ID: 925450836

View in Genome Browser
Species Human (GRCh38)
Location 2:3968200-3968222
Sequence CTGGTGGCTGAACCCTGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 224}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925450836_925450840 16 Left 925450836 2:3968200-3968222 CCAGCTCAGGGTTCAGCCACCAG 0: 1
1: 0
2: 2
3: 20
4: 224
Right 925450840 2:3968239-3968261 CTCTTGCCACGTTTGGAATTTGG 0: 1
1: 0
2: 0
3: 8
4: 104
925450836_925450839 9 Left 925450836 2:3968200-3968222 CCAGCTCAGGGTTCAGCCACCAG 0: 1
1: 0
2: 2
3: 20
4: 224
Right 925450839 2:3968232-3968254 TTGTTATCTCTTGCCACGTTTGG 0: 1
1: 0
2: 0
3: 14
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925450836 Original CRISPR CTGGTGGCTGAACCCTGAGC TGG (reversed) Intergenic
900157473 1:1208980-1209002 CTGCAGGCTGAACCGTGTGCAGG + Intergenic
900415323 1:2532031-2532053 CTGGGGGCTCATCTCTGAGCAGG + Intergenic
900687646 1:3958750-3958772 CTGGGGGCTGAATCCTGGCCTGG + Intergenic
901327429 1:8376331-8376353 ATGGGGGCTCTACCCTGAGCTGG - Intronic
901861577 1:12078083-12078105 CTGGTGTCTGCACTGTGAGCTGG + Intronic
902080727 1:13818852-13818874 CTGGAGACTTGACCCTGAGCTGG + Intronic
903049445 1:20589751-20589773 CTGGTGGTGAAACCCTGGGCTGG + Intronic
903135324 1:21305793-21305815 CTGGTGGCTGGAATCTGAGCTGG + Intronic
903370158 1:22830133-22830155 CTGGTGGGCCAACCCTGGGCTGG + Intronic
903649485 1:24914176-24914198 CAAGAGGCTGAACACTGAGCTGG - Intronic
904616074 1:31750649-31750671 CTGGTCCCAGAGCCCTGAGCAGG + Intronic
905038347 1:34931134-34931156 CTCTTGACTGAACCCTGGGCTGG - Intergenic
905459287 1:38111827-38111849 CTGGTAGCGGCTCCCTGAGCTGG - Intergenic
907241684 1:53084463-53084485 CTGGTGGGTCTGCCCTGAGCTGG + Intronic
913027165 1:114855047-114855069 CTGGGGACTGAGCCCAGAGCGGG + Intronic
913448050 1:118970832-118970854 CATGTGGCTGAGCCCTAAGCTGG + Intronic
914224268 1:145707486-145707508 CAGCTGGCTGGGCCCTGAGCTGG + Intronic
914709441 1:150199383-150199405 GTGGTTGCTGAACCCTGAGGTGG + Intergenic
919986030 1:202675804-202675826 CAGGTGGCTTGACCCTAAGCTGG - Intronic
921655725 1:217734824-217734846 CTGGAGGTGGAACCCTGAGGTGG - Intronic
922461125 1:225815101-225815123 CTGGTGGCTGTGCCCCGACCTGG - Intronic
922595308 1:226808751-226808773 CTGCTGGCTGACCCCTGCGGAGG + Intergenic
1065757038 10:28940127-28940149 CTGTTTGCTGAACCCTTGGCGGG + Intergenic
1067178260 10:43965556-43965578 CTCTTGGCTGAACCCAGAGGTGG + Intergenic
1067279655 10:44861538-44861560 CTGGGGGCTGAAAGCTCAGCAGG + Intergenic
1067345294 10:45433838-45433860 CTGAGGACTGAACTCTGAGCAGG - Intronic
