ID: 925443269

View in Genome Browser
Species Human (GRCh38)
Location 2:3906553-3906575
Sequence CAGGGTCATCACTCAGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925443269_925443274 25 Left 925443269 2:3906553-3906575 CCATTCTCTGAGTGATGACCCTG No data
Right 925443274 2:3906601-3906623 CTCAGTTCACTTTCCTAGTAAGG No data
925443269_925443271 -6 Left 925443269 2:3906553-3906575 CCATTCTCTGAGTGATGACCCTG No data
Right 925443271 2:3906570-3906592 ACCCTGTGGACATGTGATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925443269 Original CRISPR CAGGGTCATCACTCAGAGAA TGG (reversed) Intergenic
No off target data available for this crispr