-1630753 GAGGGGAGGCTGCCAGGGCAGGG + Intronic
968741726 4:2334737-2334759 AAGGGGAGGGGGAAGGGGGAGGG - Intronic
968910778 4:3476056-3476078 GGGAGGAGGCAGCAGGGGCAGGG - Intronic
968992610 4:3924850-3924872 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
969432380 4:7162939-7162961 AAGGGGAGGCCGCAGTTGCGAGG + Intergenic
969571386 4:8010741-8010763 ATGGAGAGGCAGAGGGGGCAGGG + Intronic
969822741 4:9732772-9732794 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
969827395 4:9768272-9768294 AAGAGGAAGCAGCAAGTGCAAGG - Intergenic
970889561 4:21027443-21027465 AAAGGGAGGCAGGAGAGTCAGGG + Intronic
971265279 4:25091444-25091466 CAGGGGAGGAAGAAGGGGCAGGG - Intergenic
971938889 4:33189042-33189064 GAGGTGAGGCAGCAAGGGCCTGG + Intergenic
972390251 4:38607010-38607032 ATGGGGAGTCAGAAGGGGGATGG + Intergenic
972813744 4:42620664-42620686 AAGAGGAGGCAGGAGGGGTACGG - Intronic
974891912 4:67893381-67893403 TATGGGAGGCAGTAGGGGAAGGG + Intergenic
975460863 4:74651285-74651307 AGGGGGAGGGAGGAGGGGGAGGG + Intergenic
975460870 4:74651298-74651320 AGGGGGAGGGAGGAGGGGGAGGG + Intergenic
975460877 4:74651311-74651333 AGGGGGAGGGAGGAGGGGGAGGG + Intergenic
975902862 4:79173705-79173727 GAGGGGAGGAAGCATGGCCAAGG + Intergenic
977140785 4:93369235-93369257 AAGAGGAGGCAACATGGCCATGG - Intronic
977993232 4:103470016-103470038 AAGGGGAGTAAGCATAGGCAGGG + Intergenic
978310141 4:107378655-107378677 ATGGGGAGACAGTAGGGGGATGG + Intergenic
978414784 4:108463778-108463800 ATGGGGAGCCAGAAGGGGTATGG - Intergenic
979045093 4:115852444-115852466 ACTTGGAGGCAGCAGAGGCAGGG - Intergenic
979774097 4:124565984-124566006 AAGTGGAGACAGCAGTGGCAAGG - Intergenic
979851180 4:125573117-125573139 AAGGGGAGGAAAAAGGGGGAAGG - Intergenic
981782132 4:148442410-148442432 GAGAGGAGGGGGCAGGGGCAGGG + Exonic
982205583 4:152995208-152995230 GAGGTGAGGCTGCAGGGGGAAGG + Intergenic
982312726 4:154002723-154002745 AAGGTGAGGAAGCAGGGGTGTGG - Intergenic
982793758 4:159621561-159621583 AAGGGGAAGTATCAGGGGTAAGG - Intergenic
982918935 4:161249961-161249983 AAGCTGAGGCAGCAGGGGGCTGG + Intergenic
983919718 4:173333480-173333502 AAGGTGAGGCAGGAGAGGGACGG - Exonic
984958630 4:185071867-185071889 GTGGGGAGGCATCAGGGGAAAGG - Intergenic
985145447 4:186890329-186890351 GAGGGGAGGCAGCTAAGGCACGG - Intergenic
985485643 5:146705-146727 AAGGGAGGGCCGCAGGGTCAGGG - Intronic
985619245 5:945191-945213 CAGAGGAGGCAGGAGGAGCATGG - Intergenic
985652222 5:1112409-1112431 AAGGGCGTGCAGGAGGGGCAGGG - Intergenic
985654356 5:1122181-1122203 AAGGGCAGGCGGTGGGGGCAGGG - Intergenic
985670782 5:1205528-1205550 AAGGAGAGCCACCAGGAGCAAGG + Intronic
985695316 5:1336876-1336898 AGGAGGAGGCAGCAGGGCCTGGG + Intronic
985777543 5:1852619-1852641 ACGGGAGGGCAGCAGGGGCTGGG - Intergenic
985839797 5:2297928-2297950 CAGGGGAGGGACCTGGGGCAAGG - Intergenic
985898072 5:2762239-2762261 GAGGGGAGGCAGCAGGAGGCTGG + Intergenic
985950452 5:3218414-3218436 AAGGGCAGGCAACAAGGGCATGG + Intergenic
986208357 5:5647290-5647312 GAGGGGAGGAAGAAGAGGCATGG - Intergenic
986422241 5:7597210-7597232 AAGGAATGGCAGCAGGGCCAGGG + Intronic
986946669 5:13029303-13029325 AAGGGGAAGAAGAAGGGGAAGGG + Intergenic
986946681 5:13029336-13029358 AAGGGGAAGAAGAAGGGGAAGGG + Intergenic
987005705 5:13707253-13707275 ATGGGGAGCCAGAAGGGGGATGG - Intronic
987085366 5:14462855-14462877 CATGGGTGGCGGCAGGGGCACGG - Exonic
987212137 5:15693838-15693860 ATGGGGAGCCAGAAGGGGGATGG - Intronic
987816050 5:22901950-22901972 AGGCTGAGGCAGCAGGGGCTTGG + Intergenic
989163061 5:38409999-38410021 AAGGTCAGGCAGCAGGGGGTTGG - Intronic
989194931 5:38707436-38707458 AAGGGGAGGTGGGAGGGGCCGGG - Intergenic
990352642 5:54934275-54934297 ATGGGGTGGCAGCAGGGGGAAGG + Intergenic
990510441 5:56484586-56484608 ATGGGGAAGCAGGAGGGGGATGG - Intergenic
990584745 5:57200141-57200163 AAGGGAAGGAAGCAGGGGAGGGG - Intronic
990756710 5:59079883-59079905 AAGGGGAATGGGCAGGGGCAGGG + Intronic