1067791081 10:49288249-49288271 CTGGTGCCAGAGCCCAGAGCTGG - Intergenic
1069866932 10:71509991-71510013 CAGGTGGCTGAACTCTCAGCAGG - Intronic
1070788125 10:79174144-79174166 CTGGTGGGTGCAACCTGTGCTGG - Intronic
1070981907 10:80655172-80655194 CTGCAGGCTGAGCCCTGAGAAGG - Intergenic
1071026961 10:81126402-81126424 CTGGAGGCTGGAAGCTGAGCTGG + Intergenic
1072288558 10:93940824-93940846 CTGGTTGCTGAATCCTCCGCAGG - Intronic
1076439072 10:130467203-130467225 CTGGAGGCTGCAGTCTGAGCTGG + Intergenic
1076803815 10:132845280-132845302 CTGGTGACTCAACCCAGAGGTGG - Intronic
1077039621 11:513855-513877 GTGGTGGCTGAAGGCTGAGGTGG - Intergenic
1077501510 11:2911602-2911624 CAGGCGGCTGGGCCCTGAGCCGG - Intronic
1082980098 11:59113354-59113376 CTGGTGGATGAAGGCAGAGCAGG + Intronic
1084459890 11:69290866-69290888 CTGGTGGCTGCAACCTGGGCTGG + Intergenic
1084589964 11:70084848-70084870 CTGCTGGCTGACCCCAGTGCAGG - Intronic
1085261089 11:75205124-75205146 CTGGAGGCAGAGCACTGAGCTGG + Exonic
1085455470 11:76662945-76662967 CTGGGGCCTGCTCCCTGAGCTGG + Intronic
1091226435 11:133959023-133959045 CAGGAGGCAGAACCCTGAGTAGG - Intergenic
1091331778 11:134736423-134736445 CTGGTGGTTGCACCTTGAGGAGG - Intergenic
1092125282 12:6071133-6071155 CTGGTACCTGAAACCAGAGCTGG + Intronic
1092237118 12:6817248-6817270 GTGGGTGCTGAACCCTGAGGCGG + Exonic
1094213875 12:27920572-27920594 TGGGTGGCTGAACACTGAGCTGG + Intergenic
1094385589 12:29889684-29889706 CTGGTGCCTGACCCCAGAGGAGG + Intergenic
1096394985 12:51259013-51259035 CTGATAGTTGAACCCTGAGGAGG + Intronic
1096972991 12:55682304-55682326 CTGGGGGCCGAACCCTGGGGCGG - Intronic
1100800522 12:98225922-98225944 CTGGTGGCAGTCCCTTGAGCAGG + Intergenic
1102049101 12:109849459-109849481 CTGGTGGCTTGACCCAGAGCAGG - Intergenic
1102146541 12:110658909-110658931 CTGGGGACTGGCCCCTGAGCTGG - Intronic
1103522532 12:121545963-121545985 CTGGAGTCTGAAGGCTGAGCAGG - Intronic
1104230673 12:126880968-126880990 CAGCTGGCTGCACCCTGGGCTGG - Intergenic
1104873938 12:132019927-132019949 CTGGGTGCTGGTCCCTGAGCTGG + Intronic
1105864944 13:24451176-24451198 GTGGTGTCTGAGCCCTGACCTGG + Intronic
1106136277 13:26975929-26975951 CTGGAGTCTGTACCCGGAGCTGG + Intergenic
1107413296 13:40177377-40177399 CTGGTGGCGGAAGCTTGAGTAGG + Intergenic
1111639799 13:90953372-90953394 ATTGTGGATGTACCCTGAGCAGG + Intergenic
1113860918 13:113486284-113486306 GTGGGAGCTGAACACTGAGCAGG + Intronic
1113908887 13:113832548-113832570 CTGCTGGCCGAACCCTGGCCCGG + Intronic
1114763534 14:25344792-25344814 CAGCTGGCAGAACCCTGAGGTGG + Intergenic
1121435165 14:93914503-93914525 CTGCTGGCTGTGGCCTGAGCTGG - Intergenic
