ID: 925436618

View in Genome Browser
Species Human (GRCh38)
Location 2:3843584-3843606
Sequence GGTGAAAGGTTGATTGCTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 104}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925436610_925436618 21 Left 925436610 2:3843540-3843562 CCCATAGGAAAGGTAATGTTAGC 0: 1
1: 0
2: 1
3: 12
4: 120
Right 925436618 2:3843584-3843606 GGTGAAAGGTTGATTGCTATGGG 0: 1
1: 0
2: 0
3: 5
4: 104
925436611_925436618 20 Left 925436611 2:3843541-3843563 CCATAGGAAAGGTAATGTTAGCA 0: 1
1: 0
2: 1
3: 5
4: 159
Right 925436618 2:3843584-3843606 GGTGAAAGGTTGATTGCTATGGG 0: 1
1: 0
2: 0
3: 5
4: 104
925436609_925436618 22 Left 925436609 2:3843539-3843561 CCCCATAGGAAAGGTAATGTTAG 0: 1
1: 0
2: 0
3: 9
4: 143
Right 925436618 2:3843584-3843606 GGTGAAAGGTTGATTGCTATGGG 0: 1
1: 0
2: 0
3: 5
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925436618 Original CRISPR GGTGAAAGGTTGATTGCTAT GGG Intronic
907241267 1:53082348-53082370 GGTGAAAGGTTGAAGCCTACGGG + Intronic
910331852 1:86082486-86082508 GGTGAAAGGTGGATGGATACAGG - Intronic
913182966 1:116340422-116340444 GATGAAAGATTGAATGCTCTAGG - Intergenic
914666034 1:149833277-149833299 TATGAAAGGTTGAATGCTCTAGG + Intergenic
914669731 1:149860517-149860539 TATGAAAGGTTGAATGCTCTAGG - Exonic
916721572 1:167488337-167488359 GGTAGAAGGATGATTGCAATGGG + Intronic
918965764 1:191345206-191345228 GGTGAAGGATTGATAGCAATTGG + Intergenic
919349335 1:196429219-196429241 TGTGAAGGGTTGATTTCTCTTGG - Intronic
922639406 1:227212484-227212506 GGTGAAGGGTTGAATGGGATAGG - Intronic
924260241 1:242222348-242222370 GCTGACCAGTTGATTGCTATTGG - Intronic
1066029402 10:31403945-31403967 TGTGAAAGGTAGATTGCTGCTGG + Intronic
1066442373 10:35450472-35450494 GCTGAGAGCTTGATTGCTAAGGG + Intronic
1067155757 10:43780064-43780086 GGTTAAAGTTGGATTGCAATGGG - Intergenic
1068481747 10:57598396-57598418 GGAGAAATATTCATTGCTATGGG - Intergenic
1070316975 10:75323066-75323088 GGAGAGAGGTTGATTGCAAGGGG - Intergenic
1070449423 10:76543124-76543146 AGTGAAGGGTTCCTTGCTATTGG - Intronic
1073395999 10:103218058-103218080 GGTGAAAGGATGATTTTTTTTGG + Intergenic
1076676745 10:132151046-132151068 GGTGAAAGGTTAATGGGTAGAGG - Intronic
1087367457 11:97239052-97239074 TGGGGAAGGTAGATTGCTATAGG + Intergenic
1089476147 11:118764439-118764461 GGTACAAAGTTGTTTGCTATGGG - Intronic
1096709288 12:53443514-53443536 GGGGAAAGCTGGATTGCCATGGG - Exonic
1098031359 12:66258037-66258059 GGTGACAGGTTGACTGCAGTGGG - Intergenic
1098261889 12:68680324-68680346 GGTGAAAGGATGCTTTCTTTTGG + Intergenic
1101241832 12:102846852-102846874 GGTGGATGGTGGAGTGCTATAGG - Intronic
1104534694 12:129608018-129608040 TGTGAAATATTGATTGCTGTGGG + Intronic
1105438293 13:20395641-20395663 TGTGAAAGGTGGATTGCCAAGGG - Intergenic
1109141429 13:58717303-58717325 GGTGAAAGGCTGACTGCTCATGG + Intergenic
1112799830 13:103098225-103098247 GATGCAAGGTTGATTTCTTTTGG + Intergenic