990801358 5:59607644-59607666 TAGAGGAGGCAGCAGGGGGTAGG + Intronic
991021079 5:61980755-61980777 GAGGGCAGGTAGCAGGTGCATGG + Intergenic
991476215 5:67022536-67022558 GGAGGCAGGCAGCAGGGGCAAGG + Intronic
991731818 5:69597069-69597091 AAGGGGATGCAGGAGAGGCGTGG + Intergenic
991808250 5:70452207-70452229 AAGGGGATGCAGGAGAGGCGTGG + Intergenic
991863134 5:71030798-71030820 AAGGGGATGCAGGAGAGGCGTGG - Intergenic
992093648 5:73340611-73340633 TGGGGGAGGCAGAAGGGGGATGG - Intergenic
992159845 5:73990646-73990668 GAGGGGAGTCAGCAGGGAGAAGG - Intergenic
992191544 5:74296798-74296820 AAGGGGAGGAAGCAGGGGTCGGG - Intergenic
992597904 5:78364660-78364682 GAGGGGAGGCAGCAGAGGATAGG + Intronic
992672752 5:79076138-79076160 ATGGGGAGCCAGAAGGGGGATGG + Intronic
995042602 5:107605853-107605875 ACTGGGAGGAAGCAGGGGGAGGG + Intronic
995402343 5:111757281-111757303 AAGAGGAGGGAGGAGGGGGAAGG + Intronic
995533644 5:113114787-113114809 AAGGGGAGCTAGAAGGGGGATGG - Intronic
995569379 5:113463259-113463281 AAGGGTTGTAAGCAGGGGCAAGG + Intronic
996542131 5:124641355-124641377 AACGGGAGGCAGAAAGGGAAAGG - Exonic
997083305 5:130766149-130766171 TTGGGGAGGCAGCTGGAGCAAGG + Intergenic
997600657 5:135136175-135136197 AAGGGGAGCCAGAAGGGACTTGG + Intronic
997719453 5:136065952-136065974 AAGGAGAGGAAGAAGGGGAATGG + Intergenic
997791442 5:136766002-136766024 AAGGGGAGGAAGCAGGAGGATGG - Intergenic
998028014 5:138837501-138837523 GAGGGGAGGGAGGAGGGGGAGGG - Intronic
998170636 5:139870339-139870361 AGGAGGTGGCAGCAGGGGCAGGG + Intronic
998228486 5:140344758-140344780 AAGGGGAGGGAGAAGGTGCAGGG + Intronic
998512531 5:142725191-142725213 ACAGGGAGTCAGCAGGGGCGGGG + Intergenic
998537823 5:142951047-142951069 AAGGGGAGGGGGAAGGGGAAGGG - Intronic
999117922 5:149180765-149180787 GAGGGGATGCAGCAGGGTTAGGG + Intronic
999147322 5:149405164-149405186 AAAGGGAGGCACCGGGGGAAAGG + Intergenic
999194016 5:149769848-149769870 AGAGGGAGGCAGAAGGGTCAGGG - Intronic
999201885 5:149822492-149822514 ATGGGCAGGGAGCAGGGGCTGGG - Intronic
999241748 5:150131937-150131959 GAGGGGAAGGAGCAGGGACATGG + Intronic
1000658892 5:163915412-163915434 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1001110694 5:168893719-168893741 AGGGGGAGGTGGCAGGGGCAGGG + Intronic
1001277508 5:170361219-170361241 AAAGGCAGGCAGCAGGGGAGAGG + Intronic
1001527158 5:172437144-172437166 AAGGGAAAGCAACAAGGGCAAGG + Intronic
1001732652 5:173971908-173971930 GTGTGGAGGCAGCAGGGGGAGGG + Intergenic
1001737797 5:174021047-174021069 AAGGGGAAGCAGAAGGGGAAAGG + Intergenic
1001842219 5:174887652-174887674 AAGCAGAGGCAGCAGGAGCCAGG - Intergenic
1002044965 5:176536680-176536702 AAGTGGCGGCCGCAGGGGGAGGG + Intronic
1002046793 5:176545999-176546021 AAGGGCAGGGAGAGGGGGCAGGG + Intronic
1002331192 5:178442115-178442137 AAGAGGAGAAAGCAGGGGCCAGG - Intronic
1002475712 5:179464583-179464605 ATGGGGAGCCAGAAGGGGAATGG + Intergenic
1002519425 5:179783062-179783084 AAGGGGAGGTGGCAGAGGCCTGG - Intronic
1002526619 5:179819053-179819075 GATGGGTGGCAGCAGGGGCCGGG + Intronic
1002543959 5:179925969-179925991 AAGGGGGAGCAGCAGAGGCGAGG + Intronic
1003272915 6:4623230-4623252 AAGGGGAAGCGGCAGGGGGGCGG + Intergenic
1003335586 6:5168905-5168927 AAGGAGAGGGAGGAGGGCCAGGG + Intronic
1003392266 6:5724292-5724314 AAGAGGAGCTAGCAGGGACAAGG + Intronic
1003560843 6:7178511-7178533 AAGGGGAAGAAGCTGGTGCAAGG - Intronic
1004077924 6:12362263-12362285 AAGCAGAGGGAGCTGGGGCATGG + Intergenic
1004350098 6:14883406-14883428 AGGGGACGGCAGAAGGGGCAGGG + Intergenic
1004364613 6:15001116-15001138 GAGGGGAGGCAGGAGAGGCAGGG + Intergenic
1004462714 6:15853428-15853450 AAGGAGAAGCAGAAGGGGAAGGG - Intergenic
1004537397 6:16515807-16515829 AAGCGGATGCAGGAGGGGGATGG + Intronic
1005222424 6:23601870-23601892 AAGGGGAGCCTGCATGTGCAGGG + Intergenic
1005418023 6:25622070-25622092 AAGTGGAGGGAGCAGTAGCAGGG - Intergenic
1005577673 6:27205282-27205304 AAGAGGAAGCATCAGGGGTAAGG - Intergenic