1124627466 15:31316602-31316624 CTGGTGACTGACCCCAGAGCTGG + Intergenic
1126851237 15:52798434-52798456 CGGGTGGCTGGTGCCTGAGCAGG + Intergenic
1127193729 15:56561811-56561833 CTGGAGGCTGAAGCCTGGCCGGG + Intergenic
1128744035 15:70101263-70101285 CGGCTGCCTGAACCCTGAGCAGG + Intergenic
1128779842 15:70352118-70352140 CTGGTGCCTGAGCCCTGGCCTGG - Intergenic
1129552125 15:76463861-76463883 CTAGTGGCAGAACCATGACCTGG - Intronic
1131017282 15:89068384-89068406 CTGGTGTCTGAGACCTCAGCTGG + Intergenic
1131255191 15:90857463-90857485 CTGTTTGCTAAGCCCTGAGCAGG + Intergenic
1132331006 15:101012653-101012675 CCGGGGGCTGAAGCCTGTGCAGG - Intronic
1132604332 16:787465-787487 CTGGTGGCAGAACCTGGAGTGGG + Exonic
1133216123 16:4293567-4293589 CTGGTGGCTCAACCGTGGCCAGG + Intergenic
1137615484 16:49843875-49843897 ATGGTGGCTGATCCCTGGCCAGG + Intronic
1137750381 16:50857226-50857248 CTGTTGGCTGAAACCTTGGCTGG + Intergenic
1139897538 16:70299474-70299496 ATGGAGCCTGGACCCTGAGCTGG + Intronic
1140924160 16:79566677-79566699 TTAGTGGATGAACCCTGAACTGG + Intergenic
1141405393 16:83788223-83788245 CGAGTAGCTGAACCGTGAGCAGG - Intronic
1142349564 16:89573932-89573954 CTGCGGGCTGATCCCTGAGCAGG + Intergenic
1144673140 17:17144193-17144215 CTGGAGGCTGAAGACAGAGCGGG - Intronic
1145216659 17:21057575-21057597 CTGTGGGCTGGAACCTGAGCTGG - Intergenic
1145244966 17:21262715-21262737 TTGGAGGCTGACACCTGAGCAGG + Intergenic
1146812433 17:35914678-35914700 CAGGTGGCTGATGGCTGAGCTGG + Intergenic
1148211903 17:45813650-45813672 CTGTGGGCAGCACCCTGAGCTGG + Intronic
1148754088 17:49963441-49963463 CTGGTCTCTGAATCCTGATCAGG - Intergenic
1148991988 17:51674014-51674036 CTGGAGGGTGAAGCCTGAGCAGG - Intronic
1149464733 17:56868276-56868298 CTGCTGGCAGAGCCCTGAACTGG - Exonic
1149776963 17:59365785-59365807 CTGGTGGCTGGACAGTGAGTTGG + Intronic
1150343471 17:64387025-64387047 CTGGAGTCTGAACCCTGTCCTGG - Intronic
1151700176 17:75738597-75738619 CACGTGGCTGACCCCAGAGCAGG - Intronic
1152569415 17:81115176-81115198 CAGGTGGCTGAGCCCACAGCAGG + Intronic
1152661096 17:81542516-81542538 CTGGTGGCTGCACTGTGTGCTGG + Intronic
1152814181 17:82397758-82397780 CTGGTGGCTGGAACCTCACCGGG - Intronic
1153956888 18:10104029-10104051 CTGCTGGCTGCATCCTAAGCAGG - Intergenic
1154165846 18:12013758-12013780 CTGGGGACTGATCCGTGAGCAGG - Intronic
1155261644 18:24049517-24049539 CTGGGTGCTGAACCCTGTGCTGG + Intronic
1157567156 18:48687190-48687212 CTTGTGGCTGAGCCCTGGACAGG + Intronic
1158009989 18:52717490-52717512 ATTGTGGCTGAACACTGGGCTGG - Intronic
