ID: 925441032 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:3885456-3885478 |
Sequence | GAAAGGAGGAAGGGTGAAAA TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
925441032_925441038 | 14 | Left | 925441032 | 2:3885456-3885478 | CCATTTTCACCCTTCCTCCTTTC | No data | ||
Right | 925441038 | 2:3885493-3885515 | ATATCTATTCAGATCATTTCGGG | No data | ||||
925441032_925441037 | 13 | Left | 925441032 | 2:3885456-3885478 | CCATTTTCACCCTTCCTCCTTTC | No data | ||
Right | 925441037 | 2:3885492-3885514 | AATATCTATTCAGATCATTTCGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
925441032 | Original CRISPR | GAAAGGAGGAAGGGTGAAAA TGG (reversed) | Intergenic | ||
No off target data available for this crispr |