1005893503 6:30159115-30159137 AAGGGGAGGAACCTGGGGAAGGG + Intronic
1006081937 6:31572839-31572861 CAGGTGAGGCAGCAGGAGAATGG + Exonic
1006299506 6:33186117-33186139 AAGGGGAGGTAGTAGGGGGAAGG - Intronic
1006474369 6:34245185-34245207 GTGGGGACGCAGCAGGTGCAGGG - Exonic
1006572721 6:35018680-35018702 GAGGGGAGGGAGTGGGGGCAAGG - Intronic
1006682776 6:35809065-35809087 ACAGGGAGGGGGCAGGGGCAAGG + Intronic
1006988757 6:38194844-38194866 ATGGGGAGGCAGGAGAGGCAGGG + Intronic
1007078356 6:39082136-39082158 AGGGGGAGGCCTCAGGGACAAGG - Intronic
1007187024 6:39980562-39980584 GAGGGGAGACGGTAGGGGCAGGG + Intergenic
1007216960 6:40247871-40247893 CAGGTGAGACAGCAGGAGCAAGG - Intergenic
1007236297 6:40393129-40393151 GAGGGGAGGAGGGAGGGGCAGGG + Intronic
1007380642 6:41488271-41488293 TTGGAGAGGCTGCAGGGGCAGGG - Intergenic
1007947538 6:45839711-45839733 GAGGTGATGGAGCAGGGGCAGGG - Intergenic
1008055730 6:46944160-46944182 AAGCGGGAGAAGCAGGGGCATGG + Intronic
1008913077 6:56757681-56757703 GAGGGAAGGAAGAAGGGGCAAGG - Intronic
1009615485 6:65999526-65999548 ACGGGGAGGCAGCTGAGGCCCGG + Intergenic
1010116486 6:72317205-72317227 ACGGGGTGGCAGCAGGGGACTGG + Intronic
1010398366 6:75418993-75419015 AATGGGAGGCTGCAGGGGGTGGG - Intronic
1011227723 6:85126519-85126541 AGGGGGAGCCAGCAGGAGCAAGG - Intergenic
1011744927 6:90400239-90400261 CAGGGCAGTCCGCAGGGGCATGG - Intergenic
1012175639 6:96078911-96078933 AATGGTTGGCGGCAGGGGCAAGG - Intronic
1012319046 6:97819806-97819828 AAGGGGAGGCAGAACAGGGAAGG - Intergenic
1012892171 6:104908638-104908660 AAGGGGAGGGAAGAGTGGCAAGG + Intergenic
1012980998 6:105830870-105830892 AAAGGGAGGCAGCTGGAGGAGGG + Intergenic
1013180415 6:107712561-107712583 GAGCAGAGGCAGCAGGGGCCTGG + Intronic
1013479776 6:110543734-110543756 AGGTGGAGGAAGCAGGAGCATGG + Intergenic
1013539628 6:111095144-111095166 AAGGGAGAGAAGCAGGGGCAAGG - Intronic
1014332326 6:120085504-120085526 ATGGGGAGGGGGCAGGGGGAAGG - Intergenic
1014688230 6:124530469-124530491 AATGGGAGGCAGGAGAGGTAGGG + Intronic
1015190631 6:130468006-130468028 AAGAGGAGACAGCAAGGGTAGGG + Intergenic
1016086425 6:139920635-139920657 AGGCGGGGGCGGCAGGGGCAGGG + Intergenic
1016180764 6:141145479-141145501 AAAGGGAGGCAGGAGAGGCAGGG - Intergenic
1016356804 6:143227380-143227402 ATGGGGATGAAGGAGGGGCACGG - Intronic
1016833689 6:148456218-148456240 AAAGTGAGGCAGCAGGGGGCTGG - Intronic
1017980135 6:159394173-159394195 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1018272008 6:162089880-162089902 GAGGGAAGTGAGCAGGGGCATGG + Intronic
1018573313 6:165233235-165233257 CAGGGGCTGCAGCTGGGGCAGGG + Intergenic
1018893437 6:167997593-167997615 AAGGGGCAGGGGCAGGGGCAGGG - Intronic
1018953644 6:168394074-168394096 AAGCGGCAGCAGGAGGGGCAGGG - Intergenic
1019163867 6:170086704-170086726 AAGGGGCGGCAGGAGGGATAGGG + Intergenic
1019178610 6:170173796-170173818 AGGGAGAGGAAGAAGGGGCAGGG + Intergenic
1019294153 7:265114-265136 TAGGAGGGGCAGGAGGGGCAGGG + Intergenic
1019346040 7:531307-531329 AAGGGGAGGCTGGAGGGTCTGGG + Intergenic
1019363428 7:617741-617763 AAGGGGTGGCAGCAGGCACTAGG + Intronic
1019508355 7:1404804-1404826 GAGGGGAGGGAGGAGGGGGAAGG + Intergenic
1019508370 7:1404838-1404860 GAGGGGAGGGAGGAGGGGGAAGG + Intergenic
1019508385 7:1404872-1404894 GAGGGGAGGGAGGAGGGGGAAGG + Intergenic
1019508400 7:1404906-1404928 GAGGGGAGGGAGGAGGGGGAAGG + Intergenic
1019515443 7:1437986-1438008 GAGAGGAGCCAGCTGGGGCAGGG + Intronic
1019556185 7:1632726-1632748 GGGGGGAGGCAGAAGAGGCAAGG - Intergenic
1019599270 7:1873353-1873375 AGAGGGTGGGAGCAGGGGCAGGG + Intronic
1019637178 7:2082160-2082182 GAAGGGAGGCAGGAGGGGGAGGG + Intronic
1019716013 7:2539720-2539742 GGGTGGAGGCAGCAGGGGCTGGG - Intronic
1019772323 7:2891472-2891494 AAGAGGAGGGAGGCGGGGCACGG - Intergenic
1019777110 7:2918450-2918472 CTGTGGGGGCAGCAGGGGCAGGG - Intronic
1019891931 7:3954327-3954349 GAGGGGAGGCAGGAGGGGAGGGG - Intronic
