ID: 925435097

View in Genome Browser
Species Human (GRCh38)
Location 2:3830202-3830224
Sequence GAAACTGCAGAGATGCATTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 388
Summary {0: 1, 1: 0, 2: 0, 3: 42, 4: 345}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925435097_925435102 12 Left 925435097 2:3830202-3830224 CCTAAATGCATCTCTGCAGTTTC 0: 1
1: 0
2: 0
3: 42
4: 345
Right 925435102 2:3830237-3830259 TAGGTGACAACCTAGCCACTTGG 0: 1
1: 0
2: 1
3: 4
4: 79
925435097_925435099 -7 Left 925435097 2:3830202-3830224 CCTAAATGCATCTCTGCAGTTTC 0: 1
1: 0
2: 0
3: 42
4: 345
Right 925435099 2:3830218-3830240 CAGTTTCCCAAATATTTGGTAGG 0: 1
1: 0
2: 2
3: 15
4: 200
925435097_925435105 30 Left 925435097 2:3830202-3830224 CCTAAATGCATCTCTGCAGTTTC 0: 1
1: 0
2: 0
3: 42
4: 345
Right 925435105 2:3830255-3830277 CTTGGTATTTCTTGTGATCCTGG 0: 1
1: 0
2: 0
3: 12
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925435097 Original CRISPR GAAACTGCAGAGATGCATTT AGG (reversed) Intronic
901091805 1:6646652-6646674 GAAACTGCAGAGGCTCTTTTCGG - Intronic
904010233 1:27385401-27385423 GAAGCTGCTGAGATGCAGTGAGG - Intergenic
905927322 1:41760726-41760748 GAAACTGGGGAGAGGCATTGTGG - Intronic
906976547 1:50580093-50580115 TAAACTGCACAGAAACATTTAGG - Intronic
907043773 1:51286685-51286707 GAAACTGCATTCATGCATTTGGG + Intergenic
908459711 1:64337639-64337661 GAAATTGCAGTGACGCATTAAGG + Intergenic
911377148 1:97064622-97064644 GAAACTTCAGAGCTGCTTCTGGG - Intergenic
912668663 1:111606013-111606035 GAAACTGCGCAGAGGCATTTGGG - Intronic
912865225 1:113250495-113250517 GAGTCTGCAGAGATGCATTGAGG + Intergenic
913066599 1:115261404-115261426 GAAAATGCACAGGAGCATTTGGG + Intergenic
913084123 1:115419380-115419402 GGAACAGGAAAGATGCATTTTGG + Intergenic
914806667 1:150996968-150996990 GAAGCAGAAGAGATGCATTCTGG + Intronic
914824357 1:151131118-151131140 GAAACTGCTGAGAACAATTTGGG - Intergenic
915629465 1:157140566-157140588 GAAACTCTAGAGGTGAATTTGGG + Intergenic
920266366 1:204726466-204726488 GAACCAGAAGAGATGTATTTGGG - Intergenic
920991071 1:210940536-210940558 GAGACTGCAGATGTGCCTTTTGG - Intronic
921139786 1:212296248-212296270 GAAAATCCAGAGTTGTATTTTGG + Intronic
921436596 1:215130351-215130373 CAAATGGAAGAGATGCATTTGGG - Intronic
921563632 1:216688955-216688977 TAAAATACAGAGATGCATATGGG + Intronic
922494761 1:226047826-226047848 CAAACTGCAGAGGTGGATTCAGG + Intergenic
923510418 1:234647353-234647375 GAGACTGTAGAGATGCTTGTAGG + Intergenic
923526916 1:234779685-234779707 GCATCTGCAGAGATGCAATCAGG + Intergenic
924386117 1:243499000-243499022 GAAACTCCAGACATGCTTTGTGG + Intronic
1063283036 10:4651656-4651678 GAAAGTGGAGAGGTGCCTTTTGG + Intergenic
1063584642 10:7340862-7340884 GAAACTGCAGGGATTCTTTGGGG + Intronic
1064303580 10:14144845-14144867 GAAACCGCAGAGAAGGACTTGGG + Intronic
1065173397 10:23053941-23053963 CAAACTGGGGAGTTGCATTTTGG + Intergenic
1066130731 10:32390829-32390851 CAAATTACAGAGATGCAGTTGGG + Intergenic
1066791313 10:39067186-39067208 GAATCTGCAAAGAGACATTTTGG - Intergenic
1066791404 10:39068457-39068479 GAATCTGCATAGAGACATTTTGG + Intergenic
1066794126 10:39100034-39100056 GAATCTGCAAAGGAGCATTTGGG + Intergenic
1066794669 10:39106359-39106381 GAATCTGCAAACATACATTTGGG + Intergenic
1066796162 10:39123673-39123695 GAAACTGCAAAGGGACATTTGGG + Intergenic
1066797184 10:39135490-39135512 GAATCTGCAAAGAGACATTTGGG + Intergenic
1066799067 10:39163479-39163501 GAATCTGCAAAGATGTATTTTGG + Intergenic
1066805222 10:39242665-39242687 GAATCTGCAGAGAGTTATTTTGG + Intergenic