1160980393 19:1813993-1814015 CTGGGGGCTGAAGCCAGGGCTGG + Intergenic
1160988051 19:1848574-1848596 CTGGTGACGGACCCCTGGGCCGG + Intergenic
1162480492 19:10924330-10924352 CTGGTGGCTGAGCCCAGTGCTGG + Intronic
1162935618 19:13980165-13980187 CAGGAGGCAGAGCCCTGAGCCGG - Intronic
1163819365 19:19487347-19487369 CAGGTTCCTGCACCCTGAGCTGG - Intronic
1165567675 19:36745460-36745482 CTGGTCTCTGAACTCTGGGCAGG - Exonic
1165942689 19:39423158-39423180 CTGGTGGCTGGAGCCTCAGCTGG - Exonic
925450836 2:3968200-3968222 CTGGTGGCTGAACCCTGAGCTGG - Intergenic
926233990 2:11025717-11025739 CTGGTGGGAGATTCCTGAGCAGG + Intergenic
927081311 2:19633608-19633630 CTGGTGGCTGGACCAGGAGAAGG - Intergenic
930622129 2:53654492-53654514 CTGTTGGCTGGAACCTTAGCTGG + Intronic
933474379 2:82770742-82770764 CTGGGTGCTGAGACCTGAGCTGG - Intergenic
934278220 2:91589934-91589956 CTGCTGGCTGCATCCTGAGACGG + Intergenic
938297745 2:130188995-130189017 CTGTTGGCTGAACCCTTGTCTGG + Intronic
938459022 2:131485673-131485695 CTGTTGGCTGAACCCTTGTCTGG - Intronic
938685134 2:133730675-133730697 CTGGTAGGGGAACCCTGAGGAGG + Intergenic
942043042 2:172083464-172083486 CTGGTGGCGGAATCATTAGCTGG + Intergenic
942547713 2:177081879-177081901 GTGGTGGCTGAAGACTGAGGTGG - Intergenic
947309803 2:228788877-228788899 CTGGTCTCTGACTCCTGAGCAGG + Intergenic
948844938 2:240678555-240678577 CTGGAGGCTGGAGTCTGAGCTGG - Intronic
948848922 2:240696324-240696346 CTGGAGGCTGGAGTCTGAGCTGG + Intronic
948857528 2:240736973-240736995 TGTGTGGCTGAACCCTGTGCCGG + Intronic
1169150128 20:3283065-3283087 CTGGATGTTCAACCCTGAGCAGG + Intronic
1170393029 20:15895638-15895660 CTGGTGGCGGCAGCCTGGGCAGG + Intronic
1174111389 20:48200428-48200450 ATGGTGGCTGATCCGGGAGCAGG + Intergenic
1174386482 20:50190867-50190889 CTGGTGGCTGGACCCTCGGGTGG - Exonic
1174535429 20:51247752-51247774 CTGGAGGCTGAAGCCTGCACTGG + Intergenic
1174846408 20:53947697-53947719 CCGATCTCTGAACCCTGAGCTGG + Intronic
1175014567 20:55775412-55775434 CTGGTGGCTGTCTCCTGAACTGG - Intergenic
1175810103 20:61853218-61853240 CTGGGAGCTGAAGCCTGAGGTGG + Intronic
1177038529 21:16075850-16075872 CTGGTTGCTGAACCAAGAGGAGG + Intergenic
1179949201 21:44700227-44700249 CTGGTGGTGGAACCCTGGACTGG - Intronic
1179961038 21:44767092-44767114 CTGGGGCCTGGACCCTGGGCTGG - Intergenic
1180834885 22:18924955-18924977 CCGGTGGGTGAACACTAAGCTGG - Intronic
1181181769 22:21073497-21073519 CTGTTGGCTGAACCGTCATCTGG - Intergenic
1181374315 22:22443524-22443546 CTTGTGCCTCAACCCCGAGCAGG - Intergenic
1182088068 22:27575070-27575092 CTGGTGGCAGATCTCTGAGCTGG - Intergenic