1019891944 7:3954358-3954380 GAGGGGAGGCAGGAGGGGAGGGG - Intronic
1019891980 7:3954448-3954470 GAGGGGAGGCAGGAGGGGAGGGG - Intronic
1019959826 7:4449804-4449826 AGGGGGCAGCAGCAGGAGCAGGG - Intergenic
1020188118 7:5974198-5974220 GCAGGGAGGCAGCAGGGCCAGGG - Intronic
1020294800 7:6750571-6750593 GCAGGGAGGCAGCAGGGCCAGGG + Intergenic
1020315256 7:6901206-6901228 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1020496192 7:8855706-8855728 CAGAGGATGCAGCAGTGGCAAGG + Intergenic
1020574759 7:9912894-9912916 AAGGGGAGGCAAGAGTGGGAAGG - Intergenic
1020860389 7:13485569-13485591 AAGGGAAGGCTGCAGAGGAAAGG - Intergenic
1021953186 7:25796195-25796217 CAGGGGAGGCCACAGGGGGAGGG + Intergenic
1022274423 7:28841817-28841839 AAGGGGAAGGAGAAGGGGAAGGG + Intergenic
1022357052 7:29625786-29625808 AAGGGGAAGGAGAAGGGGAAGGG + Intergenic
1022515162 7:30970599-30970621 AAGGGAAGGGAGCAGGGGCCTGG - Intronic
1022820610 7:33956542-33956564 AAGGGGAGACAGGAGAGGCAGGG - Intronic
1022963676 7:35454085-35454107 ATGGGTAGGAAGCAGAGGCAGGG - Intergenic
1022976204 7:35558889-35558911 AAGGGGAGGCTGGAGAGGAAAGG - Intergenic
1022992760 7:35724910-35724932 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1023225112 7:37960912-37960934 AGGGGGTGGCTGCAGGGGAATGG + Intronic
1023362312 7:39429519-39429541 AAGAAGATGCAGCTGGGGCAGGG - Intronic
1023867839 7:44247241-44247263 AAGAGGAGGCACTGGGGGCAGGG + Intronic
1023908914 7:44540431-44540453 AAGGACATGGAGCAGGGGCAGGG + Intronic
1024063515 7:45715655-45715677 ATGTGGGGGCAGCAGGGGCCTGG + Exonic
1024142731 7:46478667-46478689 AAGGGGAGAGAGGAAGGGCAGGG + Intergenic
1024524395 7:50336260-50336282 AGGGGGAGGGTGCAGGGGGAGGG + Intronic
1026272018 7:68844936-68844958 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1026285045 7:68955407-68955429 AAGGGGAAGAGGCAGGGGGATGG + Intergenic
1026741560 7:72981865-72981887 AAGGGGAGGGAGAAGGGGCAGGG + Intergenic
1026801394 7:73402249-73402271 AAGGGGAGGGAGAAGGGGCAGGG + Intergenic
1026828916 7:73600007-73600029 AAGGGGAGCCACCAGGGGGTGGG - Intronic
1026881459 7:73909147-73909169 GAGGGCTGGCAGCAGGGGGAGGG + Intergenic
1026960620 7:74405193-74405215 AGGTGGAGGCTGCAGGGCCAAGG - Exonic
1027102175 7:75383213-75383235 AAGGGGAGGGAGAAGGGGCAGGG - Intergenic
1027159772 7:75793791-75793813 AAGGGGAGGAAGGAAGGGGAAGG + Intergenic
1027397147 7:77767780-77767802 AGGGGGAGGGAGAAGGGGGAGGG - Intronic
1027590347 7:80111747-80111769 CAAGAGAGGAAGCAGGGGCAGGG - Intergenic
1028503881 7:91550181-91550203 GAGAGGAAGCAGCAGGGGCTAGG - Intergenic
1028611524 7:92717368-92717390 AAGGGGAAGGAGAAGGGGAAAGG + Intronic
1029037935 7:97541426-97541448 ATGGGGAGGCAGCTGAGGCCCGG - Intergenic
1029189648 7:98762438-98762460 TAGGGAAGGCACCAGCGGCAGGG + Intergenic
1029406175 7:100375106-100375128 AAGTGGGGGCTGCAGGGGCCAGG - Intronic
1029412873 7:100426927-100426949 AAGGGGAGGGAGGAGGGGGAGGG - Intronic
1029478356 7:100798618-100798640 TAGGGGAGACAGAAGGAGCAGGG + Intergenic
1029536516 7:101160666-101160688 AAGGTGAGGCAGCAGAGGAGGGG - Exonic
1029611601 7:101629567-101629589 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1029652962 7:101906327-101906349 GAGGTGAGGCAGGAGGAGCAGGG + Intronic
1029654741 7:101916864-101916886 AAGGGAAGGAAGAAGGGGCCAGG - Intronic
1030529775 7:110698098-110698120 ATGGGGAGGCAGCAGGGCCTGGG + Intronic
1030881194 7:114882344-114882366 AAGGGGAGGAAAGAGTGGCAAGG - Intergenic
1031060708 7:117048225-117048247 AAGGGGAGGCAGGAGAGGCAGGG + Intronic
1031232308 7:119123647-119123669 ATGGGGAGCCAGCAGGGGGATGG - Intergenic
1031442612 7:121812381-121812403 AAGGGGAGGCAAGAGTGGGAAGG + Intergenic
1031765640 7:125773358-125773380 ATAGGGAGCCAGCAGGGGGATGG - Intergenic
1031865989 7:127039624-127039646 AAGGGGAAGGAGAAGGGGAAGGG + Intronic
1031902884 7:127429387-127429409 ACGGGGAGGCAGCTGAGGCCCGG - Intronic
1032444737 7:131972482-131972504 AAGGGCAGGTCACAGGGGCAGGG - Intergenic
