ID: 925445932

View in Genome Browser
Species Human (GRCh38)
Location 2:3927028-3927050
Sequence GCTGAGGTGACATGTGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925445926_925445932 12 Left 925445926 2:3926993-3927015 CCATGTTTTCCTCTCAAGGCTTA No data
Right 925445932 2:3927028-3927050 GCTGAGGTGACATGTGGGGCTGG No data
925445927_925445932 3 Left 925445927 2:3927002-3927024 CCTCTCAAGGCTTAATGACAGTT No data
Right 925445932 2:3927028-3927050 GCTGAGGTGACATGTGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925445932 Original CRISPR GCTGAGGTGACATGTGGGGC TGG Intergenic