ID: 925442505

View in Genome Browser
Species Human (GRCh38)
Location 2:3900590-3900612
Sequence AACATGGAGGTGCCTACACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925442505_925442509 -6 Left 925442505 2:3900590-3900612 CCTGGTGTAGGCACCTCCATGTT No data
Right 925442509 2:3900607-3900629 CATGTTGGCCCAGTTTTCACAGG No data
925442505_925442510 -5 Left 925442505 2:3900590-3900612 CCTGGTGTAGGCACCTCCATGTT No data
Right 925442510 2:3900608-3900630 ATGTTGGCCCAGTTTTCACAGGG No data
925442505_925442513 18 Left 925442505 2:3900590-3900612 CCTGGTGTAGGCACCTCCATGTT No data
Right 925442513 2:3900631-3900653 ATCAACCACTCCTGTTAGAGTGG No data
925442505_925442514 21 Left 925442505 2:3900590-3900612 CCTGGTGTAGGCACCTCCATGTT No data
Right 925442514 2:3900634-3900656 AACCACTCCTGTTAGAGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925442505 Original CRISPR AACATGGAGGTGCCTACACC AGG (reversed) Intergenic
No off target data available for this crispr