1032759733 7:134928783-134928805 AAGAGGAGGCAGCCCGGGAACGG + Exonic
1033231267 7:139600053-139600075 AAGAGGAAGCATCAGGGGTAAGG - Intronic
1033257736 7:139816783-139816805 GAAGGCAGGGAGCAGGGGCAGGG - Intronic
1033691387 7:143740699-143740721 AAGGGGAGGCAAGAGTGGGAAGG + Intergenic
1033804392 7:144937599-144937621 AAGGGGAAGCAGAAAGGGGAAGG - Intergenic
1034459695 7:151191618-151191640 AAGGTGAGGTGGCAGGGCCAGGG - Exonic
1034962253 7:155370209-155370231 CAGAAGGGGCAGCAGGGGCAGGG + Intergenic
1035111228 7:156483713-156483735 AGGGGGAGACAGGAGGGGGAGGG + Intergenic
1035174016 7:157037712-157037734 AAGGGGAGGGAGCCTGGGGAGGG + Intergenic
1035331318 7:158098977-158098999 AAGGGGAGGCAGCCGGGATGCGG - Intronic
1035331380 7:158099132-158099154 AAGGGGAGGCAGCCGGGTTGTGG - Intronic
1035331420 7:158099225-158099247 AAGGGGAGGCAGCCGGGATGTGG - Intronic
1035331431 7:158099255-158099277 AAGGGGAGGCAGCCGGGATGTGG - Intronic
1035331444 7:158099285-158099307 AAGGGGAGGCAGCCGGGATGTGG - Intronic
1035331457 7:158099315-158099337 AAGGGGAGGCAGCCGGGATGTGG - Intronic
1035331495 7:158099408-158099430 AAGGGGAGGCAGCCGGGATGTGG - Intronic
1035331533 7:158099501-158099523 AAGGGGAGGCAGCCGGGATGTGG - Intronic
1035331595 7:158099656-158099678 AAGGGGAGGCAGCCGGGGATGGG - Intronic
1035331633 7:158099750-158099772 AAGGGGAGGCAGCCGGGATGTGG - Intronic
1035458914 7:159027379-159027401 GATGGGAGGCAGAAGGTGCAGGG - Intergenic
1035683557 8:1507300-1507322 ACGGGGAGGCAGCTGAGGCCCGG + Intronic
1035703249 8:1653336-1653358 ACGGGGAGGCTGCAGGTGCCTGG + Intronic
1036282543 8:7414131-7414153 AAGGAGAGAGAGCAGGGCCAGGG + Intergenic
1036338929 8:7897418-7897440 AAGGAGAGAGAGCAGGGCCAGGG - Intergenic
1036552664 8:9828771-9828793 CAGGGGAGGCTGCACGGGCAAGG + Intergenic
1036601728 8:10267332-10267354 GAGGGGAGGCTGCAGTGGCTGGG + Intronic
1036718038 8:11144888-11144910 AAGGGGAAGGAGAAGGGGAAGGG + Intronic
1036796364 8:11759104-11759126 AAAGGCCGGCAGCAGGGGGAAGG - Exonic
1036830534 8:12016371-12016393 CAGGGGAGGCAGGAGAGGCTGGG + Intergenic
1037502202 8:19496977-19496999 GAGGGGAGGCGGGAGGGGGAGGG - Intronic
1037816332 8:22114668-22114690 AAGGGCAGACAGGCGGGGCAAGG + Exonic
1037816907 8:22117159-22117181 AAGGGCAGGCAGGGAGGGCATGG + Intronic
1037922672 8:22818524-22818546 CAGGGGAGGGAGCAGAGGCCAGG + Intronic
1037924208 8:22831952-22831974 AAAGGGCGGGGGCAGGGGCAGGG + Intronic
1038134832 8:24773884-24773906 AAGGGGAGGGAGAAAGGGGAGGG + Intergenic
1038446897 8:27610787-27610809 AAGCGAAGGCAGGAGGTGCAGGG + Intronic
1038471574 8:27827824-27827846 AAGGGGAAGTGGCAGGGGAAAGG - Intronic
1039457039 8:37714228-37714250 AAGGCAAGGGAGCAGGGGAACGG + Intergenic
1039468073 8:37797598-37797620 GAGGGGTGGGAGCAGGGGGAAGG + Intronic
1039714717 8:40095040-40095062 AAGGGGAGGCACCAGGAGGCAGG - Intergenic
1039757783 8:40541813-40541835 AAGTGCAGGGAGCAGGGGAAGGG + Intronic
1039884074 8:41645650-41645672 AAGGGGAGGGTGCAGGGAGAGGG - Exonic
1040289237 8:46115939-46115961 ATGGGCAGGCGGCAGGGTCAGGG - Intergenic
1041007679 8:53511045-53511067 TAGGGGAAGCAGCAGGTCCATGG + Intergenic
1041011445 8:53547598-53547620 GAGGGGAAGCAGAAGGGGAAAGG + Intergenic
1041059409 8:54021955-54021977 GACGGGAGGCTGCAGGGGGAGGG + Intronic
1041145412 8:54870940-54870962 CAGGGAAGGCAGGAGGGCCAAGG - Intergenic
1041326171 8:56667680-56667702 GAAGGGAAGCAGCAGGGGCCAGG - Intergenic
1041794196 8:61729106-61729128 AAGGGCAGGGAGCAGGAGTAGGG + Intergenic
1042292038 8:67178804-67178826 GAGGGGAGGCAGCAGGGCCTTGG + Intronic
1042333427 8:67606522-67606544 AAAGGGAGGCTGCAGGGGGCAGG - Intronic
1042340600 8:67675020-67675042 AGAGGGAGGGAGCAGGGGCATGG + Intronic
1042571244 8:70167388-70167410 ATAGGGTGGCAGCAGGAGCAAGG - Intronic
1043321798 8:78996071-78996093 AGGGGGAGGAAGCAAGAGCAGGG + Intergenic
1044014380 8:87032602-87032624 AAGGGGAGGCAGAAGAGACAGGG + Intronic
1044092332 8:88017307-88017329 AAAGGCAGGAAGTAGGGGCAGGG + Intergenic
