ID: 925449533

View in Genome Browser
Species Human (GRCh38)
Location 2:3956969-3956991
Sequence CCTGCTCTGCAGCAGCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925449533_925449543 18 Left 925449533 2:3956969-3956991 CCCTCCAGCTGCTGCAGAGCAGG No data
Right 925449543 2:3957010-3957032 CATGCCACCCTGCAGCACCACGG No data
925449533_925449538 -10 Left 925449533 2:3956969-3956991 CCCTCCAGCTGCTGCAGAGCAGG No data
Right 925449538 2:3956982-3957004 GCAGAGCAGGCAACCTTCCAGGG No data
925449533_925449544 19 Left 925449533 2:3956969-3956991 CCCTCCAGCTGCTGCAGAGCAGG No data
Right 925449544 2:3957011-3957033 ATGCCACCCTGCAGCACCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925449533 Original CRISPR CCTGCTCTGCAGCAGCTGGA GGG (reversed) Intergenic
No off target data available for this crispr