ID: 925441037

View in Genome Browser
Species Human (GRCh38)
Location 2:3885492-3885514
Sequence AATATCTATTCAGATCATTT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925441031_925441037 22 Left 925441031 2:3885447-3885469 CCTAGCAAACCATTTTCACCCTT No data
Right 925441037 2:3885492-3885514 AATATCTATTCAGATCATTTCGG No data
925441034_925441037 3 Left 925441034 2:3885466-3885488 CCTTCCTCCTTTCACTTCTTCAT No data
Right 925441037 2:3885492-3885514 AATATCTATTCAGATCATTTCGG No data
925441036_925441037 -4 Left 925441036 2:3885473-3885495 CCTTTCACTTCTTCATAACAATA No data
Right 925441037 2:3885492-3885514 AATATCTATTCAGATCATTTCGG No data
925441035_925441037 -1 Left 925441035 2:3885470-3885492 CCTCCTTTCACTTCTTCATAACA No data
Right 925441037 2:3885492-3885514 AATATCTATTCAGATCATTTCGG No data
925441033_925441037 4 Left 925441033 2:3885465-3885487 CCCTTCCTCCTTTCACTTCTTCA No data
Right 925441037 2:3885492-3885514 AATATCTATTCAGATCATTTCGG No data
925441030_925441037 25 Left 925441030 2:3885444-3885466 CCTCCTAGCAAACCATTTTCACC No data
Right 925441037 2:3885492-3885514 AATATCTATTCAGATCATTTCGG No data
925441032_925441037 13 Left 925441032 2:3885456-3885478 CCATTTTCACCCTTCCTCCTTTC No data
Right 925441037 2:3885492-3885514 AATATCTATTCAGATCATTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925441037 Original CRISPR AATATCTATTCAGATCATTT CGG Intergenic
No off target data available for this crispr