1044402234 8:91786155-91786177 AAGGGGAAGGAGAAGGGGAAGGG - Intergenic
1044734040 8:95259353-95259375 AAGTGGAGGCAGGAAGGGCAGGG + Intronic
1045370841 8:101521202-101521224 AAGAAGATGCAGCAGGGCCATGG + Intronic
1046131893 8:109975754-109975776 AAGGCAAGGCAGCAGGCGCTGGG - Exonic
1046314307 8:112479551-112479573 CAAGGCAGGCAGCAGGGCCATGG - Intronic
1046497784 8:115036907-115036929 GCGGGGAGGCAGCTGAGGCATGG - Intergenic
1046530471 8:115438731-115438753 GAAGGAAGGCAGGAGGGGCAGGG - Intronic
1047066070 8:121284488-121284510 GGGGAGAGGAAGCAGGGGCAAGG + Intergenic
1047203695 8:122786700-122786722 GGGGGGAGGCAGAAGGGGAATGG - Intronic
1047288472 8:123508339-123508361 GTGGGGAGGGAGCAGTGGCAAGG + Intronic
1047523727 8:125615292-125615314 AAGGGGAAGGAGAAGGGGAAGGG - Intergenic
1047718782 8:127619792-127619814 AAGGGGAGGAAGGAGAGGGAAGG - Intergenic
1048581761 8:135734829-135734851 AAGGTGGGGGGGCAGGGGCAAGG - Intergenic
1049062581 8:140287369-140287391 AAGCAGAGGGAGGAGGGGCATGG + Intronic
1049068365 8:140337655-140337677 TGGGGGAGGCAGCAGGTTCAGGG - Intronic
1049246790 8:141567177-141567199 AAGGGGAGCCCTGAGGGGCAGGG + Intergenic
1049269658 8:141687563-141687585 ATGAGGAGGCAGGAGGGGCAGGG + Intergenic
1049316001 8:141968044-141968066 GAGGGGAGACAGCAGGGCGAAGG + Intergenic
1049359619 8:142206104-142206126 AAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1049442432 8:142615447-142615469 AAGGGGAGGGAGGAGAGGCGAGG + Intergenic
1049451542 8:142664706-142664728 GAAGGGAGGCAGAAGGGGGACGG - Exonic
1049580656 8:143409091-143409113 CAGGGGTGGGAGGAGGGGCAGGG + Intergenic
1049659530 8:143813564-143813586 AAGCAGTGGCAGCAGGGGCAGGG + Intronic
1049684840 8:143935148-143935170 TGGGGCAGGCAGCAGGGGAAGGG + Intronic
1049735303 8:144202034-144202056 AAGAGAAAGCAGCAGGGCCAAGG + Intronic
1049807455 8:144547445-144547467 AAGGTGAGGCCGAAGGGGCGCGG - Exonic
1049944498 9:580916-580938 ACGGGGAGGCAGCTGAGGCCTGG + Intronic
1050829109 9:9989531-9989553 AAGGGGAGCTAGAAGGGGGATGG - Intronic
1051836258 9:21341479-21341501 CAGGGGAGACAGCAGGGCCTAGG - Intergenic
1052216813 9:25976050-25976072 AAGGGGAAGCAGAAGGTGAAGGG - Intergenic
1052391884 9:27888863-27888885 CAGGAGAGGCAGCAGAGGCCTGG - Intergenic
1052791389 9:32878321-32878343 CACAGGTGGCAGCAGGGGCAGGG - Intergenic
1053000863 9:34576771-34576793 GAGGGAAGGCAGCAAGGGCCTGG - Intronic
1053202705 9:36163564-36163586 CCGGGGAGGCGGCCGGGGCAGGG + Exonic
1053275999 9:36783665-36783687 AAGTGGAGGATGCAGGGCCATGG + Intergenic
1053307217 9:36993563-36993585 GAAGGGACACAGCAGGGGCAGGG + Intronic
1053428714 9:38027835-38027857 CTGGGGAGGCAGAAGGGACAGGG + Intronic
1054451213 9:65404429-65404451 CAGGGGAAGAAGCTGGGGCAGGG - Intergenic
1055053379 9:72001290-72001312 AAGGGGATGCAGAAGGAGGATGG + Intergenic
1055330609 9:75179046-75179068 AAGGTCAGGTAGCTGGGGCAGGG - Intergenic
1055397784 9:75892158-75892180 TTGGGCAGGCAGCAGGGGCGCGG + Intronic
1055399538 9:75908465-75908487 AGGGGGAGGCAGTGGGGACAGGG - Intronic
1056058207 9:82851822-82851844 GCGGGGAGGCAGGAGAGGCAGGG - Intergenic
1056186285 9:84138135-84138157 AAGTGGGGGCAGCAGAGGGAAGG - Intergenic
1056214332 9:84393483-84393505 ACGGGGAGGCTGCAGGGGGGCGG + Intergenic
1056860732 9:90178661-90178683 AAGGGGAGGCAGGATAAGCAGGG + Intergenic
1056871905 9:90289626-90289648 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1057231547 9:93324535-93324557 ATGGGGAGGCTGGAGGGGGATGG - Intronic
1057236542 9:93366082-93366104 ATGGGGAGGCTGGAGGGGGATGG + Intergenic
1057294441 9:93827163-93827185 GAGGCGGGGCCGCAGGGGCAGGG + Intergenic
1057425708 9:94947757-94947779 TAGAGGAGGAAGCAGGTGCATGG + Intronic
1057438679 9:95065485-95065507 AAGGGCAGCCAGCAGGAGAAGGG - Intronic
1058236598 9:102498123-102498145 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1058365196 9:104200810-104200832 ATGGGGAGGCAGCTGAGGCCCGG - Intergenic
1058379556 9:104363045-104363067 ACGGGGAGGCAGCTGAGGCCCGG + Intergenic
