ID: 925441038

View in Genome Browser
Species Human (GRCh38)
Location 2:3885493-3885515
Sequence ATATCTATTCAGATCATTTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925441030_925441038 26 Left 925441030 2:3885444-3885466 CCTCCTAGCAAACCATTTTCACC No data
Right 925441038 2:3885493-3885515 ATATCTATTCAGATCATTTCGGG No data
925441035_925441038 0 Left 925441035 2:3885470-3885492 CCTCCTTTCACTTCTTCATAACA No data
Right 925441038 2:3885493-3885515 ATATCTATTCAGATCATTTCGGG No data
925441031_925441038 23 Left 925441031 2:3885447-3885469 CCTAGCAAACCATTTTCACCCTT No data
Right 925441038 2:3885493-3885515 ATATCTATTCAGATCATTTCGGG No data
925441033_925441038 5 Left 925441033 2:3885465-3885487 CCCTTCCTCCTTTCACTTCTTCA No data
Right 925441038 2:3885493-3885515 ATATCTATTCAGATCATTTCGGG No data
925441032_925441038 14 Left 925441032 2:3885456-3885478 CCATTTTCACCCTTCCTCCTTTC No data
Right 925441038 2:3885493-3885515 ATATCTATTCAGATCATTTCGGG No data
925441034_925441038 4 Left 925441034 2:3885466-3885488 CCTTCCTCCTTTCACTTCTTCAT No data
Right 925441038 2:3885493-3885515 ATATCTATTCAGATCATTTCGGG No data
925441036_925441038 -3 Left 925441036 2:3885473-3885495 CCTTTCACTTCTTCATAACAATA No data
Right 925441038 2:3885493-3885515 ATATCTATTCAGATCATTTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925441038 Original CRISPR ATATCTATTCAGATCATTTC GGG Intergenic
No off target data available for this crispr