1066808945 10:39299253-39299275 GAAACTGCAAAGAGTTATTTGGG - Intergenic
1066809051 10:39301129-39301151 GAATCTGCAAAGATATATTTGGG - Intergenic
1066816697 10:39427392-39427414 AAAACTGCAAAGAAGCATTCTGG - Intergenic
1066928373 10:41726192-41726214 GAATCTGCAAAGAGACATTTTGG + Intergenic
1067190852 10:44066897-44066919 GAACCTACAGAGATCCATGTTGG - Intergenic
1068818022 10:61339935-61339957 CAAAATGCAGAGAAGCATGTGGG - Intergenic
1070073753 10:73115107-73115129 ACAAATGAAGAGATGCATTTAGG - Intronic
1070078098 10:73157786-73157808 GAAACAGCAGTGATGCATGTAGG - Intronic
1071248767 10:83793438-83793460 GAAAATGCAGGGATTCATCTGGG - Intergenic
1071283949 10:84127031-84127053 GAAAGGGCAGAGATGCAGGTAGG - Intergenic
1072279105 10:93849823-93849845 GAAACTATTGAGATGCATTAGGG - Intergenic
1073009413 10:100347872-100347894 GAAACTGTACAGATACATTAGGG - Intronic
1073563290 10:104515360-104515382 GATTCTGCAGAGCAGCATTTGGG - Intergenic
1073811572 10:107157872-107157894 GCCACTGCAGAGATGCTGTTTGG + Intronic
1074271989 10:111963045-111963067 TAAACTGCAGAGAGGCATAGGGG - Intergenic
1074332947 10:112537938-112537960 GAAACAGCAAAGATCCAGTTGGG + Intronic
1074792461 10:116904239-116904261 AAAGCTGCAGAGCTGCATGTTGG - Intronic
1077972801 11:7212929-7212951 TAAACTGGAGAGATAAATTTAGG + Intergenic
1078866745 11:15304785-15304807 GACACTGCATTGATGCTTTTTGG - Intergenic
1079117354 11:17648658-17648680 GAGACTGCAGAAAGACATTTAGG - Intergenic
1079176610 11:18147795-18147817 GCAATTTCAGAGATGCCTTTAGG - Intronic
1079502433 11:21116428-21116450 GGAACTGGAGCGATACATTTAGG - Intronic
1080109783 11:28553374-28553396 GTAACAGAAGACATGCATTTAGG + Intergenic
1080621124 11:33988000-33988022 GAAGCTTGAGAGATGCATTTGGG - Intergenic
1081121271 11:39269405-39269427 TACACTGTAGAGATGTATTTTGG - Intergenic
1082290642 11:50365844-50365866 GAATCTGCAAAGAAGCATTTGGG + Intergenic
1082290860 11:50368100-50368122 GAATCTGCAAAGGGGCATTTGGG + Intergenic
1082291148 11:50372853-50372875 GAATCTGCAAAGACACATTTGGG + Intergenic
1082291526 11:50379363-50379385 GAATCTGCAAAGAGACATTTGGG + Intergenic
1082310630 11:50643127-50643149 GAAACTGCAAAGAGAGATTTGGG + Intergenic
1082311361 11:50652993-50653015 AAAACTACAGAGAAGCATTTGGG + Intergenic
1082585745 11:54937420-54937442 GAAACTGCACAGTTATATTTGGG - Intergenic
1082591352 11:55014950-55014972 GAATCTGCAAAGAGACATTTGGG + Intergenic
1082592513 11:55030362-55030384 GAATCTGCAAAGTTGCATTTTGG - Intergenic
1082596764 11:55091344-55091366 GAAACTGCAAAGGGGTATTTGGG - Intergenic
1082603738 11:55196793-55196815 GAATCTGCAAAGATATATTTGGG + Intergenic
1089205565 11:116759041-116759063 GAAAGTGCAGAGACCAATTTAGG - Intronic
1092663955 12:10773126-10773148 TAAACTGCAGTTATGGATTTTGG - Intergenic
1094857346 12:34413747-34413769 GAAACTGCAGAGGGATATTTTGG - Intergenic
1094857402 12:34414944-34414966 GAATCTGCATAGATATATTTGGG - Intergenic
1094869554 12:34584989-34585011 GAATCTGCAAAGAGGTATTTGGG - Intergenic
1094876482 12:34650424-34650446 GAAACTGCAGAGGGATATTTGGG + Intergenic
1095058846 12:37657147-37657169 AAAACTACACAGATGCATTCTGG + Intergenic
1095075884 12:37924176-37924198 GAATCTGCAAAGATATATTTGGG - Intergenic
1095076105 12:37928296-37928318 GAATCTGCAAAGGTGTATTTTGG - Intergenic
1095080857 12:37997769-37997791 GAATCTGCAAAGAAACATTTGGG + Intergenic
1095081139 12:38001023-38001045 GAATCTGCAAAGAGACATTTGGG + Intergenic
1096997794 12:55849836-55849858 GCAACTGCAGAGAGGGGTTTTGG + Intergenic
1097443236 12:59637308-59637330 GAAACTGGTAAAATGCATTTTGG + Intronic