1058681039 9:107440435-107440457 AAGGAGAGGGAAGAGGGGCAGGG + Intergenic
1058695598 9:107556613-107556635 AGGAGGAGGAAGCAGGGGCTTGG - Intergenic
1059408762 9:114118838-114118860 AAGGGGAGGAAGGAATGGCACGG - Intergenic
1059511421 9:114851686-114851708 GAGGGGAGGCAGCAGAGGTGGGG + Intergenic
1059646905 9:116276825-116276847 GAGGGGAGGGAGCTGGGGCTGGG - Intronic
1059730289 9:117050450-117050472 CAGGGGAGGAAGCAGGAGTAGGG - Intronic
1060052550 9:120387549-120387571 TAGGGGAGGCACCAGGTTCAAGG - Intergenic
1060145227 9:121247123-121247145 AAAGTCAGCCAGCAGGGGCAAGG + Intronic
1060258536 9:122053635-122053657 AAGGGGAGGGAGCATGGGTGGGG + Intronic
1060583372 9:124771068-124771090 AGGGGGAGGCGGCGGGGGCTCGG - Exonic
1060791693 9:126489656-126489678 ATGGGGAGCCAGCAGGGTGACGG - Intronic
1060971866 9:127742901-127742923 AATGGGAGTCCGCTGGGGCATGG - Exonic
1061061325 9:128251680-128251702 TAGGGGTGGCGGCAGGGGCAGGG + Intronic
1061216480 9:129224745-129224767 AAGAGGAGGCTGCAGCGGCCAGG + Intergenic
1061264441 9:129497153-129497175 GAGGGGAGGCAGCAGGGTGATGG + Intergenic
1061326385 9:129867286-129867308 AAGCCAAGGCAGCAGGGGCTCGG - Intronic
1061537365 9:131258434-131258456 AAGGGCAGAAAGAAGGGGCACGG + Exonic
1061715435 9:132515669-132515691 AAGGGGTGCCAGGAGAGGCAAGG - Intronic
1061751086 9:132777454-132777476 CCAGGGAGGCAGCAGGGGCAAGG - Intronic
1062013107 9:134277438-134277460 AAGGGGAGAAGACAGGGGCATGG - Intergenic
1062130834 9:134892274-134892296 AAGGGGAGGCCTCACGGGCAAGG - Intergenic
1062161128 9:135080497-135080519 CAGGGGAGGCAGCCCGGGAATGG - Intronic
1062192308 9:135254321-135254343 CAGTGGAGGCAGCAGGTGCTGGG - Intergenic
1062212510 9:135372574-135372596 AAGGGCGGGCAGCATGGGCCTGG - Intergenic
1062250245 9:135590196-135590218 AAGGGGAGGCTGCAAGGGGCTGG + Intergenic
1062312995 9:135949519-135949541 AAGGGGAGGCGGCTGGTGCAGGG + Intronic
1062320008 9:135986269-135986291 ACAGGGAGGCTGCAGGGGCCCGG - Intergenic
1062352441 9:136145721-136145743 AAGGGCAGGCAGCCCGAGCAAGG - Intergenic
1062469617 9:136696842-136696864 GAGGGGAGGGAGGAGGGGGAGGG - Intergenic
1062469627 9:136696860-136696882 GAGGGGAGGGAGGAGGGGGAGGG - Intergenic
1062469659 9:136696922-136696944 GAGGGGAGGGAGGAGGGGGAGGG - Intergenic
1062469682 9:136696967-136696989 GAGGGGAGGGAGGAGGGGGAGGG - Intergenic
1062469692 9:136696985-136697007 GAGGGGAGGGAGGAGGGGGAGGG - Intergenic
1062564534 9:137158295-137158317 AGGGAGAAGCAGCAGGGGGAAGG + Intronic
1062631046 9:137463328-137463350 GAGCGGAGGCAGCTGTGGCAGGG + Intronic
1062665774 9:137670699-137670721 AACTGGAGCCAGGAGGGGCAGGG - Intronic
1203740848 Un_GL000216v2:175733-175755 GCTGGGAGGCTGCAGGGGCACGG - Intergenic
1203746943 Un_GL000218v1:45173-45195 AAGAGGAGGCCGGAGGGGCTGGG - Intergenic
1203563164 Un_KI270744v1:74307-74329 AAGAGGAGGCCGGAGGGGCTGGG + Intergenic
1185482967 X:461209-461231 ACGGGGCGGCAGCCGGGGCCGGG - Intergenic
1185533102 X:837738-837760 TAGAGCAGGAAGCAGGGGCAGGG + Intergenic
1185640646 X:1588136-1588158 AAGGGGAGGGGGGAGGGGAAGGG - Intergenic
1185640808 X:1588472-1588494 AAGGGGAGGGGGGAGGGGAAGGG - Intergenic
1185641041 X:1588966-1588988 AAGGGGAGGGGGGAGGGGAAGGG - Intergenic
1186454813 X:9702846-9702868 GAGAGGAGGCAGCAGGGTTAGGG - Intronic
1186734008 X:12441549-12441571 AATGATAGGCAGCTGGGGCAGGG + Intronic
1187097280 X:16161906-16161928 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1187102415 X:16207637-16207659 AAGGGGAGGCAGGAGAGGCAGGG + Intergenic
1187138524 X:16571154-16571176 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1187671235 X:21667818-21667840 AAGGGGAGGAGACAGGGCCAGGG - Intergenic
1187841170 X:23490065-23490087 AAGGGGAGGGGGGAGGGGGAGGG + Intergenic
1187943404 X:24403119-24403141 ATGGGGAGGGGGCAGGGGGAGGG - Intergenic
1187960586 X:24563361-24563383 AAGGGGAGGGACCAGGTGAATGG + Intronic
1188152487 X:26695204-26695226 AGAGGGAGGCAGAAGGGTCAAGG + Intergenic