1117966335 14:61210425-61210447 GGGGAAAGGCTGATAGATATGGG - Intronic
1123501184 15:20882558-20882580 GGTGAAAGGTTAAATTCTGTAGG + Intergenic
1123558436 15:21456263-21456285 GGTGAAAGGTTAAATTCTGTAGG + Intergenic
1125424331 15:39534136-39534158 GGTGAAAGCCTGATTGGTATGGG - Intergenic
1129619262 15:77128939-77128961 GGTTAGAGGTAGAGTGCTATGGG + Intronic
1202966786 15_KI270727v1_random:183413-183435 GGTGAAAGGTTAAATTCTGTAGG + Intergenic
1133412138 16:5577837-5577859 TGTCAAAGGTTGATTTCTTTTGG + Intergenic
1135395711 16:22130200-22130222 GGTGGAAGTTTGACTGCAATAGG + Intronic
1135870866 16:26149095-26149117 GGTGAAAGGTGGACCACTATGGG - Intergenic
1138219388 16:55237983-55238005 TGTGAAACCTTGATTGCTAAAGG + Intergenic
1141839452 16:86565598-86565620 GGTGAGCGGTTGATTGCAAACGG - Intergenic
1142021392 16:87785060-87785082 GGTGAAATGTGGATTGCCCTTGG - Intergenic
1146701332 17:34962664-34962686 GGTGAAAGGGGCATTGTTATAGG + Exonic
1148326688 17:46787272-46787294 TGTGAAAGTTTTCTTGCTATTGG + Intronic
1149164723 17:53737456-53737478 ACTGAAAGGTAGTTTGCTATGGG - Intergenic
1150355133 17:64476592-64476614 GGCCAAAGGTTGATTGTTGTTGG + Intergenic
1155973966 18:32108244-32108266 GTTGAATGGTTGCTTGATATGGG - Intronic
1159443081 18:68506754-68506776 GGTGAAATGTATATTGCTAAAGG + Intergenic
1159839308 18:73378145-73378167 GGTGAAAGATTGAATGCAAAAGG + Intergenic
1160626942 18:80216915-80216937 GGTGAAGGGGACATTGCTATGGG + Intronic
1161186558 19:2925379-2925401 GGTGAAAGGTTGAGTACAATTGG + Intergenic
1166011122 19:39943517-39943539 GGGGAAAGCTGGATTGCCATGGG + Intergenic
925436618 2:3843584-3843606 GGTGAAAGGTTGATTGCTATGGG + Intronic
926820517 2:16847059-16847081 GGTGAAAGGTTGATTACTTCAGG - Intergenic
928291818 2:30045829-30045851 GATTAATGTTTGATTGCTATGGG + Intergenic
935154114 2:100466907-100466929 GGTGAAAAGGTGAAAGCTATTGG + Intergenic
935435238 2:103024119-103024141 GGTGGTAGGTTAGTTGCTATGGG - Intergenic
936763366 2:115813713-115813735 GCTGAAAGGTTATTTGCTGTAGG + Intronic
940562277 2:155313626-155313648 GGTGAATAGTTGAGTGCGATGGG - Intergenic
940698485 2:157011140-157011162 AGTGAAATGGTGATTGCTAGTGG + Intergenic
942948708 2:181698380-181698402 GGGCAAAGGTTGAGTGCTCTGGG - Intergenic
945701179 2:213172665-213172687 GTTGAAAAGTTGATAGCTTTTGG - Intergenic
1173823468 20:46032727-46032749 GGTGAAAGGATGTTTCCTAACGG - Intronic
1178830080 21:36048644-36048666 GGTGAAGGGTTGACTGCTTGTGG - Intronic
1179429153 21:41307365-41307387 GGAGAAAGTTTTATTGCTCTGGG - Intronic
950870194 3:16221609-16221631 GGTCAAAGCTGGCTTGCTATGGG - Intronic
952023372 3:29049847-29049869 GATGAAAGGTTGATCACTGTTGG + Intergenic
952438070 3:33292912-33292934 GATGAAAGGTTAATTCCTACAGG + Intronic
957010264 3:74997115-74997137 GGGGAAAGCTTCATTGCTTTTGG + Intergenic
958139574 3:89544179-89544201 GGAGAAAGGTCAGTTGCTATGGG + Intergenic
958938499 3:100284536-100284558 GGTGAAATATAGAGTGCTATGGG + Intronic