1097449757 12:59722043-59722065 GAAACTGAAGATATAAATTTAGG - Intronic
1097827314 12:64187373-64187395 GAAAATGGAGAGATGCAAATGGG - Intronic
1098147861 12:67516103-67516125 CAAGCTGCAGAAATGGATTTTGG + Intergenic
1100709797 12:97243661-97243683 TAAACTGCAGACATGGTTTTGGG - Intergenic
1101147779 12:101857527-101857549 CAAAATGGAGAGATACATTTGGG - Intergenic
1103663022 12:122536887-122536909 GAAACAGAACACATGCATTTTGG + Intronic
1104361878 12:128140924-128140946 AAAACTCCAGAGATGGATTCAGG - Intergenic
1106125828 13:26899386-26899408 GAAATGGCAGAGATGCTTCTGGG - Intergenic
1108132246 13:47314831-47314853 TAAAATCCAGAGATACATTTAGG + Intergenic
1108975385 13:56437215-56437237 GAAAATGGAGAGATGTAGTTTGG + Intergenic
1109121204 13:58460417-58460439 TAAAGTACAGAGATCCATTTTGG + Intergenic
1110221741 13:73081060-73081082 AAAACTGCAGTTATGTATTTTGG + Intergenic
1112066799 13:95801409-95801431 AAAATTACAGAAATGCATTTAGG - Intergenic
1112541233 13:100315364-100315386 ATAAAAGCAGAGATGCATTTGGG + Intronic
1112825831 13:103391654-103391676 CAAACTGCAGAGCTCCATGTCGG - Intergenic
1115143261 14:30198182-30198204 GAATCTGCAGAGATCTATTATGG - Intergenic
1115428664 14:33290558-33290580 GCAACTGCTGAGATGCACTGGGG - Intronic
1117011974 14:51480220-51480242 AAAACAGCACAGTTGCATTTTGG + Intergenic
1117955961 14:61123821-61123843 GAAACAGAAGAGATGCTTTGGGG - Intergenic
1118732729 14:68679988-68680010 GAAACAACAAAGACGCATTTTGG + Intronic
1119125198 14:72118891-72118913 GAAACTTTAGAGAAGCATTCTGG - Intronic
1119499512 14:75112148-75112170 GAAACAGCAAATATGCAATTAGG + Intronic
1123466498 15:20520270-20520292 GAAACTGCACAGATGAGTTGGGG + Intergenic
1123651616 15:22480767-22480789 GAAACTGCACAGATGAGTTGGGG - Intergenic
1124384521 15:29195386-29195408 GAAACTGCAGAGAGCCACCTCGG - Intronic
1125151976 15:36542922-36542944 CAAACTGTATAGATGCCTTTAGG - Intergenic
1125438578 15:39675458-39675480 GAAAATGCAGAAATAAATTTAGG + Intronic
1126232255 15:46341040-46341062 GAAACTGAAGAGGTTTATTTTGG + Intergenic
1127502284 15:59565420-59565442 AAAACCGCAGAAATGCAGTTGGG - Intergenic
1128537209 15:68500434-68500456 GAAAGAGCAGAGGTGGATTTAGG - Intergenic
1128915995 15:71562961-71562983 TAAAGACCAGAGATGCATTTTGG - Intronic
1129898312 15:79124989-79125011 GAAGCTACAAAGATGCATATGGG - Intergenic
1131965147 15:97834422-97834444 GAAACAGAAGAGATACAATTGGG - Intergenic
1132205023 15:99980536-99980558 GAAACTGCACAGATGGATGGAGG + Intronic
1132829188 16:1919186-1919208 GAGACATCAGTGATGCATTTCGG + Intergenic
1133621348 16:7529706-7529728 GAAACTCAAGAGGTGAATTTAGG + Intronic
1133805067 16:9120164-9120186 GAATCTTCAGAGATACATTCTGG + Exonic
1136738351 16:32485821-32485843 GAAACTGCAAAGGTATATTTGGG + Intergenic
1136740544 16:32519081-32519103 GAAACTGCAAAAGTGTATTTGGG - Intergenic
1136744498 16:32573106-32573128 GAAACTGCAAAGAGACATTTGGG + Intergenic
1136744570 16:32573961-32573983 GAATCTGCAAAGAGACATTTAGG + Intergenic
1137076512 16:35971314-35971336 GAATCTGCAGAGGTATATTTGGG - Intergenic
1137077962 16:35999469-35999491 AAAACTACACAGAGGCATTTTGG + Intergenic
1137749879 16:50853118-50853140 AAAACTGTAGTGATTCATTTTGG + Intergenic
1139785222 16:69386949-69386971 GAACCTGCAAAGATCCAGTTTGG + Intronic
1141531658 16:84650194-84650216 GAAGATGCAGAGAAGCACTTGGG + Intronic
1203025027 16_KI270728v1_random:501269-501291 GAATCTGCAAAGAGACATTTAGG - Intergenic
1203025098 16_KI270728v1_random:502126-502148 GAAACTGCAAAGAGACATTTGGG - Intergenic
1203029062 16_KI270728v1_random:556153-556175 GAAACTGCAAAAGTGTATTTGGG + Intergenic