1183024622 22:35055354-35055376 CTGGTTGCTAAACCCTGAAAGGG + Intergenic
1183408548 22:37642022-37642044 CTGGTCTCTGATCCCAGAGCAGG + Intronic
1183723464 22:39575437-39575459 CCTGTGCCTGAACCCTGAACAGG + Intronic
1184178980 22:42806437-42806459 CTGGGGTCTGAACCCTGAAGAGG + Intronic
1184686283 22:46097863-46097885 CTGGTGGCTGAAGACTGGGGAGG - Intronic
1184855867 22:47146335-47146357 CTGATGGCAGGACTCTGAGCTGG - Intronic
1203284974 22_KI270734v1_random:150254-150276 CCGGTGGGTGAACACTAAGCTGG - Intergenic
950018790 3:9771658-9771680 GTGGGGGCTCAGCCCTGAGCAGG - Intronic
950362945 3:12462615-12462637 CTGGCGGCTGCTCTCTGAGCCGG - Intergenic
951132966 3:19069636-19069658 CTGTTGGCTGAGACCTAAGCTGG + Intergenic
951930697 3:27963731-27963753 CAAGAGGCTGAACCCTGTGCAGG - Intergenic
953618139 3:44510456-44510478 CTGGAGGCTGCACCCGGGGCGGG - Intronic
954093165 3:48301361-48301383 CTGGTGGCCGGGCCCTGTGCCGG - Intronic
954559024 3:51539829-51539851 TTGGTGGCTGAACATTGAGGTGG + Intergenic
954672720 3:52299282-52299304 CTGGTGGCTGATGGCTGAGCTGG + Intergenic
954706896 3:52485697-52485719 CTGGTTGCCAGACCCTGAGCTGG - Intronic
955190179 3:56754428-56754450 GTGGAGGCACAACCCTGAGCTGG + Intronic
959146330 3:102550129-102550151 CTAGTAGATGAACACTGAGCAGG - Intergenic
960582105 3:119289590-119289612 CTGGTGGTTTCACCCTGGGCAGG + Intergenic
960867785 3:122219443-122219465 TTGGTCCCTGAACCCTGATCTGG - Intronic
962487712 3:135861146-135861168 ATGGAGGCTGAAGCCTGTGCAGG - Intergenic
962846724 3:139280003-139280025 CTGGGGGCTGAGCCCTGGCCAGG + Intronic
966658487 3:182386870-182386892 CTGGCTGCTGAACTATGAGCAGG - Intergenic
969094832 4:4724435-4724457 CCCCTGGCTGAACCCTGAGGAGG + Intergenic
969298291 4:6282159-6282181 ATGCTGGCTGAACTCTGAGGCGG - Intronic
973148771 4:46861889-46861911 CTTGGGGTGGAACCCTGAGCTGG - Intronic
973745715 4:53961192-53961214 CAGGTGGCAGGAACCTGAGCAGG - Intronic
974016888 4:56656151-56656173 CCGGTGGCTGCACGCTGAGCGGG + Intronic
980458802 4:133077899-133077921 CTGTTGACTGAACGCTTAGCTGG - Intergenic
980504465 4:133697201-133697223 ATGGGAGCTGAACACTGAGCAGG + Intergenic
982148713 4:152427926-152427948 CTGGTTGCTGAACCTTTTGCAGG - Intronic
984853175 4:184171223-184171245 CTGCTGGCTGAGACCTTAGCTGG + Intronic
985535635 5:464469-464491 CTGGATGCTGAATTCTGAGCAGG - Intronic
985585770 5:733088-733110 CTGGAAGCTGACCCCAGAGCAGG + Intronic
985599440 5:818892-818914 CTGGAAGCTGACCCCAGAGCAGG + Intronic
985600192 5:824492-824514 CTGGAAGCTGACCCCAGAGCAGG + Intronic
985770787 5:1809362-1809384 CTTGAGTCTGAACCCAGAGCGGG + Intronic