959134575 3:102400836-102400858 GGTGAGAGGTCCATTGCTACGGG - Intronic
959341444 3:105136471-105136493 GGTGAAAGGAAGAGTGCTAAAGG + Intergenic
959397781 3:105862888-105862910 GGTGAACCGTTGCTTGCTAAGGG - Intronic
970147051 4:13046975-13046997 GTTGAAAAGGTGACTGCTATGGG - Intergenic
970211714 4:13716770-13716792 GATGAATGGTAGATTGTTATGGG - Intergenic
974621388 4:64360749-64360771 GGGGAAAGGGTGAGTGCAATAGG + Intronic
977003714 4:91537752-91537774 GGTATATTGTTGATTGCTATGGG - Intronic
977245776 4:94629646-94629668 GTTGAAAGGCTGGTTGCTAATGG + Intronic
978649679 4:110985597-110985619 GGTGAAAGCTTGATTGAAGTTGG + Intergenic
985067002 4:186132427-186132449 GGTGAAAAGATGATTGTTATGGG + Intronic
988225538 5:28407538-28407560 GGTCAATGGGTCATTGCTATGGG + Intergenic
991632538 5:68670898-68670920 GGAGAAAGGTAGATTGATACTGG - Intergenic
998655055 5:144169833-144169855 GATGAAAAGTTACTTGCTATAGG + Exonic
1000960422 5:167594894-167594916 AGTGAAAGGTTGATTGTTTCTGG + Intronic
1008519690 6:52351396-52351418 GGTGCTGGGTTGCTTGCTATTGG - Intergenic
1013652008 6:112204955-112204977 GGTGAAATGTTAGTTGATATTGG + Intronic
1014826033 6:126049562-126049584 GGTGATTGGTTGATGTCTATGGG + Intergenic
1024491702 7:49993641-49993663 GGTGACAGGTTGATTACATTAGG - Intronic
1028226478 7:88257863-88257885 GATGAAAGCTTGATTGCTGTGGG - Intergenic
1030890859 7:114997262-114997284 GGTACATGGTTGAGTGCTATTGG + Intronic
1031216847 7:118904363-118904385 GCTCAAAGTTTGATTGGTATTGG + Intergenic
1038362738 8:26898601-26898623 GGAGAAAGGTTGAGTGCTGAAGG - Intergenic
1039021755 8:33215418-33215440 GGTTAAAGCTGCATTGCTATAGG + Intergenic
1041245729 8:55886569-55886591 GGTAAAATGTTTCTTGCTATGGG - Intronic
1051338599 9:16090653-16090675 GGTGAGAAGTTGTTTGCTTTGGG - Intergenic
1053429958 9:38035552-38035574 TGTGAAAGGTTGGGTGCCATGGG + Intronic
1060456543 9:123803859-123803881 GGTGAAAGCTTGGTTGTCATGGG - Intronic
1061438587 9:130583188-130583210 GGGGAAATGTTGATTGGTGTGGG + Intronic
1186942028 X:14519891-14519913 GTTGACTGGTTGATTGGTATAGG + Intergenic
1187443407 X:19340152-19340174 GGTGAAAGGATTATGGCTAGGGG - Intergenic
1189104635 X:38222679-38222701 GGGGAAAGGGGGATTGCTAGTGG - Intronic
1191225561 X:58039243-58039265 AGTGAAATGGTGATTGCCATGGG + Intergenic
1192594134 X:72388374-72388396 GGTGAATGGTTGATTAATAAAGG - Intronic
1193899982 X:87165453-87165475 GGTGGCAGGTTGATTACTTTGGG - Intergenic
1195953038 X:110297531-110297553 GGGGAAAGGTTGATTGGATTAGG + Intronic
1196416322 X:115475602-115475624 GGTGAAAGCCTGATTGCAGTGGG - Intergenic
1197594875 X:128452479-128452501 GGTGAAAGATTGCTGGCTAGAGG - Intergenic
1198389494 X:136159921-136159943 GGTCAGAGTTTGATTGCTTTGGG + Intronic
1199412820 X:147544459-147544481 GATGAAAGCTTGATTGGAATGGG + Intergenic
1201501800 Y:14651699-14651721 GGTGTGAGGATGAATGCTATTGG + Intronic
1201554720 Y:15256065-15256087 GGTGAAAGGTTGATACATAAAGG - Intergenic