ID: 925441035

View in Genome Browser
Species Human (GRCh38)
Location 2:3885470-3885492
Sequence TGTTATGAAGAAGTGAAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925441035_925441037 -1 Left 925441035 2:3885470-3885492 CCTCCTTTCACTTCTTCATAACA No data
Right 925441037 2:3885492-3885514 AATATCTATTCAGATCATTTCGG No data
925441035_925441039 28 Left 925441035 2:3885470-3885492 CCTCCTTTCACTTCTTCATAACA No data
Right 925441039 2:3885521-3885543 TAAGAAATCTCTTTATCTATTGG No data
925441035_925441038 0 Left 925441035 2:3885470-3885492 CCTCCTTTCACTTCTTCATAACA No data
Right 925441038 2:3885493-3885515 ATATCTATTCAGATCATTTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925441035 Original CRISPR TGTTATGAAGAAGTGAAAGG AGG (reversed) Intergenic
No off target data available for this crispr