1203042659 16_KI270728v1_random:778278-778300 GAAACTGCAAAAGTGTATTTGGG - Intergenic
1203046623 16_KI270728v1_random:832305-832327 GAAACTGCAAAGAGACATTTGGG + Intergenic
1203046694 16_KI270728v1_random:833162-833184 GAATCTGCAAAGAGACATTTAGG + Intergenic
1203115579 16_KI270728v1_random:1486736-1486758 GAAACGACAGTCATGCATTTAGG - Intergenic
1143056240 17:4164088-4164110 GAAACTGCAGGCACACATTTGGG - Intronic
1146933404 17:36793921-36793943 GAAACTTCAATGATGCATGTAGG + Intergenic
1148007035 17:44441371-44441393 AAAGCAGCAGAGATGCATTGTGG - Intronic
1150659521 17:67063218-67063240 GAAAATGAGGAGATGGATTTGGG - Intergenic
1150915740 17:69435162-69435184 GAAAATGGAAAAATGCATTTTGG - Intronic
1151007676 17:70456878-70456900 GAAACAGCAGCCATACATTTTGG - Intergenic
1151752625 17:76049292-76049314 GAAACTGCAGAGATCTCTGTGGG + Intronic
1153045649 18:853532-853554 AGAAGTGCAGAGATGAATTTCGG - Intergenic
1153235793 18:2985977-2985999 GAAAATGCAGAAATGCACTTAGG - Intronic
1157004489 18:43565694-43565716 GACACTGGACAGATGCAATTAGG + Intergenic
1157478694 18:48039258-48039280 TAGACTGCAGAGATGCCTGTAGG - Intronic
1157552416 18:48590725-48590747 GAAAAAGCAGACATCCATTTCGG + Intronic
1158064511 18:53389723-53389745 GAAATTTCAGAGAAGCATTCTGG + Intronic
1158892808 18:61888948-61888970 GAAAATATAGAAATGCATTTTGG + Intronic
1159634111 18:70784489-70784511 GAAAGTGCAGAGGTCCCTTTAGG + Intergenic
1159734124 18:72073313-72073335 GAAAATGGAGTGATGCATTTTGG + Intergenic
1163273095 19:16266071-16266093 GGAACAGCATGGATGCATTTGGG + Intergenic
1163741018 19:19012445-19012467 GGAACTTGGGAGATGCATTTGGG - Intronic
1164329663 19:24242129-24242151 GAACCTGCAGAGAGGTATTTGGG - Intergenic
1164332132 19:24269697-24269719 GAAACTGAAGAGAGACATTTGGG - Intergenic
1164337139 19:24337266-24337288 GAAACTGCAAAGAGATATTTTGG + Intergenic
1164337281 19:24339675-24339697 AAATCTGCAGAGGTGTATTTGGG + Intergenic
1164348697 19:27303315-27303337 AAAACTACACAGATGCATTCTGG + Intergenic
1164348707 19:27303485-27303507 AAAACTACACAGATGCATTCTGG + Intergenic
1164358999 19:27479386-27479408 GAATCTGCAAAGGTGTATTTGGG - Intergenic
1164359595 19:27489557-27489579 GAATCTGCAGTGATATATTTGGG + Intergenic
1164361986 19:27523097-27523119 GAAACTGCAAAGACATATTTGGG + Intergenic
1164363466 19:27545513-27545535 GAGCCTGCAGAGAGACATTTGGG + Intergenic
1166411804 19:42560529-42560551 GAATCAGCAGGGATGCATTGGGG + Intronic
925435097 2:3830202-3830224 GAAACTGCAGAGATGCATTTAGG - Intronic
925468561 2:4134333-4134355 GAAACTCAAGAGATGCATGATGG + Intergenic
925908895 2:8558378-8558400 GTGACTGCAGAGGTGCATGTGGG - Intergenic
926546057 2:14241632-14241654 AAAACTGCAAAGAAGCATATTGG - Intergenic
928520578 2:32084494-32084516 GAAACTGCAGGTATGCATTAGGG + Intronic
929425045 2:41835929-41835951 GAGACTACAGCTATGCATTTGGG - Intergenic
930724387 2:54668202-54668224 GATAAGGCAGAGGTGCATTTGGG + Intronic
934866269 2:97815754-97815776 GGCAATGCAGAGAGGCATTTTGG - Intronic
935363700 2:102268405-102268427 GAAGCTGCAGACATGGATGTGGG - Intergenic
936238293 2:110765400-110765422 AAAACTGAAGATATGCATGTTGG + Intronic
939997134 2:148930444-148930466 GAAACTGCACAGAGGAAGTTTGG + Intronic
941178735 2:162233406-162233428 GAAATTGCAGAGGAGCAATTAGG - Intronic
942380912 2:175389105-175389127 GAAACAGCAGAGCTGTATTTTGG + Intergenic
942436141 2:175979118-175979140 GAAAATGGAGAGATACATTTGGG + Intronic
942752507 2:179303931-179303953 GAAAATGTCAAGATGCATTTTGG - Intergenic
945119834 2:206445321-206445343 GAAACTGCAGAAAAAAATTTGGG + Exonic
945295244 2:208163896-208163918 GAAACTGCTGAGATGGAGGTTGG + Intergenic