985925285 5:3011297-3011319 CAGGGGTCAGAACCCTGAGCCGG - Intergenic
986203287 5:5599225-5599247 CTGGTGACCAAACCCTGAGCAGG + Intergenic
986536523 5:8793737-8793759 CTGGTGGCTGGAGGATGAGCTGG - Intergenic
987368894 5:17175200-17175222 CTGCTGGCTGGAACCTTAGCTGG + Intronic
987696549 5:21341345-21341367 GTGCTGGCTGAGGCCTGAGCGGG + Intergenic
988755654 5:34245225-34245247 GTGCTGGCTGAGGCCTGAGCGGG - Intergenic
988912598 5:35859508-35859530 CTGGTGGCAGAACTGTGAACTGG + Intronic
988935113 5:36074007-36074029 CTGGTGATTTAACCCTCAGCTGG - Intergenic
991743905 5:69710996-69711018 GTGCTGGCTGAGGCCTGAGCGGG - Intergenic
991753804 5:69844246-69844268 GTGCTGGCTGAGGCCTGAGCGGG + Intergenic
991795477 5:70290728-70290750 GTGCTGGCTGAGGCCTGAGCGGG - Intergenic
991803421 5:70400973-70400995 GTGCTGGCTGAGGCCTGAGCGGG + Intergenic
991823275 5:70586264-70586286 GTGCTGGCTGAGGCCTGAGCGGG - Intergenic
991833120 5:70719359-70719381 GTGCTGGCTGAGGCCTGAGCGGG + Intergenic
991887844 5:71290247-71290269 GTGCTGGCTGAGGCCTGAGCGGG - Intergenic
995238191 5:109854732-109854754 ATGGTGGATGAAACCTGAGAAGG + Intronic
997904274 5:137799571-137799593 GGGGTGGCTGAACGCGGAGCAGG - Intergenic
998390211 5:141782687-141782709 CTGATGTCTGAGTCCTGAGCTGG + Intergenic
998417531 5:141956660-141956682 CTGCTGGCTGAGCCAAGAGCTGG - Exonic
999203679 5:149833510-149833532 TCGGAGACTGAACCCTGAGCTGG + Exonic
1000153570 5:158527979-158528001 CTGGAAGCTGAACTCTCAGCAGG + Intergenic
1001663036 5:173410911-173410933 CCGTTCACTGAACCCTGAGCTGG - Intergenic
1002136835 5:177112881-177112903 CTGCTGGCTGGGTCCTGAGCTGG + Intergenic
1002330160 5:178435433-178435455 CTGGGTGCGGAGCCCTGAGCTGG + Intronic
1002334244 5:178467114-178467136 ATGTGGACTGAACCCTGAGCTGG + Intronic
1005554293 6:26957000-26957022 GTGCTGGCTGAGGCCTGAGCGGG - Intergenic
1007593841 6:43039396-43039418 TCGGGGGCTGATCCCTGAGCTGG - Intronic
1008048913 6:46880199-46880221 CTGGTGTCTGAGCCCTGAGGAGG + Intronic
1009634222 6:66243252-66243274 CAGGTGGATGAAGCCTGTGCTGG + Intergenic
1013217679 6:108043854-108043876 CTGCTCGCTGAACCTTAAGCTGG + Exonic
1013285007 6:108673648-108673670 TTGGTAGCTAAACCCTGAGATGG + Intronic
1013874509 6:114806988-114807010 CTGGAGGCTGAAGGCTGAGGTGG + Intergenic
1015368618 6:132425444-132425466 CTGCTGGCTGAAACCTGAGCAGG + Intergenic
1017005434 6:150025359-150025381 CTGGTGGATGGAGCCTAAGCGGG - Intronic
1018072126 6:160174055-160174077 CTGGGGGCTGACCACTGAGGAGG + Intronic
1018962771 6:168459790-168459812 CTGGTGGGTGAGCCCCGGGCTGG + Intronic
1019014951 6:168873467-168873489 CTGGTGACAGAACCCCGAGCTGG + Intergenic
