ID: 925441031

View in Genome Browser
Species Human (GRCh38)
Location 2:3885447-3885469
Sequence AAGGGTGAAAATGGTTTGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925441031_925441037 22 Left 925441031 2:3885447-3885469 CCTAGCAAACCATTTTCACCCTT No data
Right 925441037 2:3885492-3885514 AATATCTATTCAGATCATTTCGG No data
925441031_925441038 23 Left 925441031 2:3885447-3885469 CCTAGCAAACCATTTTCACCCTT No data
Right 925441038 2:3885493-3885515 ATATCTATTCAGATCATTTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925441031 Original CRISPR AAGGGTGAAAATGGTTTGCT AGG (reversed) Intergenic
No off target data available for this crispr