947424445 2:229970655-229970677 AACACTGCAGACATTCATTTAGG + Intronic
1170130409 20:13012959-13012981 GGAACTCCAGAGATGAATGTAGG + Intronic
1172007075 20:31824900-31824922 GAAACTGCGGGGTAGCATTTTGG + Intronic
1172984140 20:38968869-38968891 GACACTGCAGTGAAGCTTTTAGG + Intronic
1173439543 20:43063797-43063819 GAACTTGCAGAGCTGCTTTTTGG - Intronic
1174065862 20:47865686-47865708 GAGACTGAAGAGGTGGATTTTGG + Intergenic
1174066161 20:47867503-47867525 GAGACTGCAGAGGTGGATTTTGG + Intergenic
1175388499 20:58612088-58612110 GAAAGGGCAGAGCTGGATTTCGG + Intergenic
1175626179 20:60489808-60489830 GCAACTGCAGAGATGCTTCCGGG - Intergenic
1175707369 20:61190392-61190414 GAAACTGCAGAGTTTCACTGTGG + Intergenic
1176677846 21:9797275-9797297 AAAACTGTCAAGATGCATTTTGG + Intergenic
1203288420 22_KI270735v1_random:7619-7641 GAAACTGCACTCATTCATTTTGG - Intergenic
950310531 3:11953990-11954012 GAACTTGCAGAGATGGATGTAGG + Intergenic
952191795 3:31030444-31030466 GAAACTGCAGAGTGGGAATTAGG - Intergenic
954649617 3:52153303-52153325 GAAACCTCAAAGAAGCATTTTGG + Intronic
955025969 3:55167819-55167841 CAAACTGCAGAGCTGCAGCTGGG + Intergenic
956013843 3:64860168-64860190 GAAACTTCAAAGATGTGTTTTGG + Intergenic
956408750 3:68956440-68956462 GAAATTGAACAGATTCATTTTGG - Intergenic
959716564 3:109440084-109440106 GTAAGTGTGGAGATGCATTTAGG + Intergenic
960323575 3:116267290-116267312 GAAGCTGATGACATGCATTTTGG + Intronic
960345641 3:116528463-116528485 AAAACTGCAGTGAAACATTTTGG + Intronic
961337730 3:126192874-126192896 GAGACTGCAGAGATGCCTCAGGG + Intronic
961391802 3:126556480-126556502 GCAAGTGCAGAGCTGCACTTGGG - Intronic
961793945 3:129396121-129396143 GAAACTCTTGGGATGCATTTTGG - Intergenic
963917608 3:150873444-150873466 GAAACCTCAGAGCTGCTTTTTGG - Intronic
965105498 3:164347300-164347322 GAAATTGGTGAGATGCTTTTTGG + Intergenic
965416573 3:168402117-168402139 GAAACTGGGAAGATGTATTTTGG + Intergenic
968166772 3:196472489-196472511 GAAACTGCAGTTATGCCTTGTGG - Exonic
970398878 4:15699040-15699062 GAAATTTCAGAGATGAAGTTGGG - Intronic
971228655 4:24779255-24779277 GATAATGCAAAGAGGCATTTTGG - Intergenic
971580955 4:28339608-28339630 GAAACTCCAGTGATTGATTTAGG + Intergenic
974547262 4:63328499-63328521 GAATCTGCACAGAGACATTTTGG - Intergenic
974548922 4:63348406-63348428 GAATCTGCAAAGGTACATTTGGG - Intergenic
974819361 4:67046291-67046313 GGACCTGCAGGGATACATTTAGG - Intergenic
975462117 4:74665677-74665699 GAAAGGGCAGAGAGGCAGTTTGG + Intergenic
977522683 4:98105171-98105193 GAGACTCCAGGGATGCCTTTTGG - Intronic
978357941 4:107897190-107897212 AAGACTGCAAAGTTGCATTTGGG - Intronic
979303705 4:119117272-119117294 GAAAGTCCAGACATGAATTTAGG + Intergenic
979475165 4:121148332-121148354 AAAACTACGGAGATGGATTTTGG + Intronic
981841446 4:149117535-149117557 AAAACAGCAGATATGAATTTAGG - Intergenic
982364693 4:154563804-154563826 AAAAATACAGAAATGCATTTAGG + Intronic
982879585 4:160695459-160695481 AAAACTTCAGAAATGGATTTTGG - Intergenic
984571941 4:181404809-181404831 GGAACAGCAGAGCTGCATTTTGG + Intergenic
984954901 4:185035602-185035624 GACTCTCCAGGGATGCATTTGGG - Intergenic
985397680 4:189561514-189561536 AAAACTGTCAAGATGCATTTTGG - Intergenic
985862147 5:2479591-2479613 GAAACTGAAGACATTTATTTGGG + Intergenic
986446244 5:7824015-7824037 GAAGCTGAAGGGCTGCATTTGGG + Intronic
986736884 5:10674621-10674643 GAGAATGCAGAGGTGCAATTGGG + Intergenic
987077425 5:14397174-14397196 GAAACTGCATAGATGCACACTGG - Intronic
987183107 5:15386657-15386679 GAAACATCAGAGATGAAATTAGG - Intergenic
