ID: 925442640

View in Genome Browser
Species Human (GRCh38)
Location 2:3901530-3901552
Sequence AAGTGGTACTAGAGGAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925442640_925442643 -5 Left 925442640 2:3901530-3901552 CCTGTTTTCCTCTAGTACCACTT No data
Right 925442643 2:3901548-3901570 CACTTTTACTTGAAAGTACTCGG No data
925442640_925442645 -3 Left 925442640 2:3901530-3901552 CCTGTTTTCCTCTAGTACCACTT No data
Right 925442645 2:3901550-3901572 CTTTTACTTGAAAGTACTCGGGG No data
925442640_925442644 -4 Left 925442640 2:3901530-3901552 CCTGTTTTCCTCTAGTACCACTT No data
Right 925442644 2:3901549-3901571 ACTTTTACTTGAAAGTACTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925442640 Original CRISPR AAGTGGTACTAGAGGAAAAC AGG (reversed) Intergenic
No off target data available for this crispr