ID: 925441032

View in Genome Browser
Species Human (GRCh38)
Location 2:3885456-3885478
Sequence GAAAGGAGGAAGGGTGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925441032_925441038 14 Left 925441032 2:3885456-3885478 CCATTTTCACCCTTCCTCCTTTC No data
Right 925441038 2:3885493-3885515 ATATCTATTCAGATCATTTCGGG No data
925441032_925441037 13 Left 925441032 2:3885456-3885478 CCATTTTCACCCTTCCTCCTTTC No data
Right 925441037 2:3885492-3885514 AATATCTATTCAGATCATTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925441032 Original CRISPR GAAAGGAGGAAGGGTGAAAA TGG (reversed) Intergenic
No off target data available for this crispr