987229383 5:15877469-15877491 GAGACTGAAGAGATGCAGTTGGG + Intronic
987416986 5:17671998-17672020 GAAACTGCAGAGAGGCTCATGGG + Intergenic
987795904 5:22626250-22626272 GAAGCTGCAGTGATGCATCAGGG - Intronic
989343417 5:40402920-40402942 AAACCTGAAGAGATGAATTTAGG + Intergenic
989841010 5:46069697-46069719 GAAACTGCAGTGGGACATTTGGG + Intergenic
989854155 5:46258461-46258483 GAATCTGCAAAGGTGTATTTCGG - Intergenic
989854785 5:46270245-46270267 GAATCTGCAAAGATATATTTGGG - Intergenic
989854971 5:46273403-46273425 GAATCTGCAAAGGTACATTTGGG - Intergenic
992896582 5:81251165-81251187 CAAACAGCAGAGAAGCATTGCGG - Exonic
995257391 5:110062713-110062735 AGATCTACAGAGATGCATTTTGG - Intergenic
996817577 5:127590776-127590798 GAAACTGTAGAGATGAGGTTAGG - Intergenic
998086723 5:139332407-139332429 GACACTGCAGAGCAGCATATGGG + Intergenic
998609942 5:143677390-143677412 GAGACTATAGAGGTGCATTTTGG - Intergenic
998672910 5:144373953-144373975 GAAACTGCAGTGATGCAGCTAGG - Intronic
999904221 5:156121735-156121757 AAAAGGGAAGAGATGCATTTAGG - Intronic
1000530252 5:162410469-162410491 GAAAAGCCAGAGATGTATTTTGG - Intergenic
1002211481 5:177602044-177602066 GAGACTGGAGAGATGGATATGGG - Intronic
1002623135 5:180504545-180504567 AAAACTGCAAAGATTCATGTTGG + Intronic
1003141835 6:3478257-3478279 GAAACTTTAGAGAAACATTTTGG + Intergenic
1003617209 6:7666209-7666231 GTAACTGTATAGATTCATTTGGG + Intergenic
1005643485 6:27818899-27818921 GAAATAGCACAGAGGCATTTGGG + Intergenic
1005807094 6:29484317-29484339 CCTACTGCAGAGATGCATCTGGG - Intergenic
1006599918 6:35218561-35218583 GAAACTGCAGAGCTGCTCTGAGG + Intronic
1006681251 6:35798151-35798173 GAAAGGGGAGAGAGGCATTTAGG - Intergenic
1008146915 6:47903111-47903133 AATACTTCAGAGTTGCATTTTGG - Intronic
1008912321 6:56748757-56748779 GAAACAGCAGAGCTGGAATTTGG + Intronic
1009063951 6:58433677-58433699 GAATCTGCAAAGAGACATTTGGG + Intergenic
1009253762 6:61348158-61348180 GAAACTGCAGAGGGACATTTGGG + Intergenic
1009258448 6:61449979-61450001 GAAACTGCAGAGGGACATTTGGG + Intergenic
1009260029 6:61474325-61474347 GAAACTGGAAAGGTGTATTTGGG + Intergenic
1010111250 6:72236323-72236345 TCAGCTGCAGAGATGCATTTAGG + Intronic
1010350124 6:74863648-74863670 GAAACTGCAGAGTTGGCTTTGGG - Intergenic
1011855784 6:91688958-91688980 AAAATTGCAGAGATTCATTTGGG + Intergenic
1011861870 6:91768168-91768190 GAAACTGCAGACTTACATTTGGG + Intergenic
1013753984 6:113439586-113439608 CAAACTGAAGAAATGCATTGAGG + Intergenic
1013945030 6:115712470-115712492 GAAACTGAAGAGCTGTGTTTGGG - Intergenic
1014117725 6:117685140-117685162 TAAACAGCAGGTATGCATTTTGG - Intronic
1017295507 6:152789394-152789416 GAATCTGTAGAGATGCTATTGGG + Intergenic
1020641937 7:10766182-10766204 TATACTTGAGAGATGCATTTGGG + Intergenic
1020946597 7:14617156-14617178 GAAAAGGCAGACATGAATTTGGG - Intronic
1021294316 7:18885373-18885395 GATAGTGCAGAGAAGCATTGAGG - Intronic
1022742652 7:33137669-33137691 GAAACTGGAGAGACGCACTTGGG + Intronic
1023237186 7:38101842-38101864 GAGACTACAGAGATGCTATTCGG - Intergenic
1023674490 7:42616001-42616023 GAAAATGGAGAGATTCATTTTGG - Intergenic
1023768602 7:43534515-43534537 CAAACTGCAGAGGAGAATTTAGG - Intronic
1024093538 7:45967095-45967117 CAAAGTGCAGAGATTCCTTTTGG - Intergenic
1025523149 7:61767090-61767112 GAATCTGCAGATGTGTATTTGGG - Intergenic
1025523706 7:61776731-61776753 GAATCTGCAGAGGTATATTTGGG - Intergenic
1025526607 7:61820971-61820993 GAAACTGCAAAGGTATATTTGGG + Intergenic
1025530952 7:61882846-61882868 GAATCTGCATAGGGGCATTTGGG - Intergenic
1025532435 7:61905725-61905747 GAATCTGCAAAGAAGCATTTGGG + Intergenic