1188981860 X:36733883-36733905 AAGGGCAGGCAGAATGTGCATGG - Intergenic
1189110548 X:38285942-38285964 AAGGGGAGGAAGAAGAGGAAGGG - Exonic
1189239659 X:39515706-39515728 AAGGGGCTGCAGTGGGGGCAGGG - Intergenic
1189507576 X:41627547-41627569 TAGGGGAGGGTGGAGGGGCAAGG - Intronic
1189647424 X:43148801-43148823 AAAAAGAGGCAGCAGGGGCCAGG - Intergenic
1189837332 X:45039210-45039232 ATGGGGAGGCAGAGGGGGGATGG - Intronic
1190171006 X:48111633-48111655 ATGGAGAAGGAGCAGGGGCAGGG + Intergenic
1190222582 X:48521922-48521944 TGGGGGAGGGAGCAGGGGCCGGG - Intronic
1190561950 X:51694980-51695002 AAGGGGAAGGAGAAGGGGAAGGG + Intergenic
1190845102 X:54183587-54183609 AAGGGGAGCGAGGAGGGGCGGGG + Intergenic
1191669993 X:63740126-63740148 AAGGGGAGGCATCAGGAGCAGGG - Intronic
1191974902 X:66861309-66861331 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1192316143 X:70053302-70053324 AGAGTGAGGCATCAGGGGCAGGG - Intergenic
1192434524 X:71134851-71134873 AAGCAGAGGAAGCGGGGGCAAGG + Intronic
1192436289 X:71145540-71145562 AAGGGGAGGCAGCAATGCCGGGG - Intronic
1192491052 X:71577961-71577983 AAGGCGCGGGAGCAGGGGCGTGG - Intergenic
1192511146 X:71721057-71721079 AAGAGGAGGGAGCATGAGCAGGG - Intergenic
1192515551 X:71760496-71760518 AAGAGGAGGGAGCATGAGCAGGG + Intergenic
1193046245 X:77057965-77057987 AAGGGGAGCCAGCATGTTCAGGG - Intergenic
1193812910 X:86072843-86072865 AATGGGAAGAAACAGGGGCAGGG - Intergenic
1194584690 X:95717901-95717923 AAGGGCAGGCAGGAGGGGAAGGG + Intergenic
1194670192 X:96722423-96722445 AAGGGAAGGAAACAGGGACAAGG - Intronic
1195655532 X:107328212-107328234 CAGGGCAGGAAGCATGGGCAAGG + Intergenic
1195678261 X:107523909-107523931 AAGGGGAGGCTGCAGTGGCAGGG + Intronic
1196058017 X:111377096-111377118 AAGTGGAGGCAGGAGGAGGAGGG - Intronic
1196156735 X:112438476-112438498 CATGGGTGGCAGCAGTGGCATGG + Intergenic
1196253227 X:113486210-113486232 GAGGGGTGGCAGCGGTGGCAGGG - Intergenic
1196515431 X:116605739-116605761 GCTTGGAGGCAGCAGGGGCAAGG + Intergenic
1197096739 X:122604903-122604925 AAGGGGAGGCAAGAGTGGGAAGG + Intergenic
1197810770 X:130441403-130441425 AAGGGGAGGGAAGAGTGGCAAGG - Intergenic
1197978769 X:132194301-132194323 ACGGGGAGGCAGCTGAGGCCTGG - Intergenic
1198254844 X:134915463-134915485 AAGGGGAGGCGGGAGGGGAGGGG - Intergenic
1198267318 X:135021913-135021935 CAGGGGCGGCAGCAGGAGCCTGG + Exonic
1198268570 X:135032908-135032930 CAGGGGCGGCAGCAGGAGCCTGG - Exonic
1198301466 X:135337879-135337901 AAGGAGAGGGAGCAAGGACAGGG + Intronic
1198388054 X:136147427-136147449 GAGGGGAGGAAGCAGGAGCGCGG - Exonic
1198421222 X:136472263-136472285 AAGAGGAGCCAGCAAGAGCAAGG - Intergenic
1199365036 X:146971326-146971348 AGGGGGACAGAGCAGGGGCAAGG - Intergenic
1199382333 X:147184445-147184467 AGGGGGACAGAGCAGGGGCAAGG + Intergenic
1199531804 X:148856487-148856509 ATGGGTAGGCAGGAGGGCCAGGG - Intronic
1199546309 X:149010140-149010162 AAGGAGAGGAGGCAGGGCCAAGG + Intergenic
1199767520 X:150952130-150952152 TAGGGCAGGGGGCAGGGGCAGGG + Intergenic
1199853037 X:151738890-151738912 AAGGGGAAGCAGCAGGGTAGTGG - Intronic
1199966286 X:152823686-152823708 AAGGGGAGGAAGAGGGAGCAGGG - Intergenic
1199972900 X:152873658-152873680 AAGGGCAGTCAGCAGAGCCAGGG + Intergenic
1199974485 X:152884949-152884971 AAGGGGTGGGAGCAGGAGAATGG - Intergenic
1200018259 X:153181425-153181447 CTGGGGTGACAGCAGGGGCAGGG - Intronic
1200063736 X:153495157-153495179 CAGCGGAGGCAGCAGAGCCAGGG - Intronic
1200150039 X:153946875-153946897 AAAGGCAGGCGGCAGGGGCTTGG + Intergenic
1200153929 X:153965273-153965295 TAGGTGTGGCAGCAGGGGCAGGG - Intronic
1200165155 X:154030670-154030692 CAGGGGTGGGAGCAGTGGCACGG + Exonic
1200234957 X:154463760-154463782 GGGGGGAGGCCGCAAGGGCACGG - Intronic
1200253103 X:154564271-154564293 AAGGGGAGGATGGAGGGGGACGG - Intronic
1200264664 X:154640144-154640166 AAGGGGAGGATGGAGGGGGACGG + Intergenic
1200387272 X:155906320-155906342 AAGAGGAGGCATCAAGGGCAAGG - Intronic