1021108789 7:16670614-16670636 CTGTTGGCTAGACCCTGAGTGGG + Intronic
1021387216 7:20045761-20045783 CTGGCGCCTAAACACTGAGCAGG - Intergenic
1022339741 7:29456825-29456847 CTGGTGGCTGCCTCCTGGGCTGG + Intronic
1023329959 7:39104430-39104452 CCGGTGGCTGGAACCTTAGCTGG + Intronic
1024000593 7:45186893-45186915 ATGATGGCTGAACCCTGTGTGGG + Intergenic
1024155889 7:46624701-46624723 GTAGTGACTGAACCCTGTGCAGG - Intergenic
1024971702 7:55077866-55077888 CTGGACATTGAACCCTGAGCAGG + Intronic
1025739198 7:64182627-64182649 CTGCTGGCTGAGGCCTGTGCCGG + Intronic
1026185472 7:68079640-68079662 CTGGTGGCTTAGCCCTGGGAGGG + Intergenic
1029714290 7:102317642-102317664 CTGGCGGCTGAGCCCTCAGGAGG + Intronic
1034254517 7:149717166-149717188 CTGATGGCTCAACACAGAGCTGG - Intronic
1034574927 7:151988357-151988379 ATGTTGGCAGAACGCTGAGCTGG + Intronic
1035564394 8:631448-631470 CTGGGGTCTGTAACCTGAGCGGG + Intronic
1035632290 8:1117262-1117284 CTGATGGCACAACCCTGGGCAGG + Intergenic
1035679925 8:1480482-1480504 CGGCTGGCTGAGCCCTGACCTGG + Intergenic
1040993651 8:53379085-53379107 GTGGTGGCTGAACACTGGGAAGG - Intergenic
1041397133 8:57402913-57402935 CAGCTGCCTGAAACCTGAGCTGG - Intergenic
1043651060 8:82592588-82592610 CTGGTGACTGTCCCCTGAACTGG + Intergenic
1046482919 8:114846769-114846791 CTGGTGGCTGAAGCCTGCTCTGG - Intergenic
1047049680 8:121097025-121097047 GTGGTTTTTGAACCCTGAGCAGG + Intergenic
1047371905 8:124262955-124262977 CTGCTGGCTGCCCCCTGACCAGG + Intergenic
1047607868 8:126492549-126492571 CTGGTGCCTCAACTCAGAGCTGG - Intergenic
1050592728 9:7176525-7176547 CTTGTGGCTGAACTCTGAGCTGG + Intergenic
1051345273 9:16145625-16145647 CTGGTGGCTGGTGCCTGAACAGG - Intergenic
1051802570 9:20952631-20952653 CTCGTTGCTGAACGCTGAGGAGG + Intronic
1052772829 9:32705197-32705219 CTGCAGGGTGAGCCCTGAGCAGG + Intergenic
1052935178 9:34087146-34087168 CTGTTGGCTTAGCCCTGAGATGG - Exonic
1056332609 9:85534301-85534323 ATGTTGGCTGAATCCTGAGTGGG - Intergenic
1057440869 9:95082300-95082322 CTGGTGACAGAACGATGAGCAGG - Intronic
1060988592 9:127835608-127835630 CTGGTGGCCAAGCCCTGAGTGGG + Intronic
1061037826 9:128123222-128123244 CGGGAAGCTGAAGCCTGAGCAGG + Intronic
1061309675 9:129753936-129753958 CTGGTGGATGAAGCCTGAAATGG - Intergenic
1061813002 9:133173863-133173885 CTTGTGGATGAACCATAAGCTGG - Intergenic
1062587477 9:137255712-137255734 CTGGTGGCTGAGTCCTGTTCTGG + Intronic
1189054694 X:37686308-37686330 CAGGTGGCTGAGCCCCAAGCCGG + Intronic
1190510183 X:51166576-51166598 CTGGAGGCTGAAACCTTGGCTGG + Intergenic
1198940085 X:141944782-141944804 CTTGAGGATGAACCCTGATCTGG + Intergenic