1025534431 7:61930513-61930535 GAATCTGCAAAAAGGCATTTTGG + Intergenic
1025546901 7:62186118-62186140 GAATCTGCAGATGTGTATTTGGG - Intergenic
1025549977 7:62233527-62233549 GAAACTGCAAAGGTATATTTGGG + Intergenic
1025587492 7:62809932-62809954 GAATCTGCAAAGGGGCATTTGGG - Intergenic
1025590793 7:62858185-62858207 GAATCTGCAAAGTTGTATTTGGG + Intergenic
1025597143 7:62944340-62944362 GAAACTGCAAAGGTATATTTGGG + Intergenic
1026462654 7:70628772-70628794 GAAACTGAAGACAAGCAGTTGGG + Intronic
1027471999 7:78585197-78585219 TAAATTGCAGAAATGAATTTAGG - Intronic
1028756767 7:94444572-94444594 AAAGATGCAGAGATGCATTCAGG + Intergenic
1028769314 7:94598158-94598180 GAAACTGTACAGTTGCATTTGGG - Intronic
1028889260 7:95968646-95968668 GAAACTGCAGATTTGCACATTGG + Intronic
1030359123 7:108576924-108576946 GAAGCTGGAAATATGCATTTTGG + Intergenic
1031026663 7:116686662-116686684 GATATTGGAGAGATGGATTTCGG + Intronic
1032287883 7:130556478-130556500 GAAACTGTATATATGGATTTGGG - Intronic
1033021843 7:137733204-137733226 GTGACTGCAGAGTTTCATTTGGG - Intronic
1033534811 7:142301961-142301983 GAACCTGGTGTGATGCATTTGGG + Intergenic
1034164538 7:149015180-149015202 AAAACTGCAGAGATGCAGCCAGG - Intronic
1034943148 7:155244946-155244968 GAAACTGCTGGGAAGCTTTTGGG - Intergenic
1040112409 8:43572653-43572675 GAAACTGCAAGGAAACATTTGGG + Intergenic
1040112477 8:43573517-43573539 GAAACTGCAAAAAGACATTTGGG + Intergenic
1040112541 8:43574368-43574390 GAAACTGCAAAGGAACATTTGGG + Intergenic
1040112671 8:43576244-43576266 GAAACTGCAAAGAGACATTTAGG + Intergenic
1040112677 8:43576415-43576437 GAAACTGCAAAAAGACATTTGGG + Intergenic
1040113436 8:43586323-43586345 GAAGCTGCAAAGAAACATTTTGG + Intergenic
1040113985 8:43593444-43593466 GAATCTGCAAAGAAACATTTGGG + Intergenic
1040117286 8:43637166-43637188 GAATCTGCAAAGAAACATTTGGG + Intergenic
1040118276 8:43650290-43650312 GAAACTGCAAAGGGACATTTGGG + Intergenic
1040118447 8:43652364-43652386 GAATCTGCAAAGAGGCATTTTGG + Intergenic
1040118797 8:43657180-43657202 GAATCTGCAAAGAAACATTTTGG + Intergenic
1040119216 8:43662663-43662685 GAATCTGCAAAGAGACATTTGGG + Intergenic
1040121610 8:43690103-43690125 GAATCTGCAGAGGGACATTTGGG + Intergenic
1040124548 8:43722149-43722171 GAAACTGCAAAGGGGCATTTGGG + Intergenic
1040125390 8:43731785-43731807 GAAACTGCGAAGAGACATTTGGG + Intergenic
1040127274 8:43752194-43752216 GAATCTGCAAAGAAACATTTGGG + Intergenic
1040127929 8:43759787-43759809 GAATCTGCAAAGAAACATTTGGG + Intergenic
1040128207 8:43763286-43763308 GAATCTGCAAAGAGACATTTGGG + Intergenic
1040128773 8:43769809-43769831 GAATCTGCAGAGGGACATTTGGG + Intergenic
1040129698 8:43780760-43780782 GAATCTGCAGAGAGACATTTTGG + Intergenic
1040129853 8:43782615-43782637 GAAAGTGCAAAGAGACATTTGGG + Intergenic
1040130132 8:43785860-43785882 GAATCTGCAGAGGGACATTTGGG + Intergenic
1040132314 8:43811580-43811602 GAATCTGCAAAGAAACATTTAGG + Intergenic
1040133383 8:43824336-43824358 GAATCTGCAAAGAGGCATTTTGG + Intergenic
1040133530 8:43825863-43825885 GAATCTGCAAAGAAACATTTGGG + Intergenic
1040134312 8:43834929-43834951 GAATCTGCAAAGAAACATTTGGG + Intergenic
1040134693 8:43839202-43839224 GAATCTGCAGAGGGACATTTGGG + Intergenic
1040135481 8:43848446-43848468 GAATCTGCAAAGAGACATTTTGG + Intergenic
1040140177 8:43900504-43900526 GAATCTGCAAAGAAACATTTGGG + Intergenic
1040281984 8:46060063-46060085 GAATCTGCAAAGAATCATTTTGG + Intergenic
1040282746 8:46073766-46073788 GAATCTGCAGAGGGACATTTTGG + Intergenic
1040297595 8:46166776-46166798 GAATCTGCAAAGCTACATTTTGG - Intergenic
1040332605 8:46397093-46397115 GAATCTGCAAAGAGGCATTTTGG - Intergenic
1040343611 8:46462257-46462279 GAATCTGCAAAGAAACATTTTGG - Intergenic
1040345806 8:46491943-46491965 GAATCTGCAAAGAGACATTTTGG - Intergenic
1040348691 8:46539868-46539890 GAATCTACAAAGAGGCATTTTGG + Intergenic
1042842761 8:73140757-73140779 AAAAATGCTGAGCTGCATTTTGG - Intergenic
1043077704 8:75722656-75722678 GGAACTGCAGAGCTGCCTATGGG + Intergenic
1043803594 8:84643158-84643180 GAAACTGAGGTGATACATTTGGG - Intronic
1044288945 8:90445107-90445129 GAAATTGCAGAGAACTATTTTGG - Intergenic
1045655886 8:104386173-104386195 ATAACTGCAGAAATGCCTTTTGG + Intronic
1046866296 8:119154417-119154439 GAAACTGCCTAAATGCATTTTGG + Intergenic
1047057942 8:121188479-121188501 GAAATACCAGGGATGCATTTTGG + Intergenic
1047906806 8:129481220-129481242 GGAACTGCAGAGATGGGATTTGG + Intergenic
1048178846 8:132177118-132177140 GAAACTTCTGACTTGCATTTGGG - Intronic
1048348585 8:133597299-133597321 CAAAGTGCAGAGAAGCATTTTGG - Intergenic
1050726122 9:8651218-8651240 GAAAATGCAGAGATCCATCGTGG - Intronic
1051685115 9:19650349-19650371 GTACCTGCAGAAATCCATTTTGG - Intronic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1055787953 9:79891246-79891268 GAAAGTACAGAGATTAATTTAGG - Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1057714312 9:97478370-97478392 GTAATTGCACAGAAGCATTTTGG + Intronic
1058920706 9:109612037-109612059 GAAAATACAGAGAATCATTTAGG - Intergenic
1060748162 9:126151436-126151458 CTAACTTCAGAGATGCATTGGGG - Intergenic
1061955693 9:133960214-133960236 GCACCTGCAGCGATGCCTTTGGG - Intronic
1203412538 Un_KI270589v1:2506-2528 GAAACTACACAGAAGCATTCAGG + Intergenic
1203685815 Un_KI270757v1:57061-57083 GAAACTACACAGAAGCATTCAGG - Intergenic
1186127504 X:6429956-6429978 GAATCTGCATAGTGGCATTTTGG + Intergenic
1186917223 X:14236028-14236050 GAAACTGAAAATATGCATGTTGG - Intergenic
1188305101 X:28552106-28552128 TAAACTGAAGAGATAGATTTGGG + Intergenic
1190699665 X:52978117-52978139 GAAACTCCAGCATTGCATTTAGG + Intronic
1191259853 X:58305304-58305326 GAAACTGCAAAGGGACATTTGGG + Intergenic
1191260138 X:58309554-58309576 GAATCTGCAAAGAAACATTTGGG + Intergenic
1191261207 X:58323871-58323893 GAATCTGCAGAGAAATATTTTGG + Intergenic
1191568513 X:62573417-62573439 AAAACTACACAGAAGCATTTTGG + Intergenic
1191569166 X:62586211-62586233 AAAACTGCACAGAAGCATTCTGG + Intergenic
1191576055 X:62707305-62707327 GAACCTGCAAAGAGACATTTAGG - Intergenic
1191577920 X:62727202-62727224 GAATCTGCAGAGGTACATTTGGG - Intergenic
1191581465 X:62766650-62766672 GAATCTGCAAAGGGGCATTTGGG - Intergenic
1192278791 X:69662106-69662128 GAAAATGGAGAGATGTATGTAGG - Intronic
1193459193 X:81770085-81770107 GAAACTGCAGATTTCCACTTAGG - Intergenic
1194455494 X:94098182-94098204 GAAACTGCCTAGAGGCACTTTGG - Intergenic
1195511926 X:105725688-105725710 GAAAATGATGAGATGTATTTTGG + Intronic
1196216311 X:113056080-113056102 AAAAATGCAGAGATGAATGTAGG + Intergenic
1197013480 X:121595007-121595029 CTAACTGCAGAGATCCACTTAGG - Intergenic
1197631042 X:128858375-128858397 GAAACTGCAGAAATGAATGAGGG - Intergenic
1199015965 X:142815656-142815678 AAAGCTGGAGAGATACATTTTGG - Intergenic
1201586535 Y:15567307-15567329 GCAACTGCAGACATGCACATGGG - Intergenic
1201777079 Y:17677725-17677747 GAATCTGCAGAGGGACATTTGGG - Intergenic
1201779555 Y:17704155-17704177 AAACCTGCAGAGAAACATTTGGG - Intergenic
1201822001 Y:18201837-18201859 AAACCTGCAGAGAAACATTTGGG + Intergenic
1201824478 Y:18228267-18228289 GAATCTGCAGAGGGACATTTGGG + Intergenic